Inligting

Gegewe die aantal individue wat 'n resessiewe versteuring het, hoe kan mens die waarskynlikheid bereken dat die versteuring oorgeërf is?

Gegewe die aantal individue wat 'n resessiewe versteuring het, hoe kan mens die waarskynlikheid bereken dat die versteuring oorgeërf is?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Net om duidelik te wees, dit is nie huiswerk nie. Gestel 'n biologiese gesin het vyf kinders, waarvan twee 'n sekere resessiewe genetiese afwyking het wat nie seksgekoppel is nie. Die ouers self het nie hierdie afwyking nie. Ek wil die waarskynlikheid skat dat die ouers draers is. Hoe kan ek dit doen, behalwe om hierdie waarskynlikheid direk uit 'n laboratoriumstudie te kry?

Hierdie probleem blyk te wees waar Bayesiese statistieke kan help. Al wat ek moet weet is: 1) die waarskynlikheid dat die ouers draers sal wees, aangesien hulle nie die siekte het nie, maar 2/5 van die kinders wel. 2) Die waarskynlikheid dat die ouers draers is en 3) Die waarskynlikheid dat die kinders die afwyking sal hê.

3 Ek kan seker vind sonder te veel moeite. #2, ek raai, is 'n Hardy-Weinberg probleem - ek moet net die relevante statistieke vind vir mense van die ouers se agtergronde. Maar ek het geen benul hoe om met #1 te begin nie.


Aanvaar…

  1. Die ouers is die regte biologiese ouers (geen bedrog word toegelaat nie!)
  2. Daar is 'n suiwer dominansie/resessieiwiteit verhouding tussen die allele en geen individu kan die versteuring uitdruk sonder om homosigoties te wees vir die siekte wat alleel veroorsaak nie
  3. De novo mutasies vir die versteuring is skaars genoeg om geïgnoreer te word in die berekening van hierdie waarskynlikheid
  4. Trisomie en monosomie is nie betrokke nie

, dan moet die twee ouers noodwendig draer wees (albei van hulle) solank ten minste een van hul kinders die siekte uitdruk.

Let wel, terloops dat sommige van die bogenoemde aannames te streng is en gedeeltelik vrygestel kan word.


Hierdie vraag vereis nie enige ingewikkelde Bayesiaanse statistieke (of enige statistieke) of enige gebruik van Hardy-Weinberg-reël nie. As 'n kind 'n suiwer resessiewe siekte uitdruk, dan is hy noodwendigaa, waarais die resessiewe alleel enAis die dominante allele(s). Dit beteken dat albei ouers ten minste een moet hêa. Omdat geen ouers die siekte uitdruk nie, is albei ouers noodwendigAa(ofaA)


Vraag: 1 A) Sistiese fibrose is 'n outosomale resessiewe siekte, 1 uit elke 2500 individue van Kaukasiese afkoms in die VSA het sistiese fibrose. Watter frekwensie van sistiese fibrose-draers sou jy verwag in die Kaukasiese bevolking van die VSA onder Hardy Weinberg-ewewig? Wys jou werk. (1 Pt) 1 B) Jy weet dat Pikkewyn Tuxedo-kleur 'n Klassieke Mendelian is.

1 A) Sistiese fibrose is 'n outosomale resessiewe siekte, 1 uit elke 2500 individue van Kaukasiese afkoms in die VSA het sistiese fibrose. Watter frekwensie van sistiese fibrose draers sou jy verwag in die Kaukasiese bevolking van die VSA onder Hardy Weinberg Equilibrium? Wys jou werk. (1 punt)

1 B) Jy weet dat pikkewyn-smokingkleur 'n klassieke Mendeliaanse enkelgeen-eienskap is, die alleel vir swart en wit tuxedo kleur (T) is dominant oor grys en wit tux kleuring (t). In 'n populasie van pikkewyne is daar 400 swart en wit smoking pikkewyne en 200 grys en wit smoking pikkewyne.

(i) Watter waargenome genotipiese of alleliese frekwensies kan uit hierdie scenario bereken word sonder om Hardy Weinberg-ewewig te aanvaar? (1,5 pt)

(ii) Verduidelik in een tot twee sinne waarom verskille tussen waargenome en verwagte genotipefrekwensies kan ontstaan. (1 punt)

1 C) Jy bestudeer die oorerwing van eksterne keratienkenmerke in 'n dinosourus. Ontleding het bevind dat die teenwoordigheid van vere te wyte is aan kodominansie tussen die AS (skubbe) en AH (horings) allele. In een generasie van 'n bevolking vind jy 78 afgeskaalde dinosourusse, 76 geveerde dinosourusse en 64 horingdinosourusse.

(i) Wat is die waargenome alleelfrekwensies van AS en AH? Gebruik p vir die frekwensie van AS en q vir die frekwensie van AH . Wys jou werk. (1,5 pt)

(ii) Wat is die waargenome genotipiese frekwensies? Wys jou werk. (1 punt)

(iii) Gegewe die alleliese frekwensies wat hierbo bereken is, wat is die verwagte aantal afgeskupte, geveerde en horing dinosourusse in 'n populasie van dieselfde grootte (218) onder Hardy Weinberg Ewewig? Wys jou werk. (1,5 pt)

(iv) Gebruik 'n chi-kwadraattoets om te ondersoek of die geen wat jy bestudeer onder Hardy Weinberg-ewewig in hierdie populasie is. Wys jou werk. Aanvaar of verwerp jy die nulhipotese? (2 punte)


Inhoud

By mense volg oorerwing van X-gekoppelde resessiewe eienskappe 'n unieke patroon wat uit drie punte bestaan. -Die eerste is dat geaffekteerde vaders nie x-gekoppelde resessiewe eienskappe aan hul seuns kan oordra nie omdat vaders Y-chromosome aan hul seuns gee. Dit beteken dat mans wat deur 'n x-gekoppelde resessiewe versteuring geraak is, die verantwoordelike X-chromosoom van hul moeders geërf het. Tweedens word x-gekoppelde resessiewe eienskappe meer algemeen by mans as vrouens uitgedruk. [2] Dit is te wyte aan die feit dat mans slegs 'n enkele X-chromosoom besit, en daarom slegs een gemuteerde X benodig om aangetas te word. Vroue besit twee X-chromosome en moet dus twee van die gemuteerde resessiewe X-chromosome (een van elke ouer) ontvang. ’n Gewilde voorbeeld wat hierdie patroon van oorerwing toon, is dié van die afstammelinge van koningin Victoria en die bloedsiekte hemofilie. [3] -Die laaste patroon wat gesien is, is dat x-gekoppelde resessiewe eienskappe geneig is om generasies oor te slaan, wat beteken dat 'n geaffekteerde oupa nie 'n aangetaste seun sal hê nie, maar 'n geaffekteerde kleinseun deur sy dogter kan hê. [4] Verder verduidelik, alle dogters van 'n aangetaste man sal sy gemuteerde X verkry, en sal dan óf draers wees óf self aangetas, afhangende van die moeder. Die gevolglike seuns sal óf 'n 50% kans hê om geaffekteer te word (moeder is draer), óf 100% kans (ma is aangetas). Dit is as gevolg van hierdie persentasies dat ons sien dat mans meer algemeen geraak word as vrouens.

'n Paar geleerdes het voorgestel dat die gebruik van die terme gestaak word dominant en resessief wanneer na X-gekoppelde erfenis verwys word. [5] Die besit van twee X-chromosome by wyfies lei tot dosiskwessies wat deur X-inaktivering verlig word. [6] Met die stelling dat die hoogs veranderlike penetrasie van X-gekoppelde eienskappe by vroue as gevolg van meganismes soos skewe X-inaktivering of somatiese mosaïek moeilik is om te versoen met standaarddefinisies van dominansie en resessieiwiteit, het geleerdes voorgestel dat daar verwys word na eienskappe op die X-chromosoom eenvoudig as X-gekoppel. [5]

Mees algemene Edit

Die mees algemene X-gekoppelde resessiewe versteurings is: [7]

    , 'n baie algemene eienskap by mense en word gereeld gebruik om X-gekoppelde afwykings te verduidelik. [8] Tussen sewe en tien persent van mans en 0,49% tot 1% van vroue word aangetas. Die algemeenheid daarvan kan verklaar word deur sy relatief goedaardige aard. Dit staan ​​ook bekend as daltonisme. , 'n bloedstollingsversteuring wat veroorsaak word deur 'n mutasie van die Faktor VIII-geen en wat lei tot 'n tekort aan Faktor VIII. Daar is eens gedink dat dit die "koninklike siekte" was wat in die afstammelinge van koningin Victoria gevind is. Dit is nou bekend dat dit hemofilie B was (sien hieronder). [9][10] , ook bekend as Kersiekte, [11] 'n bloedstollingsversteuring wat veroorsaak word deur 'n mutasie van die Faktor IXgeen en wat tot 'n tekort aan Faktor IX lei. Dit is skaarser as hemofilie A. Soos hierbo genoem, was dit algemeen onder die afstammelinge van koningin Victoria. , wat geassosieer word met mutasies in die distrofien-geen. Dit word gekenmerk deur vinnige vordering van spierdegenerasie, wat uiteindelik lei tot verlies van skeletspierbeheer, respiratoriese versaking en dood. , 'n ligter vorm van Duchenne, wat stadig progressiewe spierswakheid van die bene en bekken veroorsaak. , 'n vorm van iktiose wat veroorsaak word deur 'n oorerflike tekort aan die steroïedsulfatase (STS) ensiem. Dit is redelik skaars en raak een uit 2 000 tot een uit 6 000 mans. [12] (XLA), wat die liggaam se vermoë om infeksie te beveg, beïnvloed. XLA-pasiënte genereer nie volwasse B-selle nie. [13] B-selle is deel van die immuunstelsel en vervaardig gewoonlik teenliggaampies (ook genoem immunoglobuliene) wat die liggaam teen infeksies (die humorale reaksie) verdedig. Pasiënte met onbehandelde XLA is geneig om ernstige en selfs dodelike infeksies te ontwikkel. [14] , wat nie-immune hemolitiese anemie veroorsaak in reaksie op 'n aantal oorsake, meestal infeksie of blootstelling aan sekere medikasie, chemikalieë of voedsel. Algemeen bekend as "favism", aangesien dit veroorsaak kan word deur chemikalieë wat natuurlik in breë (of fava) bone voorkom. [15]

Minder algemene afwykings Wysig

Teoreties kan 'n mutasie in enige van die gene op chromosoom X siekte veroorsaak, maar hieronder is 'n paar noemenswaardige, met 'n kort beskrywing van simptome:


Beraming van penetrasie deur gebruik te maak van populasie alleel frekwensie

Verlede maand is ek genooi om te praat by die Sentrums vir Mendeliese Genomika (CMG) Ontleding en Metode-ontwikkeling vergadering oor "Bevolkingsgebaseerde skatting van penetrasie in seldsame siektes". Hier is die blogpos weergawe van my praatjie.

Wat is penetrasie en hoekom gee ons om?

Penetrasie is die waarskynlikheid om 'n spesifieke siekte te ontwikkel gegewe 'n bepaalde genotipe. Mens kan praat van ouderdom-afhanklike penetrasie, so die persentasie mense met die genotipe wat die siekte ontwikkel op ouderdom 40, teen ouderdom 50, ensovoorts praat ek gewoonlik t.o.v. lewenslange risiko, wat beteken die waarskynlikheid dat jy ooit die siekte ontwikkel voordat jy sterf. Inherent hieraan is dat vir volwassenesiektes, lewenslange risiko nooit heeltemal 100% kan wees nie, want jy kan altyd eers aan iets anders sterf.

Penetrasie is uiters belangrik vir individue wat voorspellende genetiese toetse ondergaan - baie mense se eerste vraag is, "beteken dit dat ek beslis die siekte sal kry?". Tog is dit dikwels baie moeilik om 'n vaste skatting van penetrasie te maak.

Tradisionele metodes om penetrasie te skat

In 'n ideale wêreld, die reg manier om penetrasie te skat sou wees om van geboorte af 'n groot groep mense met 'n bepaalde genotipe vas te stel, hulle te volg totdat almal aan een of ander gesterf het, en dan te vra hoeveel ooit die siekte ontwikkel het voordat hulle gesterf het. Sedert genotiperingstegnologie minder as een menslike leeftyd gelede uitgevind is, is dit nog nooit vir enige siekte gedoen nie.

In plaas daarvan gebruik navorsers dikwels familiegebaseerde metodes om penetrasie te skat. 'n Tipiese studie sal kyk na almal wat met die gegewe genotipe waargeneem is, en vra hoeveel sterftes het, of hoeveel siektes teen 'n sekere ouderdom het. Familie-gebaseerde metodes ly aan deurdringende vasstelling vooroordeel [Minikel 2014]. Neem in ag dat sommige of al die volgende vrywarings gewoonlik op hierdie studies van toepassing is:

  • sommige individue in die studie is vasgestel op grond van aanbieding met siekte
  • gesinne in die studie is vasgestel op grond van veelvuldige geaffekteerdes
  • die families wat oorspronklik gebruik is om vas te stel dat die variant die siekte veroorsaak, word by die ontleding ingesluit
  • nie alle onaangeraakte individue in die familie het voorspellende genetiese toetse ondergaan nie

As 'n voorbeeld van hierdie laaste punt, in genetiese prionsiekte, kies slegs 23% van risiko-mense voorspellende genetiese toetsing [Owen 2014], en in stamboomdata waartoe ek toegang gehad het, het ons die genotipes van slegs 22% geken. van individue in gevaar [Minikel 2014].

Al die faktore wat hierbo gelys word, werk in dieselfde rigting, wat geneig is om 'n mens se skatting van penetrasie op te blaas.

Navorsers is al lank bewus van hierdie probleme en het 'n paar oplossings voorgestel. As een voorbeeld behels die familie-kohort-metode [Wacholder 1998] om gesonde individue ewekansig uit 'n populasie vas te stel, hulle te genotipeer, 'n familiegeskiedenis te neem en oorlewingskurwes van hul eerstegraadse familielede te vergelyk. Dit is 'n baie slim oplossing, maar dit maak staat daarop om 'n groot genoeg aantal mense met 'n siekte-veroorsakende genotipe vas te stel sonder om vas te stel oor die teenwoordigheid van siekte. So dit het gewerk vir BRCA1 en BRCA2 variante in Amerikaanse Ashkenazi-Jode [Wacholder 1998], maar vir baie skaarser genetiese toestande is dit onprakties, want jy sal tiene of honderdduisende mense moet werf om selfs een individu met 'n genotipe van belangstelling te vind.

Bevolkingsgebaseerde metodes

Vir al die redes wat hierbo beskryf is, is dit baie nuttig om ortogonale, bevolkingsgebaseerde metodes te hê om vrae oor penetrasie te vra. Die eerste sleutelinsig hier is dit 'n heeltemal penetrante genetiese variant behoort nie meer algemeen in die bevolking te wees as die siekte wat dit veroorsaak nie. Om hierdie logika in die praktyk toe te pas, beteken dat jy goeie skattings van alleelfrekwensie nodig het, selfs vir ongewone variante, en dit was tot onlangs moeilik om te bereik. ExAC, 'n databasis van genetiese variasie in 60 706 menslike eksome, bied nuwe geleenthede [Lek 2016]. Baie individue in ExAC is vasgestel as gevalle of kontroles vir verskeie algemene, komplekse siektes, maar geeneen is vasgestel vir Mendeliese siekte nie, so ExAC is 'n goeie verwysingsdatabasis om die meeste genetiese siektes te bestudeer.

Deur alleelfrekwensie-inligting in die algemene bevolking te verskaf, het ExAC, soos vroeëre verwysingsdatabasisse soos ESP [Bell 2011, Xue 2012], dit duidelik gemaak dat kliniese genetika 'n groot probleem het: baie variante wat gerapporteer word om genetiese siektes te veroorsaak, veroorsaak nie eintlik genetiese siekte veroorsaak, of ten minste nie die meeste van die tyd nie.

Twee databasisse - HGMD [Stenson 2014] en ClinVar [Landrum 2014] - versamel bewerings uit die literatuur en uit kliniese laboratoriums wat verklaar dat 'n spesifieke genetiese variant 'n spesifieke genetiese siekte veroorsaak. Op die laaste telling was daar meer as 100 000 unieke gerapporteerde genetiese variante wat siektes veroorsaak in hierdie databasisse. Die gemiddelde persoon in ExAC het 54 van hulle [Lek 2016]. Uiteraard het die gemiddelde persoon nie eintlik 54 genetiese siektes nie. Natuurlik word baie van hierdie oormaat veroorsaak deur 'n klein aantal baie hoëfrekwensie-variante wat natuurlik geen genetiese siekte veroorsaak nie, en baie daarvan kan na bewering resessiewe variante wees wat in 'n heterosigotiese toestand in ExAC voorkom. Maar selfs al kyk ons ​​net na variante in dominante siektegene teen 'n alleelfrekwensie van <1%, sien ons steeds 0,89 na bewering patogene variante per persoon [Lek 2016], en dit is duidelik nie die geval dat

90% van mense het 'n dominante genetiese siekte. So oor die alleelfrekwensiespektrum is daar baie na bewering patogene variante wat nie so patogenies is nie. Toe ek en Anne O'Donnell na die na bewering patogene variante met die hoogste alleelfrekwensies in ExAC gekyk het, en gevra het hoe hulle dit reggekry het om verkeerd geklassifiseer te word as patogenies, het ons gevind dat die probleem meestal na 'n artikel in die literatuur teruggespoor is wat het 'n eis van patogenisiteit gemaak op grond van onvoldoende bewyse.

Bo: Figure 3C en 3D uit [Lek 2016]. Regoor die alleelfrekwensiespektrum en in beide dominante en resessiewe siektegene, is daar baie na bewering patogene variante wat in ExAC voorkom. Van 'n hoë (>1%) frekwensie wat na bewering patogene variante is, is 'n paar werklik patogenies, sommige is werklik eienskap-geassosieer, maar die eienskap is goedaardig, en sommige is foute van annotasie in databasisse - maar die meerderheid is gebaseer op literatuur met onvoldoende bewyse.

Alleelfrekwensie-inligting van ExAC het nou meer as 200 genetiese variante in staat gestel om herklassifiseer te word van patogenies na benigne, waarskynlik benigne, of van onsekere betekenis [Lek 2016, Whiffin & Minikel 2016]. Hierdie soort herklassifikasies veroorsaak soms terugstoot van die oorspronklike skrywers wat voorgestel het dat 'n variant 'n genetiese siekte veroorsaak, wat kan argumenteer dat 'n variant steeds patogenies kan wees, maar met onvolledige penetrasie. Maar hoe “onvolledig” kan onvolledige penetrasie wees? Ons moet kwantitatief raak, want as lewenslange risiko hoogstens 1% is, is dit dan steeds redelik om te sê dat 'n variant 'n genetiese siekte "veroorsaak", of "patogenies" is? Terwyl alleel frekwensie inligting kan nooit bewys wat 'n variant het geen verband met siekte, kan dit perke plaas op wat die moontlike penetrasie kan wees, en in baie gevalle, selfs vir redelik skaars variante, is dit moontlik om aan te toon dat daar geen manier is dat 'n variant 'n vlak van risiko op enige plek naby 100% verleen. .

Om kwantitatief te word, moet ons ons vroeëre waarneming uitbrei - dat 'n heeltemal penetrante genetiese variant nie meer algemeen in die bevolking behoort te wees as die siekte wat dit veroorsaak nie. Dit is alles eenvoudige wiskunde en bevolkingsgenetika, maar dit word te dikwels nie in die praktyk toegepas nie. Hier is twee maniere waarop ons oor alleelfrekwensie kan dink wanneer ons afleidings maak oor patogenisiteit en penetrasie.

1. maksimum geloofwaardige alleelfrekwensie

Gestel jy bestudeer die eksoom van 'n pasiënt met Mendeliese siekte en probeer om die oorsaaklike variant te identifiseer. My kollega James Ware het 'n strategie uitgedink om daardie eksoom teen die alleelfrekwensie-inligting in ExAC te filter, met voordeel van die volgende logika. Die maksimum alleelfrekwensie wat aanneemlik is vir 'n variant om 'n dominante genetiese siekte te veroorsaak, is gelyk aan die voorkoms van die siekte maal die alleliese heterogeniteit (proporsie gevalle toeskryfbaar aan een variant) gedeel deur penetrasie (minder penetrante variante kan meer algemeen wees), gedeel deur 2 (omdat ons diploïed is):

Byvoorbeeld, prionsiekte veroorsaak in 1 uit 5 000 sterftes, en die mees algemene variant (E200K) word in 5% van gevalle gevind [Minikel 2016], dus kan 'n 100% penetrante variant onmoontlik alleelfrekwensie groter as 0,0005% hê (1 in 200 000) [Minikel 2016]. Kardiomiopatie raak 1 uit 500 mense, die mees algemene variant word in <2% van gevalle gevind, so 'n 50% penetrante variant kan nie 'n alleelfrekwensie groter as 0,004% hê nie [Whiffin & Minikel 2016]. Die formule vir resessiewe siektes is een kerf meer ingewikkeld maar James het dit ook uitgewerk en dit word beskryf in [Whiffin & Minikel 2016].

Dus, terwyl mense histories dikwels variante met 'n alleelfrekwensie >0.1% uitgefiltreer het wanneer hulle probeer om die oorsaak van 'n dominante siekte te identifiseer [Bamshad 2011], kan ons eintlik baie strenger wees. Die waarskuwing is dat by lae alleeltellings ons vermoë om alleelfrekwensie te skat beperk word deur steekproefafwyking. As ons byvoorbeeld kyk na variante wat gesien word teen 'n 1% alleelfrekwensie onder Europeërs in ESP, het hierdie variante ook ongeveer 'n 1% frekwensie onder ExAC Europeërs. Maar variante met 'n 0.1% frekwensie in ESP is geneig om effens skaarser te wees in ExAC, en die meeste enkellinge (variante wat presies een keer in ESP gesien word) verskyn nie 'n tweede keer in ExAC nie.

Bo: Figuur 3B uit [Lek 2016].Hoe laer die alleeltelling, hoe minder goeie skatting van alleelfrekwensie verskaf dit.

Daarom, hoe laer die alleeltelling, hoe meer konserwatief moet ons wees. Ons het 'n raamwerk ontwerp om dit te doen deur die 95% boonste grens van die Poisson-verspreiding te gebruik oor hoeveel allele teen 'n gegewe frekwensie waargeneem kan word, en het vooraf berekende waardes vir al ExAC (beskikbaar op FTP) wat jy kan gebruik — lees meer oor die metodes in [Whiffin & Minikel 2016]. James het ook hierdie handige webtoepassing geskep wat jou toelaat om te verken wat die "maksimum geloofwaardige alleelfrekwensie" moet wees vir jou siekte van belang.

Inherent aan hierdie benadering is dat hoe laer die penetrasie van 'n variant is, hoe hoër frekwensie kan dit in die algemene bevolking hê. Maar jy moet ook dink dat as penetrasie redelik laag is, sê minder as 10%, dan is die kliniese nut van daardie variant ook laag. James en Nicky Whiffin het data aangebied om te wys dat byna al die kliniese nut van volgordebepaling in kardiomiopatie afkomstig is van variante met 'n frekwensie van <0.001% - meer algemene variante dra kumulatief min, indien enige, risiko by [Whiffin & Minikel 2016].

2. skatting en grense van lewenslange risiko

Onthou dat penetrasie die waarskynlikheid van siekte is gegewe 'n bepaalde genotipe. Of, as ons 'n alleliese eerder as genotipiese model oorweeg, die waarskynlikheid van siekte gegewe 'n spesifieke alleel. Ons kan dit as P(D|A) skryf. Sodra ons dit doen, word dit duidelik dat, volgens Bayes se stelling,

Elkeen van hierdie terme het 'n spesifieke betekenis:

  • P(D|A) = penetrasie
  • P(D) = basislynrisiko (die leeftydrisiko van die siekte in die algemene bevolking)
  • P(A|D) = alleelfrekwensie in gevalle
  • P(A) = alleelfrekwensie in populasiekontroles

Let hier op dat "bevolkingskontroles" 'n groep beteken wat nie gekies is vir die teenwoordigheid, of vir die afwesigheid, van die siekte nie. Net 'n deel van die algemene bevolking.

Hierdie logika is niks nuuts nie. Die gebruik van Bayes se stelling om siekterisiko te skat, dateer ten minste terug na die skatting van die risiko van kanker by rokers [Cornfield 1951], en die toepassing daarvan op genetika is amper so lank oorweeg [Li 1961]. Maar vir hierdie vergelyking om vir seldsame siektes te werk, het jy goeie skattings nodig van alleelfrekwensie van gevalle en bevolkingsbeheer, en dit was tot onlangs moeilik om dit te bereik. Danksy ExAC is daar dus 'n toenemende aantal situasies waar hierdie vergelyking relevant is.

Hier is die R-kode wat ek geskryf het (oorspronklik hier) om penetrasie te skat gebaseer op hierdie formule.

As jy nie self die R-kode wil gebruik nie, het James Ware dit in die "penetrance"-oortjie van hierdie webtoepassing geïmplementeer sodat jy net jou nommers by jou blaaier kan inprop.

Om 95% vertrouensintervalle op penetrasie te skat, het ek die benadering van [Kirov 2014] aangeneem. Jy voer die alleeltelling (AC) en die aantal individue (N) vir gevalle en kontroles in, en die boonste grens van die 95%CI word bereken op grond van die boonste 95%CI van die binomiale verspreiding vir geval alleelfrekwensie en die onderste 95%CI vir kontroles. Omgekeerd is die ondergrens van penetrasie gebaseer op die onderste grens van geval alleel frekwensie en die boonste grens van kontrole alleel frekwensie. Jy kan met reg twis dat omdat hierdie formule 95%CI's op beide alleelfrekwensiewaardes gebruik, die gevolglike vertrouensintervalle groter is as wat hulle behoort te wees. U kan ook met reg twis dat die binomiale verspreiding nie 'n goeie beramer is by lae alleeltellings nie, as gevolg van die vooroordeel wat in Figuur 3B hierbo getoon word (en ek sal beslis nooit hierdie formule op enkellinge toepas nie - variante wat slegs een keer in ExAC waargeneem word). Maar aan die einde van die dag, om redes wat ek nader aan die einde van hierdie pos sal bespreek, word hierdie formule regtig die beste gebruik om 'n balpark, orde-van-grootte skatting van penetrasie te verkry. As jy op soek is na 'n uiters presiese puntskatting van penetrasie, sal hierdie hele benadering waarskynlik in elk geval nie vir jou werk nie.

As jy die vergelyking herrangskik, is 'n ander manier om daaroor te dink:

Dit beteken dat die verhoogde risiko onder mense met 'n genotipe eweredig is aan die verhouding van geval tot bevolkingsbeheer alleelfrekwensie. So 'n variant wat die risiko met 200-voudig verhoog, behoort 200 keer meer algemeen onder gevalle te wees as wat dit in die algemene bevolking is. (Let daarop dat hierdie verhouding van alleelfrekwensies effens verskil van kansverhouding, hoewel die twee maatstawwe konvergeer vir baie skaars variante.)

Toepassing op prionsiekte

Ons het deur hierdie logika gestap in 'n studie wat ons vroeër vanjaar gepubliseer het, wat die penetrasie van prionsiektevariante kwantifiseer [Minikel 2016, Markdown-weergawe hier]. Ek gee om vir prionsiekte om 'n persoonlike rede - my vrou het 'n patogene variant in PRNP - maar dit blyk dat prionsiekte ook 'n goeie toetsgeval is vir die gebruik van bogenoemde logika om penetrasie te skat. Geen van die individue in ExAC v1 is vasgestel op neurodegeneratiewe siekte nie, so ExAC is regtig 'n goeie bevolkingsbeheerdatastel vir prionsiekte. En omdat prion-siektes "aanmeldbaar" is, het nasionale toesigsentrums buitengewone goeie gevallebepaling, en danksy hul vrygewigheid in die deel van data, kon ons 'n datastel van 10 460 opeenvolgende gevalle ophoop.

Ons het gevind dat die >60-variante wat gerapporteer word om prionsiekte te veroorsaak kumulatief 52 allele in ExAC het. Dit beteken dat byna 1 uit 1 000 mense een van hierdie variante het, en dus is hierdie variante kumulatief baie meer algemeen as alle prionsiekte (wat veroorsaak

1 uit elke 5 000 sterftes), laat staan ​​almal genetiese prionsiekte (slegs

15% van die gevalle is geneties). Dit is genoeg om ons te vertel dat nie al hierdie variante moontlik ten volle penetrant kan wees nie. Om vas te stel watter variante die skuldiges was, het ons met die saakreeks vergelyk. Variante met uitstekende vorige bewyse van patogenisiteit (Mendeliaanse segregasie en muismodelle) was algemeen in gevalle en afwesig van ExAC, wat ooreenstem met volledige of byna volledige penetrasie. Die meeste van die oortollige alleeltelling in ExAC is bygedra deur variante wat ongewoon in gevalle was en swak vorige bewyse van patogenisiteit gehad het - hierdie variante is waarskynlik goedaardig of dra slegs 'n lae risiko by. Ten minste drie variante het intermediêr voorgekom, aangesien hulle te algemeen in kontroles was vir volle penetrasie, maar steeds verryk in gevalle bo kontroles.

Bo: 'n geannoteerde weergawe van Figuur 2 uit [Minikel 2016].

Toe ons penetrasie vir elke variant beraam het deur die P(D|A) formule hierbo te gebruik, het ons gevind dat daar 'n hele spektrum van penetrasie vir PRNP variante.

Let op die skaal op die x-as - vir 'n siekte wat so skaars is dat die vorige waarskynlikheid om dit te ontwikkel slegs 0,02% is, is selfs 'n 50-voudige toename in risiko slegs 1% lewenslange risiko. Dit is gerusstellend dat die penetrasie skat dat ons van alleelfrekwensie-inligting alleen aflei, redelik goed ooreenstem met die proporsie gevalle wat met 'n positiewe familiegeskiedenis voorkom.

Hierdie werk het reeds gelei tot 'n verandering in prognose vir sommige individue wat oorspronklik aangeraai is dat hulle 'n risiko vir hoë-penetrasie-variante het - sien [Lebo 2016] en Erika Check Hayden se artikel oor ExAC. Jy kan my en Sonia se persoonlike reis met hierdie studie hier lees.

Aansoek om NR1H3

Veelvuldige sklerose (MS) is 'n komplekse siekte met baie genetiese risikofaktore [IMSGC 2011], maar geen Mendeliese vorm van die siekte is bekend om te bestaan ​​nie. Vroeër vanjaar het 'n studie berig dat 'n missense-variant in 'n kernhormoonreseptor - NR1H3 R415Q — veroorsaak die eerste Mendeliese vorm van MS [Wang 2016]. Hierdie eis was gebaseer op dominante segregasie met siekte in twee families, maar die LOD-telling was slegs 2,2 - onder die drempel vir genoomwye betekenis in familiekoppelingstudies, wat meer soos 3,0 of 3,6 is [Lander & Kruglyak 1995, Kruglyak & Lander 1995]. En die betrokke variant het 'n alleelfrekwensie van 0,031% in ExAC nie-Finse Europeërs. Dit klink dalk nie soos 'n hoë alleelfrekwensie nie, maar dit blyk heeltemal te hoog te wees vir hierdie variant om Mendelian MS te veroorsaak [Minikel & MacArthur 2016, volledige teks hier].

Neem in ag dat MS 'n lewenslange risiko (in die algemene bevolking) van 0,25% in vroue en 0,14% in mans het [Alonso & Hernan 2008]. As 0,06% van mense in die algemene bevolking R415Q-heterosigote is, en as selfs die helfte van hulle voortgaan om MS te ontwikkel, dan sal hierdie variant alleen verantwoordelik wees vir 0,03% van die bevolking wat MS ontwikkel. So as 'n totaal van 0,25% van mense MS ontwikkel, dan behoort ongeveer 12% van hulle hierdie variant te hê. In plaas daarvan is die variant slegs gevind in 1 individu uit 'n gevallereeks van 2 053 MS-pasiënte [Wang 2016].

Dit werk uit op 'n alleelfrekwensie van 0,024% in gevalle, of 0,049% as ons toelaat dat 2 gevalle in die gevallereeks getel word. Dit is nie aansienlik hoër as die frekwensie in ExAC nie. Maar as hierdie variant MS veroorsaak, behoort dit meer algemeen te wees in gevalle - veel meer algemeen. Onthou ons herrangskik formule vroeër: P(D|A)/P(D) = P(A|D)/P(A). Dit beteken dat as 'n variant die risiko X-vou verhoog, dit X keer meer algemeen in kontroles behoort te wees. So as die basislynrisiko van MS 0,25% is en hierdie variant is 50% penetrant, behoort dit 50/.25 = 200 keer meer algemeen in gevalle as kontroles te wees. As dit selfs 10% penetrasie gehad het, behoort dit steeds 10/.25 = 40 keer meer algemeen in gevalle as in kontroles te wees. Alternatiewelik kan jy dink in terme van kansverhoudings in plaas van waarskynlikhede. Die 0.25% lewenslange risiko in die algemene bevolking beteken 1:399 kans, en as R415Q 50% leeftydrisiko verleen, sou dit 50:50 kans wees. (50/50)/(1/399) = 399, dus sal die kansverhouding vir R415Q 399 moet wees sodat hierdie variant 50% penetrasie kan hê.

As ons eerder ons formule toepas deur die R-kode van vroeër toe te pas, met die veronderstelling van 0,25% basislynrisiko en die berekening op 2 allele op 2 053 gevalle, teenoor 21 allele in 33 369 ExAC-individue, vind ons dat die boonste grens van die 95%CI op penetrasie is 2,2%. So selfs al sou R415Q met MS-risiko geassosieer word, kon dit nie meer as 2,2% lewenslange risiko om MS te ontwikkel [Minikel & MacArthur 2016] gee nie.

In hul formele antwoord [Wang 2016b] en in PubMed Commons het die skrywers 'n vergelyking met LRRK2 G2019S in Parkinson se siekte, wat almal saamstem is patogenies, maar wat ook gevind word in ExAC en het net 'n beskeie kans verhouding, geskat op 9,6 [Do 2011]. Vir daardie variant werk die wiskunde uit. Parkinson se siekte is ten minste 'n orde van grootte meer algemeen as MS, met lewenslange risiko wat oral van 3.7% [Elbaz 2002] tot 6.7% [Driver 2009] beraam word. Hierdie orde van grootte groter voorkoms beteken dat die

10-voudige verryking wat waargeneem is - LRRK2 G2019S word gevind in ongeveer 0,1% van die kontroles en 1% van die gevalle [Gilks ​​2005, Do 2011] - is min of meer in ooreenstemming met die berig

32% lewenslange risiko van Parkinson's wat deur hierdie variant verleen word [Ozelius 2006, Goldwurm 2007]. Hierdie kwantitatiewe besonderhede maak saak, en is verskillend vir elke variant en elke siekte. Dit is hoekom die formules wat in hierdie pos bespreek word, nuttig is, alhoewel hulle slegs baie rowwe skattings verskaf en onderhewig is aan verskeie waarskuwings, soos hieronder verduidelik.

Waarskuwings

In beide die toepassings wat hierbo beskryf is, is alleelfrekwensie-inligting gebruik om 'n rowwe skatting van penetrasie te kry. In prionsiekte kon ons aantoon dat variante wat voorheen hoogs penetrant was, lewenslange risiko meer in die orde van 0,1%, 1% of 10% inhou. In die NR1H3 storie, alleelfrekwensie-inligting was voldoende om te wys dat die na bewering oorsaaklike variant nie meer as 'n paar persent lewenslange risiko kon bied nie.

Maar om alleelfrekwensiedata te probeer gebruik om 'n strenger skatting van penetrasie te kry, sal baie uitdagend wees. Gesinsgebaseerde studies het byvoorbeeld nie saamgestem oor die penetrasie van PRNP E200K, met ramings wat wissel van 60% tot 90% lewenslange risiko [Chapman 1994, Spudich 1995, D'Alessandro 1998, Mitrova & Belay 2002]. Sedert die prion-studie verskyn het, het ek 'n paar mense uit E200K-families gehad wat my gevra het of ExAC-data kan help om te beperk waar die risiko binne hierdie reeks is. Die antwoord is, dit kan ongelukkig nie.

Hier is die belangrikste redes waarom ek dink dat alle penetrasieskattings gebaseer op alleelfrekwensie met 'n soutkorrel geneem moet word:

  • As 'n variant hoogs penetrant is, dan is dit moeilik om 'n gevallereeks te kry wat nie verwante individue bevat nie. As jou saakreeks verwante het, dan het jy tegnies nie 'n onbevooroordeelde skatting van P(A|D nie).
  • As 'n siekte dodelik is, dan is dit moeilik om 'n bevolkingsbeheerreeks te kry wat nie ten minste ietwat uitgeput is van mense met variante wat daardie siekte veroorsaak nie. So dan het jy ook nie 'n onbevooroordeelde skatting van P(A) nie.
  • Vergelykings van geval en kontrole alleel frekwensie is kwesbaar vir verwarring deur populasie stratifikasie. In die prionstudie het ons nie genoomwye SNP-data oor gevalle gehad nie, so daar was geen manier om dit perfek te beheer nie.
  • Baie oorsaaklike variante vir seldsame siektes is so skaars dat selfs met ExAC, ons nog nie voldoende akkurate skattings van alleelfrekwensie het om beter as 'n rowwe antwoord te gee nie.

Met alles wat gesê is, is bevolkingsgebaseerde alleelfrekwensieberaming steeds 'n goeie manier om rowwe orde-van-grootte skattings van penetrasie te kry en om gesonde verstandkontroles uit te voer of 'n genetiese variant waarskynlik oorsaaklik vir 'n seldsame siekte kan wees.

Oor Eric Vallabh Minikel

Eric Vallabh Minikel is op 'n lewenslange soeke om prionsiekte te voorkom. Hy is 'n wetenskaplike gebaseer by die Broad Institute of MIT en Harvard.


DNS-PROFILERING MET DIE GEBRUIK VAN STR's

INLEIDING

Die meeste individue van dieselfde spesie, hetsy Afrika-olifante, p ortobello-sampioene, wit eikebome of mense, het byna identiese DNA. Maar die DNS-volgorde op sekere plekke, of lokusse, regdeur die genoom verskil tussen individue. Hierdie variasies kan gebruik word om een ​​individu van 'n ander van dieselfde spesie te onderskei. Die proses om hierdie DNS-variasies te ontleed vir die doel van identifikasie staan ​​bekend as DNS-profilering, of genetiese vingerafdrukke.

DNS-profieltegnieke is vir 'n verskeidenheid redes gebruik, insluitend forensiese wetenskap (passing van 'n verdagte of slagoffer se DNS met monsters wat op die toneel van 'n misdaad of katastrofe gevind is), vaderskaptoetsing, historiese ondersoeke, ondersoeke na vermiste persoon, identifisering van slagoffers van ongelukke en rampe, en katalogisering van veroordeelde oortreders in 'n databasis. In hierdie aktiwiteit sal jy leer oor DNS-profiele en hoe om dit toe te pas om verskillende gevalle op te los. Dink jy wat jy in die klaskamer leer het geen praktiese nut nie? Dink weer.

DEEL 1: BASIESE DNS-PROFIELERING

Alhoewel die meeste van die genoom identies is onder individue van dieselfde spesie, bestaan ​​daar wel verskille. DNA-profiele maak gebruik van hierdie verskille. Variasies kom regdeur die genoom voor, en veral in streke van niekoderende DNA, wat DNS is wat nie getranskribeer en in 'n proteïen vertaal word nie. Variasies in niekoderende streke is minder geneig om 'n individu se fenotipe te beïnvloed, en daarom is veranderinge in hierdie streke minder geneig om deur natuurlike seleksie uitgeskakel te word.

DNA-profilering gebruik 'n kategorie van DNA-variasies wat kort tandem-herhalings genoem word. STR'e bestaan ​​uit eenhede van basisse, tipies twee tot vyf basisse lank, wat verskeie kere herhaal. Die herhalende eenhede word op verskillende plekke, of lokusse, regdeur die genoom aangetref.

Elke STR het veelvuldige allele, of variante, elk gedefinieer deur die aantal herhalende eenhede teenwoordig of deur die lengte van die ry. Hulle word omring deur onveranderlike segmente van DNS wat bekend staan ​​as flankerende streke.

Byvoorbeeld, die STR-alleel in Figuur 1 kan as "6" aangewys word omdat die herhalingseenheid (GATA) ses keer herhaal, of as 70 bp (waar bp vir basispare staan) omdat dit 70 bp lank is, insluitend die flankerende streke. 'n Ander alleel van dieselfde STR sal 'n ander aantal GATA-herhalingseenhede hê, maar dieselfde flankerende streke.

Flankerende streke is belangrik omdat die kennis van hul volgordes genetici in staat stel om die STR te isoleer deur gebruik te maak van polimerase kettingreaksie, of PCR, amplifikasie.

Figuur 1. Elkeen van die reghoeke hierbo verteenwoordig 'n herhalende eenheid. In hierdie voorbeeld bestaan ​​die STR uit ses herhalings van die vier-basis-eenheid GATA. Aan weerskante van die STR is 'n flankerende gebied van DNS. As jy die STR-reeks in Figuur 1 sou uitskryf, sou dit GATAGATAGATAGATAGATAGATA wees. Vir STR'e met baie herhalende eenhede kan die skryf van die volgorde baie moeilik raak, daarom gebruik genetici snelskrif. Die herhalingseenheid word tussen hakies geplaas met 'n subskripsie wat die aantal kere wat dit herhaal aandui. Die snelskrif vir die STR in die voorbeeld hierbo sal [GATA] 6 wees.

DNS-profilering met behulp van STR's Studente-uitdeelstuk

  1. Identifiseer die flankerende rye en die aantal herhalende eenhede [GAAT] in die volgende STR, bekend as TPOX, op menslike chromosoom 2:

a. gedeeltelike flankerende rye: ____ en _____

b. aantal herhalende eenhede: ___

  1. Skryf die STR hierbo uit deur gebruik te maak van genetiese snelskrif. _____

STR's word net soos enige geen of segment van DNA geërf. Elke individu het twee allele per STR, een geërf van elke ouer. Baie verskillende allele is egter dikwels teenwoordig binne 'n populasie. As die oorgeërfde allele vir 'n gegewe STR in 'n individu identies is (d.w.s. dieselfde aantal herhalende eenhede bevat), is die individu homosigoties vir daardie STR. As die individu twee verskillende allele vir 'n gegewe STR geërf het, dan is hy of sy

Heterosigoties vir daardie STR. Figuur 2 toon 'n eenvoudige model van STR-oorerwing.

Figuur 2. Model van oorerwing vir 'n enkele STR. Die getalle verwys na die alleelnommer. Hier is die moeder homosigoties vir 'n alleel met 10 herhalende eenhede. Die vader is heterosigoties by hierdie STR-lokus, met een alleel met 12 herhalings en die ander met 14. Hul dogter is heterosigoties, wat alleel 10 van haar ma geërf het en alleel 12 van haar pa.

Is daar enige manier dat die dogter in Figuur 2 homosigoties kon gewees het vir die STR wat gewys word? Verduidelik jou antwoord.

Gebruik die diagram aan die regterkant en identifiseer al die moontlike STR-alleelkombinasies wat die seun by hierdie spesifieke lokus kon geërf het.

DNS-profilering met behulp van STR's Studente-uitdeelstuk

Figuur 4. 'n Elektroferogram van 'n individu wat die allele by vier STR-lokusse wys: D8S1179, D21S11, D7S820 en CSF1PO. Elke lokus wys die allele daaronder as pieke in die elektroferogram. Die aantal herhalings vir elke alleel word aangedui.

Ondersoek die elektroferogram in Figuur 4. Beskryf hoe jy bepaal of 'n individu heterosigoties of homosigoties is vir 'n spesifieke STR.

Lys die STR-lokus of lokusse waar hierdie individu homosigoties is. ___

Watter lokus het die langste DNA-fragmente? _____ Hoe weet jy?

Verskillende individue het unieke stelle, of profiele, van STR-allele. Vir baie forensiese ontledings gebruik navorsers 'n kernstel van 13 STR-lokusse wat in 1996 deur die FBI-laboratorium gevestig is. Hulle is CSF1PO, FGA, TH01, TPOX, VWA, D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51 en D21S11. Daarbenewens word 'n geenmerker genaamd AMEL gebruik om 'n individu se geslag te bepaal en word saam met die 13 STR-lokusse as deel van daardie individu se genetiese vingerafdruk ontleed.

Wanneer al 13 lokusse ontleed word, is die kans dat twee mense (met die uitsondering van identiese tweelinge) dieselfde presiese stel allele vir elk van hierdie 13 STR'e sal hê, uiters laag—sommige stel dit in die omgewing van 1 uit 10,000,000,000,000. Met ander woorde, die kans op 'n ewekansige perfekte pasmaat by al 13 lokusse is ongeveer een uit 10 triljoen.

DEEL 3: BOU 'N DNS-PROFIEL EN LOS 'N MISDAAD OP

Vandag se tegnologie het dit makliker gemaak om DNS-profiele vinnig en akkuraat te genereer. In hierdie deel van die aktiwiteit sal jy self die proses modelleer om 'n misdaad op te los. Sterkte, speurder!

Misdaadverslag: 'n Dief het 'n kosbare versameling juwele uit die Museum van Kosbare Juwele gesteel. Forensiese tegnici het velselle gekry van 'n voorkopafdruk wat op die glasomhulsel van die juweeluitstalling gelaat is. DNA is geïsoleer en PCR geamplifiseer vir sommige van die standaard STR lokusse. 'n Gedeeltelike genetiese profiel wat uit die versamelde DNA gegenereer word, word in Figuur 5 getoon.

DNS-profilering met behulp van STR's Studente-uitdeelstuk

Figuur 5. Die DNS-profiel van die voorkopafdruk vanaf die toneel van die misdaad. Elke gekleurde lyn toon die allele vir een van vier van die kern CODIS STR lokusse (D5S818, CSF1PO, D7S820, D8S1179).

’n Verdagte is in die saak geïdentifiseer. Haar DNS is ingesamel, en data vir die vier STR lokusse wat by die ontleding van die voorkopafdruk ingesluit is, is verkry. Die verdagte se profieldata word op die volgende bladsy gewys.

Jou taak: Vergelyk die verdagte se data hieronder met die elektroferogram in Figuur 5. Ontleed elke STR-lokus deur die herhalings vir elke lokus op te spoor en die aantal herhalings te tel en dui aan of die verdagte homosigoties of heterosigoties by elke lokus is. Teken jou antwoorde op die volgende bladsy aan.

VERDAKTE SE DNS-PROFIEL DATA

alleel 1: 5'–CAATCATAGCCACAAGATAGATAGATAGATAGATAGATAGATACCAAAGAG–3'

alleel 2: 5'–CAATCATAGCCACAAGATAGATAGATAGATAGATAGATAGATAGATACCAAAGAG–3'

alleel 1: 5'–GGCCATCTTCAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATGCTAGTCC–3'

alleel 2: 5'–GGCCATCTTCAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATGCTAGTCC–3'

alleel 1: 5'–CCTCATTGACGATAGATAGATAGATAGATAGATACATAGTCAG–3'

alleel 2: 5'–CCTCATTGACGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATACATAGTCAG–3'

alleel 1: 5'–GTTCATTTTCATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTACGAATGTACA–3'

alleel 2: 5'–GTTCATTTTCATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTACGAATGTACA–3'

DNS-profilering met behulp van STR's Studente-uitdeelstuk

UITBREIDINGSAKTIWITEIT

Alleelfrekwensies vertel jou hoe algemeen 'n gegewe alleel in 'n populasie is. 'n Alleelfrekwensie van 0. beteken dat daar van 3% van die bevolking verwag kan word om daardie spesifieke alleel te hê. Die frekwensie in die Amerikaanse bevolking van elke STR-alleel uit die verdagte se profiel is in die tabel hieronder verskaf.

STR-alleel van verdagte se DNS-profiel

Frekwensie in die Amerikaanse bevolking

Om die waarskynlikheid van 'n genotipe te bereken, kan ons die formules hieronder gebruik:

Heterosigotiese genotipefrekwensie = 2pq, waar p die frekwensie van die eerste alleel en q is

Is die frekwensie van die tweede alleel

Homosigotiese genotipefrekwensie = p 2 , waar p die frekwensie van die alleel is

  1. Gebruik die Amerikaanse frekwensiedata en bereken die waarskynlikheid dat die gegewe genotipe by elke lokus is. Wys jou werk.

a. Waarskynlikheid van genotipe vir D5S818: __

b. Waarskynlikheid van genotipe vir CSF1PO: __

c. Waarskynlikheid van genotipe vir D7S820: __

d. Waarskynlikheid van genotipe vir D8S1179: _____

DNS-profilering met behulp van STR's Studente-uitdeelstuk

Onthou dat die allele hierbo onafhanklik van mekaar geërf word. Om die waarskynlikheid te bepaal dat 'n lokus met 'n ander lokus geërf word, gebruik ons ​​die produkreël vir die kombinasie van waarskynlikhede. Om die waarskynlikheid te bereken om 'n gegewe genetiese vingerafdruk te hê, word die waarskynlikhede om elke STR-genotipe te hê met mekaar vermenigvuldig.

  1. Bereken die waarskynlikheid dat iemand anders 'n DNS-profiel het wat identies is aan dié van die verdagte. Wys jou werk.

Die waarskynlikheid wat in Vraag 4 bereken is, verteenwoordig die waarskynlikheid dat iemand anders as die verdagte die DNS wat op die misdaadtoneel gevind is, gelos het.


Geval 1: Sifting vir die sekelselgeen

Die enigste verskil tussen die twee gene is die vervanging van 'n T vir 'n A in die middelste posisie van kodon 6.

  • skakel 'n GAG-kodon (vir Glu) om na 'n GTG-kodon vir Val en
  • skaf 'n volgorde af (CTGAGG, wat oor kodons 5, 6 en 7 strek) wat deur een van die beperkingsensieme herken en gesny word.

Wanneer die normaal geen (beta A ) met die ensiem verteer word en die fragmente deur elektroforese geskei word, bind die sonde aan 'n kort fragment (tussen die rooi pyle).

Die ensiem kan egter nie die sny nie sekelselgeen op hierdie terrein, so die sonde heg aan 'n baie groter fragment (tussen die blou pyle).

Die figuur (uit data verskaf deur S. E. Antonarakis) toon die stamboom van 'n familie wie se enigste seun sekelselsiekte het. Beide sy pa en ma was heterosigoties (halfgevulde boks en sirkel onderskeidelik) soos hulle moes wees om 'n aangetaste kind (soliede boks) voort te bring. Die elektroforesepatrone vir elke lid van die gesin word direk onder hulle geplaas. Let daarop dat die twee homosigotiese kinders (1 en 3) slegs 'n enkele band het, maar dit is meer intens omdat daar twee keer soveel DNA in hulle is.

In hierdie voorbeeld het 'n verandering van 'n enkele nukleotied die RFLP geproduseer. Dit is 'n baie algemene oorsaak van RFLP's en nou word daar dikwels na sulke polimorfismes verwys enkele nukleotied polimorfismes of SNP's. (Nie alle RFLP's spruit egter uit SNP's nie. Skakel na 'n voorbeeld van een wat dit nie gedoen het nie.)

Hoe kan hierdie gereedskap gebruik word?

Deur die DNS van voornemende ouers te toets, kan hul genotipe bepaal word en hul kans om 'n aangetaste kind te produseer kan bepaal word. In die geval van sekelselsiekte, indien albei ouers is heterosigoties vir die gene, daar is 'n 1 uit 4 kans dat hulle 'n kind met die siekte sal produseer. Amniosentese en chorionvillus-steekproefneming maak dit moontlik om vroeg in swangerskap dieselfde tegnieke op die DNA van 'n fetus toe te pas. Die ouers kan leer of die ongebore kind vry sal wees van die siekte of nie. Hulle kan kies om 'n aborsie te ondergaan eerder as om 'n geteisterde kind in die wêreld te bring.

  • Die mutasies wat die meeste menslike genetiese siektes veroorsaak, is meer uiteenlopend as die enkele mutasie wat met sekelselsiekte geassosieer word. Meer as duisend verskillende mutasies in die sistiese fibrose geen kan die siekte veroorsaak. 'n Ondersoek vir een sal waarskynlik nie 'n tweede identifiseer nie. 'n Mengsel van probes, een vir elk van die meer algemene mutasies, kan gebruik word. Maar daar bly die probleem van "vals negatiewe": mense wat valslik vertel word dat hulle nie 'n mutante geen dra nie.
  • Daar is baie siektes wat voortspruit uit verskeie mutante gene wat saamwerk om die siekte fenotipe te produseer.
  • Daar is steeds genetiese siektes waarvoor geen geen ontdek is nie. Totdat die geen opgespoor, gekloon en georden kan word, kan geen sonde gemaak word om dit direk op te spoor nie. Dit is egter soms moontlik om 'n genetiese "merker" te vind wat as 'n surrogaat vir die geen self kan dien. Kom ons kyk hoe.

Gegewe die aantal individue wat 'n resessiewe versteuring het, hoe kan mens die waarskynlikheid bereken dat die versteuring oorgeërf is? - Biologie

Aan die einde van hierdie afdeling sal jy die volgende kan doen:

  • Verduidelik Mendel se wet van segregasie en onafhanklike verskeidenheid in terme van genetika en die gebeure van meiose
  • Gebruik die gevurkte-lynmetode en die waarskynlikheidsreëls om die waarskynlikheid van genotipes en fenotipes van veelvuldige geenkruisings te bereken
  • Verduidelik die effek van koppeling en rekombinasie op gameetgenotipes
  • Verduidelik die fenotipiese uitkomste van epistatiese effekte tussen gene

Mendel het die resultate van sy ertjie-plant-eksperimente in vier postulate veralgemeen, waarvan sommige soms "wette" genoem word, wat die basis van dominante en resessiewe oorerwing in diploïede organismes beskryf. Soos jy geleer het, bestaan ​​meer komplekse uitbreidings van Mendelisme wat nie dieselfde F vertoon nie2 fenotipiese verhoudings (3:1). Nietemin vat hierdie wette die basiese beginsels van klassieke genetika op.

Pare eenheidsfaktore, of gene

Mendel het eerstens voorgestel dat gepaarde eenheidsfaktore van oorerflikheid getrou van geslag tot geslag oorgedra word deur die dissosiasie en herassosiasie van gepaarde faktore tydens onderskeidelik gametogenese en bevrugting. Nadat hy ertjies met kontrasterende eienskappe gekruis het en gevind het dat die resessiewe eienskap weer in die F2 generasie, het Mendel afgelei dat oorerflike faktore as diskrete eenhede geërf moet word. Hierdie bevinding het die oortuiging op daardie tydstip weerspreek dat ouerlike eienskappe in die nageslag vermeng is.

Allele kan dominant of resessief wees

Mendel se wet van oorheersing bepaal dat in 'n heterosigoot een eienskap die teenwoordigheid van 'n ander eienskap vir dieselfde eienskap sal verberg. Eerder as dat beide allele tot 'n fenotipe bydra, sal die dominante alleel uitsluitlik uitgedruk word. Die resessiewe alleel sal "latent" bly, maar sal na die nageslag oorgedra word op dieselfde manier waarop die dominante alleel oorgedra word. Die resessiewe eienskap sal slegs uitgedruk word deur nageslag wat twee kopieë van hierdie alleel het ((Figuur)), en hierdie nageslag sal waar teel wanneer hulle self gekruis word.

Sedert Mendel se eksperimente met ertjieplante het navorsers gevind dat die wet van dominansie nie altyd geld nie. In plaas daarvan is gevind dat verskeie verskillende patrone van oorerwing bestaan.

Figuur 1. Die kind op die foto gee uitdrukking aan albinisme, 'n resessiewe eienskap.

Gelyke skeiding van allele

Deur waar te neem dat ware broeiende ertjieplante met kontrasterende eienskappe aanleiding gegee het tot F1 generasies wat almal die dominante eienskap uitgedruk het en F2 generasies wat die dominante en resessiewe eienskappe in 'n 3:1 verhouding uitgedruk het, het Mendel die wet van segregasie voorgestel. Hierdie wet bepaal dat gepaarde eenheidsfaktore (gene) eweredig in gamete moet segregeer sodat nageslag 'n gelyke waarskynlikheid het om enige van die faktore te erf. Vir die F2 generering van 'n monohibriede kruising, kan die volgende drie moontlike kombinasies van genotipes ontstaan: homosigoties dominant, heterosigoties of homosigoties resessief. Omdat heterosigote uit twee verskillende weë kan ontstaan ​​(wat een dominante en een resessiewe alleel van enige ouer ontvang), en omdat heterosigote en homosigote dominante individue fenotipies identies is, ondersteun die wet Mendel se waargenome 3:1 fenotipiese verhouding. Die gelyke segregasie van allele is die rede waarom ons die Punnett-vierkant kan toepas om die nageslag van ouers met bekende genotipes akkuraat te voorspel. Die fisiese basis van Mendel se wet van segregasie is die eerste verdeling van meiose, waarin die homoloë chromosome met hul verskillende weergawes van elke geen in dogterkerne geskei word. Die rol van die meiotiese segregasie van chromosome in seksuele voortplanting is nie gedurende Mendel se leeftyd deur die wetenskaplike gemeenskap verstaan ​​nie.

Onafhanklike Assortiment

Mendel se wet van onafhanklike assortiment bepaal dat gene mekaar nie beïnvloed met betrekking tot die sortering van allele in gamete nie, en elke moontlike kombinasie van allele vir elke geen sal ewe waarskynlik voorkom. Die onafhanklike verskeidenheid van gene kan geïllustreer word deur die dihibriede kruising, 'n kruising tussen twee ware broeiende ouers wat verskillende eienskappe vir twee eienskappe uitdruk. Oorweeg die eienskappe van saadkleur en saadtekstuur vir twee ertjieplante, een met groen, gerimpelde sade (jr) en nog een wat geel, ronde sade het (JJRR). Omdat elke ouer homosigoties is, dui die wet van segregasie aan dat die gamete vir die groen/gerimpelde plant almal is jr, en die gamete vir die geel/ronde plant is almal YR. Daarom het die F1 generasie nageslag almal is JjRr ((Figuur)).

Kunsverbinding

Figuur 2. Hierdie dihibriede kruising van ertjieplante behels die gene vir saadkleur en -tekstuur.

In ertjieplante is pers blomme (P) dominant vir wit blomme (p) en geel ertjies (Y) is dominant vir groen ertjies (y). Wat is die moontlike genotipes en fenotipes vir 'n kruising tussen PpYY en ppYy ertjieplante? Hoeveel vierkante het jy nodig om 'n Punnett-kwadraat-analise van hierdie kruis te doen?

Vir die F2-generasie vereis die wet van segregasie dat elke gameet óf 'n R alleel of 'n r alleel saam met óf a Y alleel of a y alleel. Die wet van onafhanklike assortiment bepaal dat 'n gameet waarin 'n r alleel gesorteer sal ewe waarskynlik óf 'n bevat Y alleel of a y alleel. Daar is dus vier ewe waarskynlike gamete wat gevorm kan word wanneer die JjRr heterosigote word self gekruis, soos volg: YR, Jr, yR, en jr. Deur hierdie gamete langs die bokant en links van 'n 4 × 4 Punnett-vierkant ((Figuur)) te rangskik, gee ons 16 ewe waarskynlike genotipiese kombinasies. Uit hierdie genotipes lei ons 'n fenotipiese verhouding van 9 rond/geel:3 rond/groen:3 gerimpel/geel:1 gerimpel/groen af ​​((Figuur)). Dit is die nageslagverhoudings wat ons sou verwag, as ons die kruisings met 'n groot genoeg monstergrootte uitgevoer het.

As gevolg van onafhanklike verskeidenheid en dominansie, kan die 9:3:3:1 dihibriede fenotipiese verhouding in twee 3:1 verhoudings ineengestort word, kenmerkend van enige monohibriede kruising wat 'n dominante en resessiewe patroon volg. As ons saadkleur ignoreer en slegs saadtekstuur in die bogenoemde dihibriede kruising in ag neem, sou ons verwag dat driekwart van die F2 generasie nageslag sou rond wees, en een kwart sou verrimpeld wees. Net so, deur slegs saadkleur te isoleer, sou ons aanvaar dat driekwart van die F2 nageslag sou geel wees en een kwart sou groen wees. Die sortering van allele vir tekstuur en kleur is onafhanklike gebeurtenisse, dus kan ons die produkreël toepas. Daarom is die verhouding van ronde en geel F2 nageslag sal na verwagting (3/4) × (3/4) = 9/16 wees, en die verhouding van gerimpelde en groen nageslag sal na verwagting (1/4) × (1/4) = 1/16 wees. Hierdie verhoudings is identies aan dié wat verkry word deur 'n Punnett-vierkant te gebruik. Ronde, groen en gerimpelde, geel nageslag kan ook met behulp van die produkreël bereken word, aangesien elkeen van hierdie genotipes een dominante en een resessiewe fenotipe insluit. Daarom word die proporsie van elk bereken as (3/4) × (1/4) = 3/16.

Die wet van onafhanklike assortiment dui ook aan dat 'n kruising tussen geel, gerimpelde (JJR) en groen, rond (jjRR) ouers sou dieselfde F oplewer1 en F2 nageslag soos in die JJRR x jr kwaad.

Die fisiese basis vir die wet van onafhanklike assortiment lê ook in meiose I, waarin die verskillende homoloë pare in ewekansige oriëntasies in lyn is. Elke gameet kan enige kombinasie van vaderlike en moederlike chromosome (en dus die gene daarop) bevat omdat die oriëntasie van tetrads op die metafasevlak ewekansig is.

Vurklyn-metode

Wanneer meer as twee gene oorweeg word, word die Punnett-kwadraat-metode onhandelbaar. Byvoorbeeld, die ondersoek van 'n kruising wat vier gene behels, sal 'n 16 × 16 rooster vereis wat 256 bokse bevat. Dit sal uiters omslagtig wees om elke genotipe handmatig in te voer. Vir meer komplekse kruisings word die gevurkte-lyn- en waarskynlikheidsmetodes verkies.

Om 'n gevurkte lyndiagram vir 'n kruising tussen F voor te berei1 heterosigote wat voortspruit uit 'n kruising tussen AABBCC en aabbcc ouers, skep ons eers rye gelykstaande aan die aantal gene wat oorweeg word, en skei dan die allele in elke ry op gevurkte lyne volgens die waarskynlikhede vir individuele monohibriede kruisings ((Figuur)). Ons vermenigvuldig dan die waardes langs elke gevurkte pad om die F te verkry2 nageslag waarskynlikhede. Let daarop dat hierdie proses 'n diagrammatiese weergawe van die produkreël is. Die waardes langs elke gevurkte pad kan vermenigvuldig word omdat elke geen onafhanklik sorteer. Vir 'n trihibriede kruising, die F2 fenotipiese verhouding is 27:9:9:9:3:3:3:1.

Figuur 3. Die vurklynmetode kan gebruik word om 'n trihibriedkruising te ontleed. Hier beslaan die waarskynlikheid vir kleur in die F2-generasie die boonste ry (3 geel:1 groen). Die waarskynlikheid vir vorm beslaan die tweede ry (3 rondes: 1 gerimpeld), en die waarskynlikheid vir hoogte beslaan die derde ry (3 lank: 1 dwerg). Die waarskynlikheid vir elke moontlike kombinasie van eienskappe word bereken deur die waarskynlikheid vir elke individuele eienskap te vermenigvuldig. Die waarskynlikheid dat F2-nageslag geel, rond en lang eienskappe het, is dus 3 × 3 × 3, of 27.

Waarskynlikheidsmetode

Terwyl die gevurkte-lyn-metode 'n diagrammatiese benadering is om tred te hou met waarskynlikhede in 'n kruis, gee die waarskynlikheidsmetode die proporsies van nageslag wat verwag word om elke fenotipe (of genotipe) te vertoon sonder die bykomende visuele hulp. Beide metodes maak gebruik van die produkreël en oorweeg die allele vir elke geen afsonderlik. Vroeër het ons die fenotipiese proporsies vir 'n trihibriede kruising ondersoek deur die gevurkte-lyn metode te gebruik, nou sal ons die waarskynlikheidsmetode gebruik om die genotipiese proporsies vir 'n kruising met selfs meer gene te ondersoek.

Vir 'n trihibriede kruising is die uitskryf van die gevurkte-lyn-metode vervelig, hoewel nie so vervelig soos die gebruik van die Punnett-vierkant-metode nie. Om die krag van die waarskynlikheidsmetode volledig te demonstreer, kan ons egter spesifieke genetiese berekeninge oorweeg. Byvoorbeeld, vir 'n tetrahibriede kruising tussen individue wat heterosigote vir al vier gene is, en waarin al vier gene onafhanklik en in 'n dominante en resessiewe patroon sorteer, watter proporsie van die nageslag sal verwag word om homosigoties resessief te wees vir al vier allele ? Eerder as om elke moontlike genotipe uit te skryf, kan ons die waarskynlikheidsmetode gebruik. Ons weet dat vir elke geen, die fraksie van homosigotiese resessiewe nageslag 1/4 sal wees. Deur dus hierdie breuk vir elk van die vier gene, (1/4) × (1/4) × (1/4) × (1/4) te vermenigvuldig, bepaal ons dat 1/256 van die nageslag viervoudig homosigoties resessief sal wees .

Vir dieselfde tetrahibriede kruising, wat is die verwagte proporsie nageslag wat die dominante fenotipe by al vier lokusse het? Ons kan hierdie vraag beantwoord deur fenotipiese proporsies te gebruik, maar kom ons doen dit op die moeilike manier - deur genotipiese proporsies te gebruik. Die vraag vra na die proporsie nageslag wat 1) homosigoties dominant is A of heterosigoties by A, en 2) homosigoties by B of heterosigoties by B, en so aan. Deur die "of" en "en" in elke omstandighede te let, maak dit duidelik waar om die som- en produkreëls toe te pas. Die waarskynlikheid van 'n homosigotiese dominant by A is 1/4 en die waarskynlikheid van 'n heterosigoot by A is 1/2. Die waarskynlikheid van die homosigoot of die heterosigoot is 1/4 + 1/2 = 3/4 deur die somreël te gebruik. Dieselfde waarskynlikheid kan op dieselfde manier vir elk van die ander gene verkry word, sodat die waarskynlikheid van 'n dominante fenotipe by A en B en C en D is, met die produkreël, gelyk aan 3/4 × 3/4 × 3/4 × 3/4, of 27/64. As jy ooit onseker is oor hoe om waarskynlikhede te kombineer, moet terugkeer na die gevurkte-lyn-metode dit duidelik maak.

Reëls vir multihibriede bemesting

Om die genotipes en fenotipes van nageslag van gegewe kruisings te voorspel, is die beste manier om jou kennis van Mendeliese genetika te toets. Gegewe 'n multihibriede kruising wat aan onafhanklike assortiment gehoorsaam en 'n dominante en resessiewe patroon volg, bestaan ​​daar verskeie algemene reëls, jy kan hierdie reëls gebruik om jou resultate na te gaan terwyl jy deur genetiese berekeninge werk ((Figuur)). Om hierdie reëls toe te pas, moet jy eers bepaal n, die aantal heterosigotiese geenpare (die aantal gene wat twee allele elk skei). Byvoorbeeld, 'n kruising tussen AaBb en AaBb heterosigote het 'n n van 2. Daarteenoor 'n kruising tussen AABb en AABb het 'n n van 1 omdat A is nie heterosigoties nie.

Algemene reëls vir multihibriede kruisings
Algemene reël Aantal heterosigotiese geenpare
Aantal verskillende F1 gamete 2 n
Aantal verskillende F2 genotipes 3 n
Gegewe dominante en resessiewe oorerwing, die aantal verskillende F2 fenotipes 2 n

Gekoppelde gene oortree die wet op onafhanklike assortiment

Alhoewel al Mendel se ertjie-eienskappe volgens die wet van onafhanklike assortiment gedra het, weet ons nou dat sommige alleelkombinasies nie onafhanklik van mekaar geërf word nie. Gene wat op aparte nie-homologe chromosome geleë is, sal altyd onafhanklik sorteer. Elke chromosoom bevat egter honderde of duisende gene, lineêr georganiseer op chromosome soos krale aan 'n tou. Die segregasie van allele in gamete kan beïnvloed word deur koppeling, waarin gene wat fisies naby mekaar geleë is op dieselfde chromosoom meer geneig is om as 'n paar geërf te word. As gevolg van die proses van rekombinasie, of "crossover", is dit egter moontlik dat twee gene op dieselfde chromosoom onafhanklik optree, of asof hulle nie gekoppel is nie. Om dit te verstaan, kom ons kyk na die biologiese basis van geenkoppeling en rekombinasie.

Homoloë chromosome besit dieselfde gene in dieselfde lineêre volgorde. Die allele kan verskil op homoloë chromosoompare, maar die gene waarmee hulle ooreenstem, verskil nie. Ter voorbereiding vir die eerste verdeling van meiose, repliseer homoloë chromosome en sinaps. Soos gene op die homoloë in lyn met mekaar. Op hierdie stadium ruil segmente van homoloë chromosome lineêre segmente van genetiese materiaal uit ((Figuur)). Hierdie proses word genoem herkombinasie, of crossover, en dit is 'n algemene genetiese proses. Omdat die gene tydens rekombinasie belyn is, word die geenorde nie verander nie. Die gevolg van rekombinasie is dat moeder- en vaderlike allele op dieselfde chromosoom gekombineer word. Verskeie rekombinasiegebeurtenisse kan oor 'n gegewe chromosoom plaasvind, wat 'n uitgebreide skommeling van allele kan veroorsaak.

Figuur 4. Die proses van oorkruising, of rekombinasie, vind plaas wanneer twee homoloë chromosome tydens meiose in lyn is en 'n segment van genetiese materiaal uitruil. Hier is die allele vir geen C uitgeruil. Die resultaat is twee rekombinante en twee nie-rekombinante chromosome.

Wanneer twee gene in die nabyheid op dieselfde chromosoom geleë is, word hulle as gekoppel beskou, en hul allele is geneig om deur meiose saam oorgedra te word. Om dit te illustreer, stel jou 'n dihibriede kruising voor wat blomkleur en planthoogte behels waarin die gene langs mekaar op die chromosoom is. As een homoloë chromosoom allele vir lang plante en rooi blomme het, en die ander chromosoom het gene vir kort plante en geel blomme, dan sal wanneer die gamete gevorm word, die lang en rooi allele saamgaan in 'n gameet en die kort en geel allele sal in ander gamete ingaan. Dit word die ouerlike genotipes genoem omdat hulle ongeskonde geërf is van die ouers van die individu wat gamete produseer. Maar anders as as die gene op verskillende chromosome was, is daar geen gamete met lang en geel allele nie en geen gamete met kort en rooi allele nie. As jy die Punnett-vierkant met hierdie gamete skep, sal jy sien dat die klassieke Mendeliese voorspelling van 'n 9:3:3:1-uitkoms van 'n dihibriede kruising nie van toepassing sal wees nie. Soos die afstand tussen twee gene toeneem, neem die waarskynlikheid van een of meer oorkruisings tussen hulle toe, en die gene tree meer op soos hulle op aparte chromosome is. Genetici het die proporsie rekombinante gamete (die wat nie soos die ouers is nie) gebruik as 'n maatstaf van hoe ver van mekaar af gene op 'n chromosoom is. Deur hierdie inligting te gebruik, het hulle uitgebreide kaarte van gene op chromosome opgestel vir goed bestudeerde organismes, insluitend mense.

Mendel se hoofpublikasie maak geen melding van koppeling nie, en baie navorsers het bevraagteken of hy koppeling teëgekom het, maar het verkies om nie daardie kruisies te publiseer nie uit kommer dat dit sy onafhanklike assortimentpostulaat ongeldig sou maak. Die tuin-ertjie het sewe chromosome, en sommige het voorgestel dat sy keuse van sewe eienskappe nie toevallig was nie. Selfs al was die gene wat hy ondersoek nie op afsonderlike chromosome geleë nie, is dit moontlik dat hy eenvoudig nie skakeling waargeneem het as gevolg van die uitgebreide skommelingseffekte van rekombinasie nie.

Wetenskaplike metodeverbinding

Toets die hipotese van onafhanklike assortiment

Om die hoeveelheid arbeid en vindingrykheid wat in Mendel se eksperimente ingegaan het beter te waardeer, gaan deur een van Mendel se dihibriede kruisings.

Vraag: Wat sal die nageslag van 'n dihibriede kruising wees?

Agtergrond: Neem in ag dat ertjieplante in een groeiseisoen volwasse word, en jy het toegang tot ’n groot tuin waarin jy duisende ertjieplante kan kweek. Daar is verskeie ware broeiende plante met die volgende pare eienskappe: lang plante met opgeblaasde peule, en dwergplante met saamgetrekte peule. Voordat die plante volwasse is, verwyder jy die stuifmeelproduserende organe van die lang/opgeblaasde plante in jou kruisings om selfbevrugting te voorkom. Met plantrypwording word die plante met die hand gekruis deur stuifmeel van die dwerg-/beklemde plante na die stigmata van die lang/opgeblaasde plante oor te dra.

Hipotese: Albei kenmerkpare sal onafhanklik volgens Mendeliaanse wette sorteer. Wanneer die ware broei-ouers gekruis word, sal al die F1 nageslag is lank en het opgeblaasde peule, wat daarop dui dat die lang en opgeblaasde eienskappe onderskeidelik dominant is oor die dwerg- en vernoue eienskappe. 'n Selfkruising van die F1 heterosigote lei tot 2 000 F2 nageslag.

Toets die hipotese: Omdat elke eienskappaar onafhanklik sorteer, word verwag dat die verhoudings van lank:dwerg en opgeblaas:vernou elk 3:1 sal wees. Die lang/dwerg-eienskapspaar word genoem T/t, en die opgeblaasde/verkorte eienskappaar word aangewys Ek/i. Elke lid van die F1 generasie het dus 'n genotipe van TtIi. Konstrueer 'n rooster analoog aan (Figuur), waarin jy twee kruis TtIi individue. Elke individu kan vier kombinasies van twee eienskappe skenk: TI, Ti, tI, of ti, wat beteken dat daar 16 moontlikhede van nageslaggenotipes is. Omdat die T en ek allele dominant is, sal enige individu met een of twee van daardie allele onderskeidelik die lang of opgeblaasde fenotipes uitdruk, ongeag of hulle ook 'n t of ek alleel. Slegs individue wat is tt of ii sal onderskeidelik die dwerg- en verkorte allele uitdruk. Soos getoon in (Figuur), voorspel jy dat jy die volgende nageslagproporsies sal waarneem: lank/opgeblaas:lang/vernou:dwerg/opgeblaas:dwerg/vernou in 'n verhouding van 9:3:3:1. Let op vanaf die rooster dat wanneer die lang/dwerg en opgeblaasde/verkorte eienskappare in isolasie in ag geneem word, hulle elk in 3:1 verhoudings geërf word.

Figuur 5. Hierdie figuur toon alle moontlike kombinasies van nageslag wat voortspruit uit 'n dihibriede kruising van ertjieplante wat heterosigoties is vir die lang/dwerg en opgeblaasde/verkorte allele.

Toets die hipotese: Jy kruis die dwerg en lang plante en kruis dan self die nageslag. Vir die beste resultate word dit herhaal met honderde of selfs duisende ertjieplante. Watter spesiale voorsorgmaatreëls moet getref word by die kruisings en in die groei van die plante?

Ontleed jou data: Jy neem die volgende plantfenotipes waar in die F2 generasie: 2706 hoog/opgeblaas, 930 hoog/vernou, 888 dwerg/opgeblaas, en 300 dwerg/verkort. Verminder hierdie bevindings tot 'n verhouding en bepaal of dit ooreenstem met Mendeliaanse wette.

Vorm 'n gevolgtrekking: Was die resultate naby aan die verwagte 9:3:3:1 fenotipiese verhouding? Ondersteun die resultate die voorspelling? Wat kan waargeneem word as baie minder plante gebruik word, aangesien allele ewekansig in gamete skei? Probeer jou voorstel dat jy soveel ertjieplante kweek, en oorweeg die potensiaal vir eksperimentele foute. Byvoorbeeld, wat sou gebeur as dit eendag uiters winderig was?

Epistase

Mendel se studies oor ertjieplante impliseer dat die som van 'n individu se fenotipe deur gene beheer word (of soos hy dit noem, eenheidsfaktore), sodat elke eienskap duidelik en volledig deur 'n enkele geen beheer word. Trouens, enkele waarneembare eienskappe is feitlik altyd onder die invloed van veelvuldige gene (elk met twee of meer allele) wat eendragtig optree. Byvoorbeeld, ten minste agt gene dra by tot oogkleur by mense.

Skakel na Leer

Oogkleur by mense word deur verskeie gene bepaal. Gebruik die oogkleursakrekenaar om die oogkleur van kinders uit ouer se oogkleur te voorspel.

In sommige gevalle kan verskeie gene bydra tot aspekte van 'n algemene fenotipe sonder dat hul geenprodukte ooit direk interaksie het. In die geval van orgaanontwikkeling, kan gene byvoorbeeld opeenvolgend uitgedruk word, en elke geen dra by tot die kompleksiteit en spesifisiteit van die orgaan. Gene kan op komplementêre of sinergistiese wyses funksioneer, sodat twee of meer gene gelyktydig uitgedruk moet word om 'n fenotipe te beïnvloed. Gene kan ook teenoor mekaar staan, met een gene wat die uitdrukking van 'n ander verander.

In epistase is die interaksie tussen gene antagonisties, sodanig dat een geen die uitdrukking van 'n ander masker of inmeng. "Epistasis" is 'n woord saamgestel uit Griekse wortels wat beteken "staan ​​op." Daar word gesê dat die allele wat gemasker of stilgemaak word, hipostaties is teenoor die epistatiese allele wat die maskering doen. Dikwels is die biochemiese basis van epistase 'n geenweg waarin die uitdrukking van een geen afhanklik is van die funksie van 'n geen wat dit voorafgaan of volg in die pad.

'n Voorbeeld van epistase is pigmentasie in muise. Die wilde-tipe jaskleur, agouti (AA), is dominant vir eenkleurige pels (aa). 'N Afsonderlike geen (C) is nodig vir die produksie van pigmente. 'N Muis met 'n resessiewe c allel op hierdie lokus kan nie pigment produseer nie en is albino, ongeag die allel wat op lokus voorkom A ((Figuur)). Daarom die genotipes AAcc, Aacc, en aacc almal produseer dieselfde albinofenotipe. 'n Kruising tussen heterosigote vir beide gene (AaCc x AaCc) sou nageslag genereer met 'n fenotipiese verhouding van 9 agouti:3 soliede kleur:4 albino ((Figuur)). In hierdie geval, die C geen is epistaties vir die A geen.

Figuur 6. By muise is die gevlekte agouti-jaskleur (A) dominant vir 'n soliede kleur, soos swart of grys. 'n Geen op 'n aparte lokus (C) is verantwoordelik vir pigmentproduksie. Die resessiewe c-alleel produseer nie pigment nie, en 'n muis met die homosigotiese resessiewe cc-genotipe is albino ongeag die alleel wat by die A-lokus teenwoordig is. Die C-geen is dus epistaties teenoor die A-geen.

Epistase kan ook voorkom wanneer 'n dominante alleel uitdrukking by 'n aparte geen masker. Vrugkleur in somerpampoen word op hierdie manier uitgedruk. Homosigotiese resessiewe uitdrukking van die W geen (ww) tesame met homosigotiese dominante of heterosigotiese uitdrukking van die Y geen (JJ of Yy) genereer geel vrugte, en die wwyy genotipe produseer groen vrugte. As 'n dominante kopie van die W geen in die homosigotiese of heterosigotiese vorm voorkom, sal die somerpampoen wit vrugte produseer, ongeag die Y allele. 'N Kruising tussen wit heterosigote vir beide gene (WwYy × WwYy) sou nageslag produseer met 'n fenotipiese verhouding van 12 wit: 3 geel: 1 groen.

Ten slotte kan epistase wederkerig wees sodat enige geen, wanneer dit in die dominante (of resessiewe) vorm teenwoordig is, dieselfde fenotipe uitdruk. In die herder se beursie plant (Capsella bursa-pastoris), word die kenmerk van saadvorm beheer deur twee gene in 'n dominante epistatiese verhouding. Wanneer die gene A en B is albei homosigoties resessief (aabb), die sade is eiervormig. As die dominante alleel vir een van hierdie gene teenwoordig is, is die resultaat driehoekige sade. Dit wil sê elke moontlike genotipe anders as aabb lei tot driehoekige sade en 'n kruising tussen heterosigote vir beide gene (AaBb x AaBb) sou nageslag oplewer met 'n fenotipiese verhouding van 15 driehoekig:1 eiervormig.

Hou in gedagte dat elke enkele eienskap wat lei tot 'n fenotipiese verhouding van 16, tipies is van 'n tweegen-interaksie. Onthou die fenotipiese oorerwingspatroon vir Mendel se dihibriede kruising, wat twee nie-interaksie gene beskou het—9:3:3:1. Net so sou ons verwag dat interaksie geenpare ook verhoudings sal vertoon wat as 16 dele uitgedruk word. Let daarop dat ons aanneem dat die gene wat interaksie het nie gekoppel is nie, hulle is steeds onafhanklik in gamete.

Skakel na Leer

Vir 'n uitstekende oorsig van Mendel se eksperimente en om jou eie kruisings uit te voer en patrone van oorerwing te identifiseer, besoek die Mendel's Peas-weblaboratorium.

Afdeling Opsomming

Mendel het gepostuleer dat gene (kenmerke) geërf word as pare allele (eienskappe) wat in 'n dominante en resessiewe patroon optree. Allele skei in gamete sodat elke gameet ewe waarskynlik een van die twee allele wat teenwoordig is in 'n diploïede individu sal ontvang. Daarbenewens word gene onafhanklik van mekaar in gamete verdeel. Dit wil sê, allele is oor die algemeen nie meer geneig om te skei in 'n gameet met 'n spesifieke alleel van 'n ander geen nie. 'n Dihibriede kruising demonstreer onafhanklike verskeidenheid wanneer die betrokke gene op verskillende chromosome of ver van mekaar op dieselfde chromosoom is. Vir kruisings wat meer as twee gene behels, gebruik die gevurkte lyn of waarskynlikheidsmetodes om genotipes en fenotipes van nageslag te voorspel eerder as 'n Punnett-vierkant.

Alhoewel chromosome onafhanklik in gamete sorteer tydens meiose, verwys Mendel se wet van onafhanklike assortiment na gene, nie chromosome nie, en 'n enkele chromosoom kan meer as 1 000 gene dra. Wanneer gene in die nabyheid op dieselfde chromosoom geleë is, is hul allele geneig om saam geërf te word. Dit lei tot nageslagverhoudings wat Mendel’ se wet van onafhanklike assortiment oortree. Rekombinasie dien egter om genetiese materiaal op homoloë chromosome uit te ruil sodat moederlike en vaderlike allele op dieselfde chromosoom herkombineer kan word. Dit is hoekom allele op 'n gegewe chromosoom nie altyd saam geërf word nie. Rekombinasie is 'n ewekansige gebeurtenis wat op enige plek op 'n chromosoom plaasvind. Gene wat ver uitmekaar is op dieselfde chromosoom is dus waarskynlik steeds onafhanklik as gevolg van rekombinasiegebeure wat in die tussenliggende chromosomale ruimte plaasgevind het.

Of hulle onafhanklik sorteer of nie, gene kan op die vlak van geenprodukte in wisselwerking tree sodat die uitdrukking van 'n alleel vir een geen die uitdrukking van 'n alleel vir 'n ander geen masker of wysig. Dit word epistase genoem.

Kunsverbindings

(Figuur) By ertjieplante is pers blomme (P) dominant vir wit blomme (p) en geel ertjies (Y) is dominant vir groen ertjies (y). Wat is die moontlike genotipes en fenotipes vir 'n kruising tussen PpYY en ppYy ertjieplante? Hoeveel vierkante het jy nodig om 'n Punnett-kwadraat-analise van hierdie kruis te doen?

(Figuur) Die moontlike genotipes is PpYY, PpYy, ppYY en ppYy. Eersgenoemde twee genotipes sou lei tot plante met pers blomme en geel ertjies, terwyl laasgenoemde twee genotipes sou lei tot plante met wit blomme met geel ertjies, vir 'n 1:1 verhouding van elke fenotipe. Jy benodig net 'n 2 × 2 Punnett-vierkant (vier vierkante in totaal) om hierdie analise te doen, want twee van die allele is homosigoties.

Meervoudige keuse

Aanvaar geen geenkoppeling, in 'n dihibriede kruising van AABB x aabb met AaBb F1 heterosigote, wat is die verhouding van die F1 gamete (AB, aB, Ab, ab) wat aanleiding sal gee tot die F2 nageslag?

Die gevurkte lyn en waarskynlikheidsmetodes maak gebruik van watter waarskynlikheidsreël?

Hoeveel verskillende nageslaggenotipes word verwag in 'n trihibriede kruising tussen ouers heterosigoties vir al drie eienskappe wanneer die eienskappe in 'n dominante en resessiewe patroon optree? Hoeveel fenotipes?

  1. 64 genotipes 16 fenotipes
  2. 16 genotipes 64 fenotipes
  3. 8 genotipes 27 fenotipes
  4. 27 genotipes 8 fenotipes

Labrador retriever se pelskleur word beheer deur twee allele, E en B. Enige hond met die ee__ genotipe ontwikkel in 'n geel laboratorium, terwyl B_E_ honde swart laboratoriums word en bbE_ honde sjokolade laboratoriums word. Dit is 'n voorbeeld van _____.

Watter van die volgende situasies doen nie die Wet van Onafhanklike Assortiment volg?

  1. 'n Blonde man en 'n donkerkop vrou bring mettertyd drie nageslag voort, wat almal blonde hare het.
  2. 'n Wit koei wat met 'n bruin bul gekruis word, produseer rooibeeste.
  3. Deur 'n vark met 'n sog te paar, produseer ses vroulike varkies.
  4. Mans is meer geneig om hemofilie te ervaar as vroue.

Gratis reaksie

Gebruik die waarskynlikheidsmetode om die genotipes en genotipiese proporsies van 'n kruising tussen te bereken AABBCc en Aabbcc ouers.

Met inagneming van elke geen afsonderlik, die kruis by A nageslag voortbring waarvan die helfte is AA en die helfte is Aa B alles sal produseer Bb C sal die helfte produseer Cc en die helfte cc. Proporsies is dan (1/2) × (1) × (1/2), of 1/4 AABbCc voortgaan vir die ander moontlikhede lewer 1/4 op AABbcc, 1/4 AaBbCc, en 1/4 AaBbcc. Die verhoudings is dus 1:1:1:1.

Verduidelik epistatis in terme van sy Griekstalige wortels “op staan”.

Epistase beskryf 'n antagonistiese interaksie tussen gene waarin een geen die uitdrukking van 'n ander masker of inmeng. Die geen wat inmeng, word epistaties genoem, asof dit op die ander (hipostatiese) geen staan ​​om die uitdrukking daarvan te blokkeer.

In Afdeling 12.3, "Erfeniswette," is 'n voorbeeld van epistase vir die somerpampoen gegee. Kruis wit WwYy heterosigote om die fenotipiese verhouding van 12 wit:3 geel:1 groen wat in die teks gegee is, te bewys.

Die kruis kan voorgestel word as 'n 4 × 4 Punnett-vierkant, met die volgende gamete vir elke ouer: WY, Wy, wY, en wy. Vir al 12 die nageslag wat 'n dominante uitdruk W geen, sal die nageslag wit wees. Die drie nageslag wat homosigoties resessief is vir w maar druk 'n dominante uit Y geen sal geel wees. Die oorblywende wwyy nageslag sal groen wees.

Mense met trisomie 21 ontwikkel Downsindroom. Watter wet van Mendeliese oorerwing word in hierdie siekte oortree? Wat is die mees waarskynlike manier waarop dit gebeur?

In enige trisomie-afwyking erf 'n pasiënt 3 kopieë van 'n chromosoom in plaas van die normale paar. Dit oortree die Wet van Segregasie, en vind gewoonlik plaas wanneer die chromosome nie skei tydens die eerste rondte van meiose nie.

’n Heterosigotiese ertjieplant produseer violetblomme en geel, ronde sade. Beskryf die verwagte genotipes van die gamete wat deur Mendeliese oorerwing geproduseer word. As al drie gene op dieselfde arm van een chromosoom gevind word, moet 'n wetenskaplike voorspel dat oorerwingspatrone die Mendeliese genetika sal volg?

Mendeliese oorerwing sou voorspel dat al drie gene onafhanklik geërf word. Daar is dus 8 verskillende gameet genotipe moontlikhede: VYR, VYr, VyR, Vyr, vYR, vYr, vyR, vyr. As al drie gene op dieselfde chromosoomarm gevind word, is dit onwaarskynlik dat onafhanklike verskeidenheid sal plaasvind omdat die gene naby aan mekaar (gekoppel) is.


Huntington se siekte

Boonop het Huntington se siekte - 'n outosomale dominante afwyking - gepaardgaande simptome wat verwoestend kan wees vir die Halley's Comet-kolonie. Aangesien Huntington se siekte 'n dominante afwyking is, neem dit net een ouer wat hierdie siekte het om die waarskynlikheid aansienlik te verhoog om hierdie siekte na opeenvolgende generasies oor te dra. As beide ouers heterosigoties is vir hierdie afwyking, is daar 'n 75% waarskynlikheid dat 'n nageslag hierdie versteuring sal erf, terwyl as een ouer heterosigoties is en een ouer homosigoties is vir hierdie versteuring, die waarskynlikheid vir die verkryging van hierdie versteuring 100% is. As gevolg van die hoë koers van oorerwing van hierdie versteuring wanneer hierdie versteuring algemeen voorkom in die ouergenerasie, is dit noodsaaklik dat wetenskaplikes koloniste vir hierdie versteuring ondersoek om te verseker dat die kolonie verby die aanvanklike generasie oorleef. Verder word Huntington's veroorsaak deur 'n vervorming in die HTT-geen wat 'n proteïen bekend as huntingtin produseer. Hierdie proteïen speel 'n integrale rol in die ontwikkeling en instandhouding van neurone en dus ervaar pasiënte met Huntington 'n geleidelike agteruitgang van motoriese en kognitiewe vermoëns. Huntington se siekte is ongeneeslik, degeneratief en chronies. Soos hierdie versteuring vorder, ervaar pasiënte bewegingsversteurings wat gekenmerk word deur onwillekeurige beweging en probleme om spraak te produseer, kognitiewe versteurings wat gekenmerk word deur probleme met impulsbeheer en verwerking van nuwe stimuli, en psigiatriese versteurings wat gekenmerk word deur obsessief-kompulsiewe versteurings en bipolêre versteurings. Aangesien hierdie simptome, indien dit oor opeenvolgende generasies heen voorkom, die kolonie se vermoë om te floreer en te oorleef aansienlik sou benadeel, is dit belangrik dat wetenskaplikes koloniste ondersoek om te bepaal of hulle hierdie afwyking het. Aangesien hierdie versteuring 'n dominante versteuring is, hoef wetenskaplikes net te bepaal of koloniste hierdie versteuring het of nie. Verder kan wetenskaplikes vir Huntington se siekte sif deur gebruik te maak van neurologiese ondersoek, motoriese reflekstoets, visietoets, gehoortoets, geestestoestandtoets, buitoets, geheuetoets, redenasietoets, verstandelike behendigheidstoets, 'n MRI-skandering, 'n CT-skandering, genetiese toets vir die HTT-geen, sowel as voorspellende genetiese toets gebaseer op familiegeskiedenis. Dit is nie nodig om na 'n stamboom vir hierdie afwyking te kyk nie aangesien homosigotiese resessiewe allele vir hierdie geen korreleer met nie hierdie siekte nie en dit is slegs nodig om te bepaal of 'n kolonis die siekte (dominante alleel) het om die nodige stappe te neem om die spesifieke kolonis om by die ekspedisie aan te sluit. Die volgende berekeninge toon hipotetiese waarskynlikhede wat wetenskaplikes in 'n bevolking van 20 koloniste met betrekking tot Huntington se siekte kan teëkom:

Figuur 4 en 5: Die diagram hierbo (aan die linkerkant) beeld spesifieke simptome uit wat met Huntington se siekte geassosieer word. Regs is 'n foto van 'n pasiënt wat deur hierdie afwyking geraak word.

Waarskynlikheid:

Alhoewel die persentasie van die bevolking met Huntington se versteuring slegs ongeveer .007% is, kan daar 'n hoër voorkoms van Huntington's in die koloniale bevolking wees as wetenskaplikes nalaat om die koloniste vir hierdie versteuring te ondersoek. Vir hierdie hipotetiese berekening, laat ons aanvaar dat 5 van die 20 koloniste 'n dominante alleel vir hierdie afwyking het. Van hierdie 5 koloniste is twee heterosigoties dominant en drie is homosigoties dominant, maar ongeag het al 5 koloniste hierdie afwyking. Onthou dat Huntington se is 'n outosomale, dominante afwyking is, so 'n kolonis moet ten minste een dominante alleel hê om hierdie afwyking te hê. Van hier af kan Punnet Squares gebruik word om waarskynlikhede te bereken. As al die heterosigotiese dominante koloniste teel met aparte koloniste wat homosigoties resessief is, sal 50% van hul nageslag hierdie afwyking hê. Verder, as al die homosigotiese dominante koloniste ook met aparte homosigotiese resessiewe individue broei, sal 100% van hul nageslag hierdie afwyking hê. As elke paar koloniste (daar is 10 totale pare) die gemiddelde aantal kinders wêreldwyd (2,4) het, sal die tweede koloniale generasie 24 nageslag hê (2,4 keer 10 pare). As ons ons genetiese waarskynlikhede van 50% neem vir die heterosigotiese en homosigotiese resessiewe kruising en 100% vir die homosigotiese dominante en heterosigotiese resessiewe kruising, sal die aantal nageslag uit 24 wat waarskynlik hierdie afwyking sal hê 9,6 wees of wanneer dit 10 na bo afgerond word ( (2 maal 2.4 gedeel deur 2) plus (3 maal 2.4)). Dus, onder hierdie toestande sal ongeveer 40 persent van die opeenvolgende generasie waarskynlik Huntington se siekte hê.

Verder bied hierdie relatief groot persentasie van die bevolking wat met hierdie afwyking bereken word, gekombineer met die onverbiddelike aard van hierdie siekte, genoegsame bewyse vir 'n ander rede waarom wetenskaplikes koloniste moet ondersoek voor hul ekspedisie vir Huntington se siekte.

Figuur 6 en 7: Die Punnet Squares hierbo beeld beide die hipotetiese kruise uit wat gebruik word vir die berekening van waarskynlikhede van Huntington se versteuring. Deur hierdie waarskynlikhede te gebruik, kan die waarskynlikheid van voorkoms in die koloniale samelewing bepaal word.


Deel 3: Menslike Genetika Probleme

Genetiese beraders is opgelei om oorerwingspatrone van genetiese siektes op te spoor gebaseer op inligting wat hulle van die familie verkry. Stel jou voor dat jy 'n genetiese berader is en jy moet die volgende gevalle oplos op grond van die inligting wat verskaf word. Gebruik die volgende stappe om elke probleem op te los:

  1. Skep 'n legende wat die betrokke geenpare (allele) aandui. Gebruik 'n hoofletter om die dominante alleel aan te dui en kleinletter om die resessiewe alleel aan te dui.
    Voorbeeld: D= kuiltjies d= geen kuiltjies nie
  2. Skryf die genotipe en fenotipe van die ouers neer. Voorbeeld: DD → kuiltjies
  3. Gebruik 'n Punnet Square om die potensiële gamete van die ouers te kruis.
  4. Bepaal die waarskynlikheid gebaseer op die Punnet Square.

Probleme

  1. Outosomale resessiewe oorerwing (eienskap slegs uitgedruk indien homosigoties resessief)
    'n Albino-man (nn) trou met 'n normaal gepigmenteerde vrou (N_) wat 'n albino-ma het. Wat is die kans dat hul kinders albino's sal wees?
  2. Outosomale dominante oorerwing (eienskap uitgedruk solank een dominante alleel teenwoordig is)
    'n Dogter wil weet wat die kanse is dat sy Huntington’ se siekte sal ontwikkel, 'n degeneratiewe versteuring van die senuweestelsel wat gedurende die ouderdom van 30's tot 40's voorkom. Haar ma het Huntington’s terwyl haar pa nie die siekte het nie. Probeer om die moontlikhede te bepaal uit die inligting wat jy byderhand het. Watter verdere inligting het jy nodig om die waarskynlikheid meer akkuraat te bepaal?
  3. X-gekoppelde of geslagsgekoppelde resessiewe oorerwing (mans is meer geneig om eienskap uit te druk as vrouens)
    Hemofilie is 'n bloedafwyking wat seksgekoppel is. 'n Vrouedraer het kinders by 'n normale man. Bepaal die kanse vir meisies en seuns met hemofilie. [Onthou dat wyfies die XX genotipe en mans hetn het die XY genotipe. Moenie 'n alleel op die Y-chromosoom plaas nie. Voorbeeld: XNXn vir vroulik XY vir manlik]
  4. Veelvuldige allele (meer as twee allele in die genepoel van die bevolking)
    In die populasie as 'n geheel is daar drie allele (A, B en O) wat bloedtipe bepaal, alhoewel enige een individu hoogstens net twee van die drie allele kan hê. 'n Vrou en haar seun is albei bloedgroep O. Die vrou beweer dat 'n man met bloedgroep A die pa van die seun is. Is dit moontlik? Verduidelik jou antwoord.
  5. Geslagsbepaling (vroulike genotipe XX en manlike genotipe XY)
    1. Watter fraksie van menslike nageslag ontvang 'n X-chromosoom van die moeder?
    2. Watter breuk ontvang 'n Y-chromosoom van die vader?
    3. Meneer en mev Jackson het sewe seuns en een meisie. Wat is die waarskynlikheid dat hul volgende kind 'n meisie sal wees?

    Beantwoord hierdie vraag

    Engels

    1. Watter van die volgende sinne gebruik hoofletters KORREK? (1 punt) A.) Jy kan die volledige lys van Senatore aanlyn vind. B.) Het jy al ooit The History of Tom Jones, a Foundling gelees? C.)Die Maryland Blue Crabs het

    Biologie

    'n Man met normale kleurvisie trou met 'n vrou wat kleurblind is. Watter persentasie van hul seuns sal kleurblind wees, watter persentasie van hul dogters sal kleurblind wees, watter persentasie van hul dogters draers van

    Wetenskap help asb

    Meervoudige Keuse 1. Op chromosomale vlak, wat is die verskil tussen menslike mans en menslike vrouens? (1 punt) Alle mans het 'n Y-chromosoom, en wyfies nie. Alle mans het 'n X-chromosoom, en wyfies nie. Alle mannetjies

    Fisika

    Die minderheidsdraerleeftyd van 'n materiaal is die gemiddelde tyd wat 'n draer in 'n opgewekte toestand kan deurbring na elektron-gatgenerering voordat dit herkombineer. Bereken die minderheidsdraerleeftyd (in μs) vir 'n enkeling

    Wetenskap

    'n Kleurblinde vrou trou met 'n man wat nie kleurblind is nie. Al hul seuns is kleurblind, maar nie een van hul dogters is kleurblind nie. Kleurblindheid is waarskynlik A. die gevolg van te min chromosome. B. die gevolg van

    Wetenskap

    'n Man met 'n genetiese siekte trou met 'n vrou wat nie die siekte dra nie. Dit is nie moontlik vir hul seuns om die siekte te hê nie. Die siekte moet X-gekoppel wees dominaat Y-gekoppel dominaat X-gekoppel resessief Y-gekoppel resessief Ek is

    Biologie

    'n Blouoogman wie se ouers bruinoog was trou met 'n bruinoogvrou wie se pa bruinoog was wie se ma blouoog het hulle het een vroulike kind wat blouoog het, maak 'n stamboomkaart gebaseer op die inligting hierbo.

    Wetenskap

    ’n Blouoogman, wie albei se ouers bruinoog was, trou met ’n bruinoogvrou wie se pa blouoog en wie se ma bruinoog was. Hierdie man en vrou het 'n blouoogkind. Wat is die genotipes van al hierdie

    Biologie

    Bruin oë by mense is dominant vir blou oë. ’n Bruinoogman wie se ma blouoog was, trou met ’n bruinoogvrou wie se pa blou oë gehad het. Wat is die waarskynlikheid dat hierdie egpaar 'n blouoogkind sal hê?

    FISIKA

    Twee skaatsers, 'n man en 'n vrou, staan ​​op ys. Verwaarloos enige wrywing tussen die skaatslemme en die ys. Die massa van die man is 95 kg, en die massa van die vrou is 55 kg. Die vrou druk op die man met 'n krag van 57 N as gevolg van

    Genetika

    As 'n man met bloedgroep B, een wie se ouers bloedgroep O gehad het, met 'n vrou met bloedgroep AB trou, wat sal die teoretiese persentasie van hul kinders met bloedgroep B wees?

    Wetenskap

    Hemofilie is 'n oorerflike bloedingsversteuring waar die bloed nie behoorlik stol nie. Hierdie afwyking word veroorsaak deur 'n resessiewe alleel op die X-chromosoom, 'n egpaar het pas verneem dat hul dogter hemofilie het. Hulle het reeds 'n


    Kyk die video: Poremećaji ponašanja u demencijama (Oktober 2022).