Inligting

Hoe is die beperkingsplek van EcoRI opgevolg?

Hoe is die beperkingsplek van EcoRI opgevolg?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Die volgorde van beperkingsplek van EcoRI - GAATTC is in die vroeë 1970's geïdentifiseer, voordat Sanger Sequencing uitgevind is.(1977)

Hoe is die beperkingsplek van EcoRI gevolgorde?


Die eerste bepaling van 'n herkenningsplek vir 'n beperking endonulease is gerapporteer in:

Kelly & Smith (1970) 'n Restrictie-ensiem van Hemophilus influenzae II. Basisvolgorde van die herkenningsplek. J Mol. Biol. 51: 393-409

Die ensiem is toe endonuklease R genoem, maar staan ​​nou bekend as HindII (of HincII).

Die metode wat gebruik is, was om DNA met die ensiem te sny en dan die blootgestelde terminale fosfate met alkaliese fosfatase te verwyder. Hierdie punte kan dan gemerk word met 32P met behulp van polinukleotiedkinase en y-gemerkte ATP.

Die eindgemerkte DNA is dan op drie verskillende maniere met nukleases behandel om mononukleotiede, dinukleotiede en 'n mengsel wat vir trinukleotiede verryk is vry te stel. In elke geval is die gemerkte produkte geïdentifiseer deur hul gedrag in 2D dunlaagchromatografie, en is verder gekarakteriseer vir hul totale basis samestelling na vertering na mononukleotiede waar toepaslik.

Die afgeleide webwerf was/is

5'----GTY RAC----3' 3'----CAR YTG----5'

Daar is dus gevind dat die gemerkte mononukleotiede A en G is (purien=R), die dinukleotiede is GA en AA ensovoorts.

Die EcoRI-volgorde is deur in wese dieselfde metodologie bepaal en is gerapporteer deur

Hedgpeth et al (1972) DNA-nukleotiedvolgorde beperk deur die RI-endonuklease. Proc. Natl. Acad. Sci USA 69:3448 - 3452

Bylaag:

Alhoewel Sanger-volgordebepaling (die plus-minus-metode) moontlik deur die 1970's ontwikkel is, het dit regtig eers in die vroeë 80's vasgevang. So byvoorbeeld was die eerste volledige plasmiedvolgorde wat bepaal moes word pBR322 in 1979:

Sutcliffe (1979) Volledige nukleotiedvolgorde van die Escherichia coli plasmied pBR322. CSH Simp. Quant. Biol. 43: 77 - 90

"Ek het die 4362-nukleotiedpaarvolgorde van die plasmiedkloningsvektor pBR322 bepaal deur gebruik te maak van die DNS-volgordebepalingstegniek van Maxam en Gilbert (1977). Die DNS-struktuur het verskeie interessante kenmerke wat tot toetsbare voorspellings lei."

Die standaardvolgordebepalingsmetode wat op daardie stadium gebruik is, was chemiese volgordebepaling deur die Maxam-Gilbert-metodologie te gebruik. Toe ek in 1979 met 'n postdoktoraat in die VSA begin het, was M-G-volgordebepaling die standaardmetode. Sanger-volgordebepaling het regtig eers begin ná die ontwikkeling van die M13 mp-vektore (en later die pUC-plasmiede) deur J Messing in die vroeë 80's. En wat 'n verligting was dit nie: M-G-volgordebepaling was uiters moeisaam, soos enigiemand wat dit ooit gedoen het, sal getuig.


EkoRI

EkoRI (uitgespreek "eco R one") is 'n beperking endonuklease-ensiem wat van spesies geïsoleer is E coli. Dit is 'n beperkingsensiem wat DNS-dubbelhelikse in fragmente op spesifieke plekke klief, en is ook 'n deel van die beperkingsmodifikasiestelsel. Die Eko 'n deel van die ensiem se naam kom van die spesie waaruit dit geïsoleer is - "E" dui generiese naam aan wat "Escherichia" is en "co" dui spesienaam, "coli" aan - terwyl die R die spesifieke stam verteenwoordig, in hierdie geval RY13 , en die I dui aan dat dit die eerste ensiem was wat uit hierdie stam geïsoleer is.

In molekulêre biologie word dit as 'n beperkingsensiem gebruik. EkoRI skep 4 taai nukleotied-punte met 5'-einde oorhange van AATT. Die nukleïensuurherkenningsvolgorde waar die ensiem sny is G↓AATTC, wat 'n palindromiese, komplementêre volgorde van CTTAA↓G het. Ander beperkingsensieme, afhangende van hul snyplekke, kan ook 3' oorhange of stomp punte laat sonder oorhange.


Beperkingsensieme

DNA kan deur gesny word beperking endonukleases ( RE ). Endonukleases is ensieme wat die nukleïensuurpolimeer kan hidroliseer deur die te breek fosfodiester binding tussen die fosfaat en die pentose op die nukleïensuurruggraat. Dit is 'n baie sterk kovalente binding terwyl die swakker waterstofbindings hul interaksies en dubbelstrengsheid behou.

Soos die naam aandui, is beperkingsendonukleases (of beperkingsensieme) "beperk” in hul vermoë om DNS te sny of te verteer. Die beperking wat vir bioloë nuttig is, is gewoonlik palindromies DNA-volgordes. Palindromiese rye is dieselfde volgorde vorentoe en agtertoe. Enkele voorbeelde van palindrome: RACEMOTOR, CIVIC, 'N MAN 'N PLAN 'N KANAAL PANAMA. Met betrekking tot DNA, is daar 2 stringe wat teenoor mekaar parallel loop. Daarom is die omgekeerde komplement van die een string identies aan die ander. Molekulêre bioloë is ook geneig om hierdie spesiale molekulêre skêr te gebruik wat palindrome van 6 of 8 herken. Deur 6-snyers of 8-snyers te gebruik, kom die rye selde oor groot strekte voor, maar dikwels genoeg om van nut te wees.

EcoRI genereer taai van samehangende punte SmaI genereer stomp punte

Beperkingsensieme hidroliseer kovalente fosfodiester-bindings van die DNA om óf "taai/samehangende" punte óf "stomp" punte te laat. Hierdie onderskeid in sny is belangrik omdat 'n EcoRI 'n taai punt kan gebruik word om 'n stuk DNA wat met dieselfde ensiem gesny is, aan te pas om dit aan mekaar te plak of te lig. Terwyl endonukleas DNA sny, ligases sluit hulle weer saam. DNA verteer met EcoRI kan weer saamgebind word met 'n ander stuk DNA wat verteer word EcoRI, maar nie na 'n stuk wat verteer is nie SmaI. Nog 'n stomp snyer is EcoRV met 'n herkenningsvolgorde van GAT | ATC.


Toepassing van HindIII- en EcoRI-beperkingsendonukleases in die identifisering en diagnose van sistiese fibrose wat veroorsaak word deur die CFTR ∆F508-mutasie

Sistiese fibrose (CF) word veroorsaak deur 'n mutasie op die CFTR-proteïen wat die vervoer van soute oor epiteel-seloppervlaktes verhoed wat lei tot slymhiperproduksie en uiteindelik dood. Die doel van hierdie eksperiment was om te bepaal of 'n 3-jarige pasiënt sistiese fibrose het. Die hipotese het gesê dat Jeff sistiese fibrose sou hê wat veroorsaak word deur die CFTR ∆F508 mutasie. Daar is voorspel dat Jeff se DNS en die positiewe/negatiewe kontroles twee keer deur EcoRI gesny sou word, wat drie bande met die groottes 2 150 bp, 2 150 bp en 4 700 bp sou produseer en dat Jeff se DNS en die positiewe kontrole deur HindIII gesny sou word sodra twee produseer bande met die groottes 7 200 bp en 1 800 bp. Die eksperiment het EcoRI en HindIII beperking endonukleases in RFLP analise gebruik en die resultate gevisualiseer met elektroforese op 'n agarose gel, die molekulêre grootte van hierdie DNA fragmente is bereken uit 'n vergelyking wat uit 'n standaard kromme grafiek vervaardig is. Die DNS van 'n pasiënt met die CFTR ∆F508 mutasie is ingesluit as die positiewe kontrole en die DNS van 'n pasiënt sonder die CFTR ∆F508 mutasie is ingesluit as die negatiewe kontrole. Die resultate van die eksperiment het getoon dat al die DNS-monsters wat deur EcoRI gesny is, die DNS-fragmente van soortgelyke grootte vervaardig het, en Jeff se DNS en die positiewe kontrole is byna identies deur HindIII gesny, terwyl die negatiewe kontrole anders gesny is. Hierdie resultate het gelei tot die aanvaarding van die hipotese, wat beteken dat Jeff gediagnoseer is met sistiese fibrose wat veroorsaak is deur die CFTR ∆F508 mutasie.

Inleiding

In gesonde individue reageer die liggaam op respiratoriese infeksies deur slymvlakke in die longe en lugweë te verhoog. Hierdie slym kan egter ook bakterieë en vreemde materiaal vasvang, sodat die sistiese fibrose transmembraangeleidingsreguleerder (CFTR) proteïen soute, insluitend chloorione, bikarbonaatione en anione oor epiteellongselle vervoer om die longe te hidreer en oortollige slym weg te ruim (Gentzsch, 2018) Southern et al. 2018).

Daar is egter meer as 2000 mutasies van die CFTR-geen wat kan lei tot die dodelike siekte Cystic Fibrosis (Southern et al. 2018). Hierdie CFTR-mutasies word in vyf verskillende klasse gegroepeer, gebaseer op hoe dit die CFTR-proteïen beïnvloed: Klas I-mutasies produseer 'n disfunksionele CFTR-proteïen deur 'n vroeë stopkodon by die genetiese volgorde te voeg, Klas II-mutasies produseer 'n abnormale CFTR-proteïen waarvan die meeste afgebreek word deur die sel voordat dit die longvoering bereik, Klas III-mutasies produseer CFTR-proteïene wat nie ione oor epiteellongselle kan vervoer nie, Klas IV-mutasies produseer verswakte CFTR-proteïene wat 'n moeilike tyd het om ione oor epiteellongselle te vervoer, Klas V-mutasies produseer 'n funksionele CFTR-proteïen maar in laer getalle as gewoonlik, so dit verminder die doeltreffendheid daarvan (Southern et al. 2018).

Die mees algemene van die CFTR-mutasies, verantwoordelik vir 90% van sistiese fibrose-gevalle (Cooney, 2018) is 'n Klas II-defek genaamd die ∆F508-mutasie, hierdie spesifieke mutasie vind plaas wanneer fenielalanien by posisie 508 van die CFTR-geen geskrap word (Suaud et al. al. 2011). Dit is 'n baie algemene en dodelike outosomaal resessiewe siekte wat 1 uit 2000 Noord-Amerikaners of 70 000 individue wêreldwyd affekteer (Cutting, 2015 Southern et al. 2018). Hierdie siekte is dodelik as gevolg van 'n disfunksionele CFTR-proteïen wat beteken dat slym in die longe en pankreaskanale ophoop wat bakterieë vasvang, die immuunstelsel verswak, organe beskadig, ontsteking veroorsaak en dikwels lei tot diabetes en/of wanvoeding, gewoonlik pasiënte. sterf aan respiratoriese versaking (Cutting, 2015 Southern et al. 2018). Gelukkig is daar verskeie behandelings om die uitwerking van hierdie siekte te versag en die lewe van geaffekteerde individue te verleng, en aangesien sistiese fibrose slegs deur mutasies op die CFTR-geen veroorsaak word, is dit relatief maklik om pasiënte te toets en te diagnoseer (Cutting, 2015).

Hierdie enkelgeen outosomale resessiewe versteurings (Cutting, 2015) skep 'n tipe genetiese variasie van die CFTR-geen binne 'n populasie wat polimorfisme genoem word (Pare, 2012). Een van die mees algemene maniere om enkelmutasie polimorfismes te diagnoseer is met 'n tegniek genaamd beperking fragment lengte polimorfisme (RFLP) analise, wat beperking endonukleases gebruik om DNS-volgordes in fragmente op spesifieke terreine te sny om navorsers te help om genetiese variasies te identifiseer (Loenen et al. . 2014 Sapienza, 2012). Beperkingsendonukleases is ensieme wat natuurlik in verskeie spesies prokariote geproduseer word, maar het baie toepassings in laboratoriumgenetiese eksperimente (Pingoud et al. 2014). Beperkingsendonukleases of REases word in vier kategorieë gegroepeer (Tipe I, Tipe II, Tipe III en Tipe IV) die mees algemeen gebruik word in genetiese toetsing is Tipe II REases wat funksioneer deur die fosfaatbande op of naby die herkenningsvolgorde in die DNA te splits , produseer hierdie proses konsekwente DNS-fragmente (Pingoud et al. 2014 Sapienza, 2012).

Twee van die tipe II REases wat die meeste verstaan ​​word, sluit EcoRI en HindIII in: EcoRI wat van Escherichia coli ontdek is en HindIII is ontdek vanaf Haemophilus influenzae rd (Pingoud et al. 2014). Spesifiek, EcoRI en HindIII lokaliseer hul spesifieke verspringende nukleotiedherkenningsekwense en klief die fosfaatbindings tussen die nukleotiede: EcoRI herken GAATTC en klief die fosfaatbinding tussen die G en A, addisioneel sal dit enige rye herken en sny wat met een basis verskil- paar herken HindIII AAGCTT en klief die fosfaatbinding tussen die twee A's (Loenen et al. 2014 Sapienza, 2012). Daarbenewens, aangesien hierdie twee REases simmetriese verspringende snitte produseer, kan die DNA-fragmente aan hul komplementêre string gloei, dit is uitgebuit vir genetiese kloningstoepassings (Loenen et al. 2014). Wanneer EcoRI by die bloed- of speeksel-DNS-monster van 'n pasiënt gevoeg word, hetsy met of sonder die CF∆F508-mutasie, klief die EcoRI die CFTR-geen twee keer om drie fragmente te produseer wat 2,150 bp, 2,150 bp en 4,700 bp is. HindIII lewer egter verskillende resultate wanneer dit by die bloed- of salvia-DNS-monster van pasiënte met en sonder die CF∆F508-mutasie gevoeg word. By pasiënte sonder die CF∆F508-mutasie, klief HindIII die CFTR-geen twee keer om drie fragmente te produseer wat 1 500 bp, 5 700 bp en 1 800 bp is. Aan die ander kant, in pasiënte met die CF∆F508-mutasie, identifiseer HindIII nie die herkenningsvolgorde by 1 500 bp nie, omdat die fenielalanien-uitwissing by posisie 508 die res van die volgorde deurmekaarkrap, so in plaas daarvan klief HindIII die CFTR-geen net om te produseer twee fragmente wat 7 200 bp en 1 800 bp is. Die rede waarom die HindIII verskillende resultate lewer in pasiënte met en sonder die mutasie, terwyl EcoRI identiese resultate lewer, is dat HindIII meer spesifiek is en net presiese herkenningsvolgorde kan identifiseer, terwyl EcoRI effens minder spesifiek is en effens gevarieerde volgordes kan identifiseer. Die resultate van RFLP-analise kan met elektroforese op 'n agarose-gel ontleed word, 'n fluoresserende kleurstof word by die DNA-monsters gevoeg sodat dit onder 'n UV-transilluminator fluoresseer om die afstand wat die fragmente afgelê het, te openbaar. Die afstand wat die monsters aflê is eweredig aan hul lengte, daarom kan die afstande wat merker-DNS-fragmente aflê, gebruik word om 'n vergelyking te skep vanaf 'n standaardkromme wat die afstande wat die ander DNA-monsters afgelê het, sal gebruik om hul molekulêre grootte te bepaal.

Hierdie eksperiment gaan 'n aangenome 3-jarige genaamd Jeff toets vir sistiese fibrose wat veroorsaak word deur die CFTR ∆F508 mutasie. Om vas te stel of Jeff sistiese fibrose het, sal sy DNA RFLP-analise ondergaan met die beperking-endonukleases EcoRI en HindIII. ’n Positiewe kontrole (pasiënt met die ∆F508-mutasie) en negatiewe kontrole (pasiënt sonder die ∆F508-mutasie) sal ook RFLP-analise met EcoRI en HindIII ondergaan sodat Jeff se resultate met iets vergelyk kan word. Die resultate van die RFLP-analise sal gevisualiseer word deur elektroforese op 'n agarose-gel en dan sal die vergelyking wat uit 'n standaardkromme vervaardig word, gebruik word om die molekulêre groottes van die DNA-fragmente te bereken nadat hulle deur die REases gesny is. Om vas te stel of Jeff sistiese fibrose het en watter tipe mutasie sy sistiese fibrose veroorsaak word, is belangrik sodat hy die beste behandeling kan ontvang sodat hy 'n pynvrye en verlengde lewe kan lei.

Daar word vermoed dat Jeff sistiese fibrose het omdat hy verskeie van die simptome toon wat met sistiese fibrose geassosieer word, insluitend hyg, geknetter, aanhoudende hoes, vetterige stoelgang en 'n loopneus. Verder, omdat sistiese fibrose veroorsaak deur 'n CFTR ∆F508 mutasie 'n outosomaal resessiewe versteuring is, is dit moontlik dat beide sy ouers draers van die mutasie was en dat hy twee gemuteerde allele geërf het, dit verklaar waarom sy ouers nie 'n mediese geskiedenis van sistiese sou hê nie. fibrose.

As hierdie hipotese korrek is en Jeff het wel sistiese fibrose wat veroorsaak word deur die CFTR ∆F508 mutasie, dan word voorspel dat wanneer sy DNA twee keer deur EcoRI gesny sal word om drie bande te produseer wat molekulêre gewigte van 2,150 bp, 2,150 bp, en 4 700 bp en dat sy DNA een keer deur HindIII gesny sal word om twee bande te produseer wat molekulêre gewigte van 7 200 bp en 1 800 bp het. Die kontroles (pasiënte met en sonder die ∆F508-mutasie) sal ook twee keer deur EcoRI gesny word om drie bande te produseer wat molekulêre gewigte van 2,150 bp, 2,150 bp en 4,700 bp het. Daarom sal Jeff se DNA en die pasiënte met en sonder die ∆F508-mutasie bande hê met identiese molekulêre gewigte wanneer dit deur EcoRI gesny word. Daarbenewens sal die positiewe kontrole (pasiënt met die ∆F508 mutasie) ook een keer deur HindIII gesny word om twee bande te produseer wat molekulêre gewigte van 7 200 bp en 1 800 bp het. Terwyl die negatiewe kontrole (pasiënt sonder die ∆F508 mutasie) twee keer gesny sal word om drie bande te produseer wat molekulêre gewigte van 5 700 bp, 1 800 bp en 1 500 bp het. Dit beteken dat die bande wat verskyn wanneer Jeff se DNA-monster met HindIII gesny word, identies in gewig moet wees aan die pasiënt met die ∆F508-mutasie wie se DNA ook met HindIII gesny is, en beide hierdie monsters moet anders wees as wanneer HindIII gebruik word met die pasiënt wat nie die ∆F508 mutasie het nie.

Materiaal

Om te begin, is ses DNS-monsters verkry: twee monsters van die pasiënt wat vir sistiese fibrose (Jeff) getoets word, twee monsters van 'n individu met die ∆F508-mutasie, en twee monsters van 'n individu sonder die ∆F508-mutasie. Die monsters van die individu met die ∆F508 mutasie is voorheen met EcoRI en HindIII onderskeidelik gesny, niks anders is by hierdie monsters gevoeg totdat die laai kleurstof bygevoeg is nie. Reaksiebuffer is met die ander monsters gekombineer, en dan is EcoRI by een DNA-monster van die individu sonder die ∆F508-mutasie en by een van Jeff se DNA-monsters gevoeg. Vervolgens is HindIII by een DNA-monster van die individu gevoeg sonder die ∆F508-mutasie en by een van Jeff se DNA-monsters. Hierdie vier monsters is vir dertig minute by 37 grade Celsius geïnkubeer. 'n Oplossing van 0,8% agarose-gel is voorberei met agarose, 1x TAE-buffer en 10 000x Sybr Safe DNA-gelkleursel. Hierdie oplossing is in 'n jelbak gegooi wat in 'n gietrak toegesluit is, 'n kam is bygevoeg en dan is die jel vir dertig minute in 'n yskas geplaas om te stol. Die kam is verwyder en dan is die jelskinkbord met soliede gel in die elektroforesekamer laat sak en in 1x TAE-buffer ondergedompel. 'n Laaikleurstof wat Ficol bevat, is by elk van die ses DNS-monsters gevoeg. 'n Merker is in die eerste put/baan gelaai om bande van die volgende molekulêre groottes te vertoon: 12 000 bp, 7 000 bp, 3 000 bp, 2 500 bp, 2 000 bp, 1 800 bp en 1 500 bp. Toe is die ses DNA-monsters wat met óf EcoRI óf HindIII gesny is, in aparte putte gelaai. Die deksel is op die elektroforese kamer geplaas sodat die lading van die negatiewe na die positiewe kant sou loop, die apparaat is toegelaat om vir 45 minute teen 120V te loop totdat die due halfpad deur die jel was. Die jel is uit die apparaat verwyder en op die UV-transilluminator langs 'n liniaal bekyk sodat die afstand wat elke kleurstof afgelê het gemeet kon word. 'n Standaard kurwe grafiek is geskep met die data van die metings van die merker. Die vergelyking wat hierdie grafiek gegenereer het, is gebruik om die molekulêre grootte van die bande van die ses DNS-monsters te benader. (DeCicco-Skinner, 2019).

Resultate

Figuur 1: Vertoon die gel bo-op die UV-transilluminator langs 'n metrieke liniaal. Laan 1 het die merker bevat en het 7 sigbare bande geproduseer, baan 2 bevat -E (DNA van die pasiënt sonder die ∆F508 mutasie, gesny met EcoRI), baan 3 bevat +E (DNA van die pasiënt met die ∆F508 mutasie, gesny met EcoRI), baan 4 bevat JE (Jeff se DNA gesny met EcoRI), baan 5 bevat -H (DNA van die pasiënt sonder die ∆F508 mutasie, gesny met HindIII), baan 6 bevat +H (DNA van die pasiënt met die ∆F508) mutasie, gesny met HindIII), baan 7 bevat JH (Jeff se DNA gesny met HindIII). Lane 2, 3 en 4 het elk twee bande geproduseer wat byna identies was oor die drie putte. Laan 5 het vier bands opgelewer. Laan 6 en 7 het twee bands opgelewer wat byna identies was.

Die afstand wat die bande op die jel afgelê het, is gemeet vanaf die afstand tussen die put en die onderkant van die band. Die merker vanaf baan 1 het bande van verskeie molekulêre gewigte bevat: die 12 000 bp-band het 21,5 mm gereis, die 7 000 bp-band het 26,5 mm beweeg, die 3 000 bp-band het 29,2 mm gereis, die 2 500 bp-band het 32,4 mm gereis, die b. mm, die 1 800 bp-band het 40,5 mm gereis, en die 1 500 bp-band het 44,1 mm gereis (Figuur 1). Laan 2 is gelaai met die DNA van die pasiënt sonder die ∆F508 mutasie wat met EcoRI gesny is, baan 2 het twee bande vertoon: een het 28.1 mm gereis en die ander 35.2 mm (Figuur 1).Laan 3 is gelaai met die DNA van die pasiënt met die ∆F508 mutasie wat met EcoRI gesny is, baan 3 het ook twee bande gehad: een het 27.8 mm gereis en die ander 36.1 mm (Figuur 1). Laan 4 was gelaai met Jeff se DNA en is met EcoRI gesny, baan 4 het ook twee bande op byna dieselfde plek as die vorige twee putte gehad: een band het 28.0 mm gereis en die ander 35.9 mm (Figuur 1). Laan 5 is gelaai met die DNA van die pasiënt sonder die ∆F508 mutasie wat met HindIII gesny is, baan 5 het vier bande gehad wat 27.8 mm, 35.8 mm, 42.3 mm en 44.1 mm beweeg (Figuur 1). Laan 6 is gelaai met die DNA van die pasiënt met die ∆F508 mutasie wat met HindIII gesny is, baan 6 het twee bande gehad wat 26.1 mm en 43.5 mm beweeg (Figuur 1). Laan 7 was gelaai met Jeff se DNA en is met HindIII gesny, baan 7 het twee bande gehad wat baie soortgelyk was aan baan 6, wat 26.0 mm en 43.5 mm beweeg (Figuur 1).

Figuur 2: Vertoon die standaardkurwe vir CFTR ∆F508 mutasiebeperkingsvertering. Die log van die molekulêre gewig van elke merkerband is op die y-as geplot, en die afstand in millimeter wat elke band gemigreer het vanaf die put waarin die merker gelaai is, is op die x-as geplot. Uit hierdie data is 'n lineêre tendenslyn bygevoeg, die vergelyking van die lyn van beste passing is bereken en vertoon (y=-0,0391x + 4,8133), en die bepalingskoëffisiënt is bereken en vertoon (R^2=0,8987).

Die metings wat uit Figuur 1 versamel is, is gebruik om die standaardkrommegrafiek in Figuur 2 te skep. Die byvoeging van 'n lineêre neiginglyn het 'n vergelyking van die lyn van die beste passing (y=-0,0391x + 4,8133) opgelewer en 'n 0,8987 bepalingskoëffisiënt opgelewer . Die afstand wat elke band afgelê het vir die ses monsters is in hierdie vergelyking ingeprop en dan is die antilog geneem om die benaderde bandgrootte te bereken.

Tabel 1: CFTR ∆F508 mutasie beperking vertering deur EcoRI en HindIII resultate vir Jeff, pasiënt met die CFTR ∆F508 mutasie, en pasiënt sonder die CFTR ∆F508 mutasie.
Tabel 1: Vertoon die verwagte vs waargenome molekulêre gewig vir die merker en ses DNA-monsters wat met EcoRI of HindIII gesny is. Die molekulêre gewig vir elke monster is bereken uit die standaard kurwe vergelyking (y=-0,0391x + 4,8133). Lane 2, 3 en 4 het bande van baie soortgelyke groottes gehad en die waardes was naby aan wat verwag is. Laan 5 het meer bands gehad as wat verwag is. Laan 6 en 7 het bande gehad wat baie soortgelyk was en naby aan wat verwag is.

Uit die vergelyking in Figuur 2 is die waargenome bandgroottes vir die ses DNS-monsters bereken en in Tabel 1 aangeteken. Die waargenome bandgroottes is ook vir die merker bereken sodat die hoeveelheid fout gekwantifiseer kan word. Tabel 1 toon dat die berekende molekulêre gewig verskil van die verwagte molekulêre gewig, hierdie verskil is veral opvallend wanneer die band meer basispare het. Dit beteken dat die waargenome bandgrootte vir die DNA-monsters nie presies moet ooreenstem met die verwagte bandgrootte nie en dat die waarde die akkuraatste sal wees vir bande met minder basispare. Vir die drie DNA-monsters wat met EcoRI gesny is (die pasiënte met (+E) en sonder (-E) die CFTR ΔF508-mutasie, en Jeff (JE)) is verwag dat die EcoRI die DNA-string twee keer sou sny om drie bande te produseer: twee bande wat 2 150 bp was en een band wat 4 700 bp was. Waarneming van hierdie monsters het egter slegs twee bande aan die lig gebring. Pasiënt -E het berekende bande van 2,500 bp gehad en 5,183 bp pasiënt +E het berekende bande van 2,522 bp en 5,325 bp pasiënt JE het berekende bande van 2,568 bp en 5,229 bp. Hierdie waardes is baie naby en is in wese identies. Die pasiënt sonder die CFTR ΔF508-mutasie (-H) wie se DNA met HindIII gesny is, sou na verwagting twee keer gesny word om drie bande te produseer: 1 500 bp, 5 700 bp en 1 800 bp. Vier bande is egter waargeneem wat aandui dat die DNS op vier plekke gesny is. Dit het bande opgelewer wat bereken is op 1 227 bp, 1 443 bp, 2 591 bp en 5 325 bp. Die pasiënt met die CFTR ΔF508 mutasie (+H) en Jeff (JH) wie se DNA met HindIII gesny is, sou na verwagting een keer gesny word om twee bande te produseer wat 7 200 bp en 1 800 bp was. In werklikheid is hierdie twee monsters een keer gesny, in die +H-pasiënt was die bandgroottes 6,206 bp en 1,296 bp, terwyl in die JH-pasiënt die bandgroottes 6,262 bp en 1,296 bp was. Hierdie waardes is so eenders dat die bandgroottes as identies beskou kan word.

Bespreking

Met meer as 2000 polimorfismes van sistiese fibrose-mutasies, is daar beslis baie wat verkeerd kan gaan vir die CFTR-geen. In die voorbeeld van die CFTR ∆F508 mutasie word 'n enkele aminosuur (fenielalanien) by posisie 508 van die geen geskrap (Suaud et al. 2011). Die verwydering van fenielalanien by hierdie posisie is so ernstig dat die CFTR-proteïen disfunksioneel raak, wat lei tot hiperproduksie van slym oor epiteeloppervlaktes (Kreda et al. 2012). Die CFTR-proteïen is deur verskeie eksperimente geïdentifiseer as 'n sikliese adenosienmonofosfaatafhanklike fosforilering (cAMP) geaktiveerde anioonkanaal wat soute (chloriedione en bikarbonaatione) en ander anione oor epiteelselle vervoer (Gentzsch, 2018). Gesonde, ten volle funksionele CFTR-proteïene vervoer hierdie soute oor die plasmamembraan van epiteelselle wat die longe en ander organe beklee om oortollige slym weg te vee deur die oppervlak te hidreer (Gentzch, 2018 Suaud et al. 2011). In die geval van die CFTR ∆F508 mutasie, word 'n abnormale CFTR proteïen wat nie behoorlik kan vou geproduseer nie. binne 'n ander gedeelte van CFTR wat ander proteïen in die plasmamembraan (MSD 2) anker, vorm waterstofbindings met die arginien-aminosuur by die 1070-kodon (Cutting, 2015). Die sel bespeur die verkeerd gevoude CFTR-proteïene en breek die meeste van hulle binne die endoplasmiese retikulum af (Suaud et al. 2011). Dit beteken dat baie min of geen van die CFTR-proteïen die oppervlak van die epiteelselle bereik nie, daarom kan chloried- en bikarbonaatione nie oor die plasmamembraan vervoer word nie (Suaud et al. 2011). Aangesien hierdie souione nie oor die plasmamembraan vervoer kan word nie, is die soute in 'n hoër konsentrasie aan die basale kant van die epiteelselle, dit trek water weg van die apikale oppervlak en lei tot dehidrasie van die long-, gastroïntestinale en pankreasoppervlaktes (Gentzsch) , 2018). Wanneer daar geen water op die apikale oppervlaktes van hierdie organe is nie, kan oortollige slym nie weggevee word nie en dan skep digte taai slym obstruksies en lei tot respiratoriese siektes en inflammasie wat uiteindelik dood by pasiënte veroorsaak (Gentzsch, 2018).

Hierdie eksperiment het die 3-jarige Jeff getoets vir sistiese fibrose wat veroorsaak word deur die CFTR ∆F508 mutasie deur gebruik te maak van RFLP analise met EcoRI en HindIII beperking endonukleases. Sy resultate is vergelyk met 'n positiewe kontrole (pasiënt met die ∆F508 mutasie) en 'n negatiewe kontrole (pasiënt sonder die ∆F508 mutasie) wat ook ingesluit is in die RFLP analise met EcoRI en HindIII sodat Jeff se resultate met iets vergelyk kan word. Die resultate van die RFLP-analise is gevisualiseer met elektroforese op agarosegel (Figuur 1) en dan is 'n vergelyking uit 'n standaardkurwe (Figuur 2) geproduseer wat gebruik is om die molekulêre groottes (Tabel 1) van die DNS-fragmente wat die beperking te bereken. endonukleases geproduseer. Hierdie vroeë diagnose is van kritieke belang om te verseker dat Jeff die sorg ontvang wat hy nodig het sodat hy 'n pynlose en lang lewe kan lei. Verder is RFLP-analise 'n baie meer betroubare metode om te toets vir outosomaal resessiewe versteurings as direkte-na-verbruikers genetiese toetse soos 23andMeTM omdat daar minder ruimte vir misverstande is. Maatskappye soos 23andMeTM meet genetiese variasie deur die kliënt se genetiese inligting met hul databasis van mutasies te vergelyk, hierdie databasis kan 715 000 enkelnukleotiedmutasies opspoor (Lu et al. 2017). Dit beteken dat die databasis die drie-nukleotieddelesie sal opspoor wat plaasvind wanneer fenielalanien by posisie 508 van die CFTR-geen geskrap word. RFLP is anders as dit omdat dit nie genetiese volgordes vergelyk nie, eerder gebruik dit beperking-endonukleases om DNS in fragmente te sny by herkenningsvolgordes, in hierdie geval kan sistiese fibrose gediagnoseer word as die DNS van 'n pasiënt op dieselfde plekke gesny is as 'n pasiënt. positiewe beheer. Een voordeel van genetiese toetse soos dié wat deur 23andMeTM verskaf word, is dat hulle ook kan sien of 'n pasiënt 'n draer van 'n resessiewe mutasie is, dit is iets wat RFLP-analise nie kan doen nie (Lu et al. 2017). Een van die grootste bekommernisse met direkte-na-verbruiker genetiese toetsing is egter dat die meeste mense nie weet hoe om die resultate te interpreteer nie en drastiese gedrag kan optree as gevolg van nie ontvangs van genetiese berading nie (Pare, 2012), dit is nog 'n rede. waarom dit belangrik is om te toets vir sistiese fibrose met RFLP in plaas van om 23andMeTM te gebruik.

Daar is veronderstel dat Jeff sistiese fibrose het wat veroorsaak word deur die CFTR ∆F508 mutasie omdat hy verskeie van die simptome vertoon wat met die siekte geassosieer word. Dit sou moontlik wees as albei sy ouers draers van die CFTR ∆F508 mutasie was omdat draers nie simptome het nie aangesien die siekte slegs voorkom wanneer beide allele op hierdie ligging van die CFTR geen gemuteer is. Daar is voorspel dat wanneer Jeff se DNA twee keer deur EcoRI gesny sou word, drie bande met die groottes 2 150 bp, 2 150 bp en 4 700 bp sou produseer en dat sy DNA deur HindIII gesny sou word een keer wat twee bande met die groottes 7 200 bp en 1 800 bp produseer . Die EcoRI-monsters (pasiënte met en sonder die ∆F508-mutasie) sal ook twee keer deur EcoRI gesny word op 'n identiese wyse as Jeff se DNA wat drie bande produseer met die groottes 2,150 bp, 2,150 bp en 4,700 bp. Dit beteken dat Jeff se DNS en die DNS van die pasiënte met en sonder die ∆F508-mutasie bande moet hê wat identies is in grootte wanneer dit deur EcoRI gesny word. Daarbenewens sal die positiewe kontrole (pasiënt met die ∆F508-mutasie) ook een keer deur HindIII gesny word, soortgelyk aan Jeff se DNA wat twee bande met groottes 7 200 bp en 1 800 bp produseer. Dit is in teenstelling met die negatiewe kontrole (pasiënt sonder die ∆F508 mutasie) wie se DNS voorspel is om twee keer gesny te word, wat drie bande met groottes 5 700 bp, 1 800 bp en 1 500 bp produseer. As die hipotese korrek is, sal die bande wat verskyn wanneer Jeff se DNS-monster met HindIII gesny word, identies wees in gewig aan die pasiënt met die ∆F508-mutasie wie se DNS ook met HindIII gesny is, en beide hierdie monsters behoort anders te wees as wanneer HindIII is gebruik met die pasiënt wat nie die ∆F508 mutasie het nie.

Die doel om die positiewe kontrole in te sluit was sodat die HindIII beperking vertering resultate van 'n individu met ∆F508 mutasie gevisualiseer kan word en dan vergelyk kan word met hoe Jeff se DNA gesny is, as hulle op dieselfde manier gesny is dan beteken dit hy het ook dieselfde CFTR-polimorfisme. As sy DNA anders gesny word as die positiewe kontrole, sou dit beteken dat hy nie die ∆F508 mutasie het nie. Die doel van die insluiting van die negatiewe kontrole was sodat die HindIII beperking vertering resultate van 'n individu sonder ∆F508 mutasie gevisualiseer kan word en dan vergelyk kan word met hoe Jeff se DNA gesny is. As die negatiewe kontrole anders gesny is as beide die positiewe kontrole en Jeff se DNA, sou dit beteken dat hy nie die ∆F508 mutasie het nie. As Jeff se resultate egter nie met die positiewe of negatiewe ooreenstem nie, sou dit beteken dat die resultate van die eksperiment ongeldig is. Ook, as die positiewe en negatiewe kontroles identies is wanneer hulle deur HindIII gesny word, sal die eksperimentele resultate ongeldig wees. Verder, alhoewel die resultate van die RFLP-analise dieselfde sal wees vir Jeff en die kontroles wanneer met EcoRI gesny is, is die EcoRI steeds ingesluit, want as dit nie identiese resultate vir al die monsters opgelewer het nie, sou die resultate van die eksperiment bevraagteken te word.

Die merker wat in baan 1 gelaai is, het suksesvol oor die jel beweeg (Figuur 1) en het bande teen 12 000 bp, 7 000 bp, 3 000 bp, 2 500 bp, 2 000 bp, 1 800 bp en 1 500 bp geproduseer (soos verwag is). Die afstand wat elke band gemigreer het, is gemeet en hierdie data is teen die log van elke molekulêre gewig geplot om 'n standaardkromme te produseer wat 'n 0.8987 koëffisiënt van bepaling en lyn van die beste passing opgelewer het met die vergelyking y=-0.0391x +4.8133 (Figuur 2) ). Die afstand wat elke band afgelê het vir die ses monsters is in hierdie vergelyking ingeprop en dan is die antilog geneem om die benaderde bandgrootte te bereken. Hierdie vergelyking is ook gebruik om die grootte van die merkers te bereken om te bepaal hoeveel wiskundige foute in hierdie model aanwesig is. Tabel 1 toon dat die berekende molekulêre gewig effens verskil van die werklike molekulêre gewig, hierdie effek word versterk wanneer die DNA meer basispare het. Dit beteken dat die resultate van die ander DNS-monsters ook 'n mate van variasie in die verwagte vs waargenome molekulêre gewig van die bande kan hê en dat selfs met so 'n variasie die resultate steeds geldig sal wees. Hierdie vergelyking is ook gebruik om die molekulêre groottes van die bande wat op die jel in Figuur 1 getoon word te bereken. As die hipotese korrek is, sal Jeff se DNA, die pasiënt met die ∆F508-mutasie en die pasiënt sonder die ∆F508-mutasie almal gesny word twee keer deur EcoRI om bande met molekulêre gewigte van 2 150 bp, 2 150 bp en 4 700 bp te produseer. Aangesien twee van hierdie bande dieselfde molekulêre gewig het, sal slegs twee bande op die gel verskyn: 2 150 bp en 4 700 bp. Waarneming van hierdie DNS-monsters het getoon dat hulle almal twee bande het (Figuur 1 – bane 2,3,4) en berekeninge van die standaardkrommevergelyking het aan die lig gebring dat die molekulêre gewig van hierdie twee bande in die drie monsters baie ooreenstem: in JE was die groottes van die DNA-fragmente is bereken as 2,568 bp en 5,229 bp in -E die groottes van die bande is bereken as 2,500 bp en 5,183 bp in +E die groottes van die bande is bereken as 2,522 bp en 5,325 bp (tabel). Aangesien die EcoRI al die monsters op ongeveer dieselfde plek gesny het, kan die gevolgtrekking gemaak word dat die RFLP-analise korrek gewerk het en dat die ander resultate van die eksperiment ook korrek moes gewerk het. Dit beteken ook dat die CFTR-geen eintlik in al die DNS-monsters teenwoordig was, want as enige van die monsters die CFTR-geen ontbreek, sou die monsters nie identiese DNS-fragmente geproduseer het nie. Hierdie resultate alleen kan egter nie 'n diagnose vir sistiese fibrose verskaf nie, want die EcoRI-ensiem sny die positiewe en negatiewe beheer op dieselfde manier. As EcoRI en die positiewe kontrole die enigste dinge was wat gebruik is om Jeff te diagnoseer, dan sou die hipotese aanvaar gewees het omdat die CFTR-geen in dieselfde DNA-fragmente vir die positiewe kontrole en Jeff gesny word. Paradoksaal genoeg, as EcoRI en die negatiewe kontrole die enigste dinge was wat gebruik is om Jeff te diagnoseer, sou die hipotese verwerp gewees het omdat die CFTR-geen in dieselfde DNA-fragmente vir die negatiewe kontrole en Jeff gesny word. Uiteraard is dit problematies omdat die hipotese nie beide aanvaar en verwerp kan word nie, dus, om Jeff akkuraat te diagnoseer met sistiese fibrose, moet 'n beperking endonuklease gebruik word wat die positiewe en negatiewe beheer verskillend sny, dit is hoekom HindIII ook gebruik is.

As die hipotese korrek was, sou Jeff se DNA en die (positiewe kontrole) pasiënt met die ∆F508 mutasie een keer deur HindIII gesny word om bande met molekulêre gewigte van 7 200 bp en 1 800 bp te produseer. Waarneming van hierdie DNS-monsters het getoon dat hulle albei een keer gesny is en twee bande gehad het (Figuur 1 – bane 6 en 7) en berekeninge van die standaardkrommevergelyking het aan die lig gebring dat die molekulêre gewig van hierdie twee bande in beide monsters soortgelyk was: in JH is die groottes van die bande is bereken as 6,262 bp en 1,296 bp en in +H is die groottes van die bande as 6,206 bp en 1,296 bp bereken (Tabel 1). Aangesien die HindIII beide Jeff se DNA en die DNA van die pasiënt wat die ∆F508-mutasie het gesny het, is dit waarskynlik dat Jeff ook die ∆F508-mutasie het wat sistiese fibrose veroorsaak. Om te bevestig dat hierdie resultate geldig is, moet beide hierdie monsters vergelyk word met die negatiewe kontrole – die pasiënt sonder die CFTR ∆F508 mutasie. Waarneming het aan die lig gebring dat die DNA van die pasiënt (-H) sonder die ∆F508-mutasie drie keer deur HindIII gesny is om vier bande te produseer (Figuur 1) en hierdie bande is bereken om die molekulêre gewigte van 1,227 bp, 1,443 bp, 2,591 bp te hê , en 5,325 bp (Tabel 1). Uiteraard stem hierdie resultate nie ooreen met die voorspelling wat gesê het dat hierdie pasiënt se DNA twee keer deur HindIII gesny sou word om drie bande met die molekulêre gewigte van 5 700 bp, 1 800 bp en 1 500 bp te produseer nie. Dit blyk egter dat die boonste twee bande in lyn is met die bande van die monsters wat met EcoRI gesny is. Dit beteken dat hierdie monster waarskynlik met 'n paar EcoRI besmet is. Dit meng in met die ontleding van die resultate, maar sommige gevolgtrekkings kan steeds gemaak word as gevolg van die plasing van hierdie bande in verhouding tot die ander HindIII monsters. Eerstens is die resultate verskillend genoeg dat daar tot die gevolgtrekking gekom kan word dat JH en +H identies was terwyl -H verskillend was. Tweedens het die -H-monster 'n band wat onder die laagste band in +H en JH is (Figuur 1– bane 5, 6, 7). Dit sal sin maak as die hipotese korrek was omdat -H sy kleinste band 1 500 bp moet hê en +H/JH moet hul kleinste bande by 1 800 BP hê (Tabel 1). Derdens, die enigste manier waarop Jeff se DNA-monster deur HindIII teen 7 200 bp gesny kan word, sou wees as hy die CFTR ∆F508-mutasie gehad het (Figuur 1 en Tabel 1). Daarom word die hipotese aanvaar, Jeff het sistiese fibrose wat veroorsaak word deur die CFTR ∆F508 mutasie.

As die positiewe kontrole weggelaat is, sou die diagnose baie moeilik wees om te maak en die hipotese kon nie bevestig word nie, want die berekende molekulêre grootte van Jeff se DNA-fragmente is anders as die verwagte molekulêre groottes. Om waar te neem dat die berekende molekulêre grootte van die ook verskil van die verwagte grootte vir die positiewe kontrole se DNS-fragmente en dat die molekulêre grootte van hierdie fragmente en Jeff's byna identies was wanneer dit deur HindIII gesny is, was die uiteindelike faktor wat gelei het tot die aanvaarding van die hipotese. As die negatiewe kontrole weggelaat is, dan sou die hipotese steeds aanvaar gewees het omdat Jeff se DNA steeds met die positiewe kontrole ooreenstem. In die alternatiewe scenario waar hy nie sistiese fibrose gehad het nie, sou die ontbrekende van 'n negatiewe kontrole beteken dat dit onmoontlik sou wees om te bevestig dat Jeff nie sistiese fibrose gehad het nie, want sy DNS-fragmente sou niks ooreenstem wanneer dit deur HindIII gesny is nie.

Hierdie eksperiment het slegs die segment van Jeff se genoom gebruik wat die CFTR-geen ingesluit het. As ons sy hele genoom van 'n pasiënt met of sonder die mutasie gebruik het, dan sou EcoRI en HindIII baie meer herkenningsplekke (GAATTC en AAGCTT onderskeidelik) opgespoor het en fosfaatgroepe op hierdie terreine gekloof het, dit sou baie meer DNA-fragmente produseer. Trouens, soveel DNS-fragmente dat dit moeilik sal wees om te sê waarna jy kyk, In plaas daarvan om 'n paar bande op Figuur 1 te sien, kan daar honderde bande wees. Dit sal dit onmoontlik maak om te identifiseer of Jeff 'n mutasie in CFTR gehad het of nie. Die laboratoriumprotokol sal gewysig moet word as hele genome gebruik word sodat 'n spesifieke DNS-gebied ondersoek kan word.Een manier om dit te bereik is deur suidelike klad: waar die DNA-fragmente van elektroforese na 'n membraan oorgedra word deur opwaartse kapillêre oordrag en dan geïmmobiliseer word, sodat die bande wat ooreenstem met die CFTR-volgorde met 'n sonde geïdentifiseer kan word (Brown, 2001).

Ten slotte is hierdie bevindinge betekenisvol omdat dit onthul dat HindIII 'n baie bruikbare beperking endonuklease is vir die diagnose van sistiese fibrose en Jeff se diagnose van sistiese fibrose (veroorsaak deur die CFTR ∆F508 mutasie) beteken dat hy persoonlike behandeling kan ontvang, byvoorbeeld lumacaftor, is 'n geneesmiddel wat Jeff kan bevoordeel deur die afbreek van die verkeerd gevoude CFTR-proteïene wat deur die CFTR ∆F508-mutasie veroorsaak word, te voorkom, dit help die proteïene om die apikale epiteelseloppervlak te bereik sodat funksie gedeeltelik herstel kan word (Kreda et al. 2012). Hierdie eksperiment kan verbeter word deur die aantal monsters te verdubbel om te verseker dat die monsters nie deur die verkeerde beperking endonuklease gekontamineer is nie en deur 'n ander tendenslyn te gebruik wat 'n vergelyking produseer wat molekulêre groottes met verbeterde akkuraatheid bereken. Toekomstige studies kan die toepassing van ander beperking-endonukleases soos BamHI, EcoRII, Hand HaeIII ondersoek om te sien hoe hulle die CFTR in die positiewe en negatiewe kontroles sny.

Verwysings

Brown, T (2001) Southern Blotting. Curr Protoc Immunol 10(6a).

Cooney, A.L., P.B. McCray Jr, en P.L. Sinn (2018) Sistiese Fibrose-geneterapie: Terugkyk, vorentoe kyk. Gene (Basel) 9(11).

Cutting, G. R. (2015) Sistiese fibrose genetika: van molekulêre begrip tot kliniese toepassing. Nat Ds Genet 16(1): 45-56.


Belangrike vrae vir CBSE Klas 12 Biologie Beginsels van Biotegnologie en Gereedskap van Rekombinasie DNA Tegnologie

1. Biotegnologie kan gedefinieer word as die gebruik van mikroörganismes, plante of dierselle of hul komponente om produkte en prosesse te produseer wat nuttig is vir mense. Volgens die Europese Federasie van Biotegnologie (EFB) is biotegnologie die integrasie van natuurwetenskap en organismes, selle, dele daarvan en molekulêre analoë vir produkte en dienste. Die term 'Biotegnologie' is in 1919 deur Karl Ereky geskep.
2. Beginsels van biotegnologie is gebaseer op die konsep van die volgende tegnieke:
(i) Genetiese ingenieurswese is die tegniek om die chemie van genetiese materiaal (DNS/RNA) te verander, om dit in 'n ander organisme in te voer en sodoende die fenotipe van die gasheerorganisme te verander.
(ii) Voldoende instandhouding van steriele toestande om groei van slegs die verlangde mikrobes/eukariotiese selle in groot hoeveelhede te ondersteun vir die vervaardiging van biotegnologiese produkte soos antibiotika, entstowwe, ensieme, ens.

3. Die tegnieke van genetiese ingenieurswese sluit die volgende in:

  • Skepping van rekombinante DNA deur gewenste gene te kombineer.
  • Geen oordrag.
  • Instandhouding van DNA in gasheer- en geenkloning.
  • Die basiese stappe in genetiese ingenieurswese kan as volg opgesom word:
  • Identifikasie van DNA met gewenste gene.
  • Inleiding van die geïdentifiseerde DNA in die gasheer.
  • Instandhouding van ingevoerde DNA in die gasheer en oordrag van die DNA na sy nageslag.

4. Konstruksie van eerste kunsmatige rekombinante DNA
(i) Dit is bereik deur 'n geen wat antibiotiese weerstand kodeer met 'n inheemse te koppel plasmied ('n outonoom repliserende sirkelvormige ekstrachromosomale DNA) van Salmonella typhimurium.
(ii) Stanley Cohen en Herbert Boyer het dit in 1972 vermag.
(iii) Hulle het die antibiotika-weerstandsgeen geïsoleer deur 'n stukkie DNS uit 'n plasmied uit te sny.
(iv) Die sny van DNS op spesifieke plekke is uitgevoer deur molekulêre skêr, d.w.s. beperking ensieme.
(v) Die gesnyde stuk DNA is dan met die ensiem DNA aan die plasmied DNA gekoppel ligase. Die plasmied DNA dien as vektore om die stuk DNA wat daaraan geheg is oor te dra.
(vi) Wanneer hierdie DNS na coli oorgedra word, kan dit repliseer deur die nuwe gasheer se DNS-polimerase-ensiem te gebruik en veelvuldige kopieë te maak.
(vii) Hierdie vermoë om kopieë van antibiotika-weerstandsgeen te vermenigvuldig in E. coli genoem is kloning van antibiotika weerstandigheid geen in E. coli.

5. Gereedskap van rekombinante DNA-tegnologie is soos volg:
(i) Beperkingsensieme (ii) Polimerase ensieme
(iii) Ligases (iv) Vektore
(v) Bekwame gasheerorganisme.

6. Beperkingsensieme of 'molekulêre skêr' word gebruik om DNA te sny.
(i) Twee ensieme van E. coli wat verantwoordelik was vir die beperking van die groei van bakteriofaag is in 1963 geïsoleer, een van hulle het metielgroep by DNS gevoeg en die ander het DNS in segmente gesny. Die latere is beperking-endonuklease genoem.
(ii) Die eerste beperking endonuklease Hind II is geïsoleer deur Smith Wilcox en Kelley (1968). Hulle het gevind dat dit altyd DNA-molekules op 'n spesifieke punt sny deur 'n spesifieke volgorde van ses basispare bekend as herkenningsvolgorde te herken.
(iii) Behalwe Hind II, is meer as 900 beperkingsensieme nou geïsoleer, van meer as 230 bakterieë, wat elkeen verskillende herkenningsvolgorde herken.
(iv) Benoeming van beperkingsensieme
(a) Die eerste letter is afgelei van die genusnaam en die volgende twee letters van die spesienaam van die prokariotiese sel waaruit ensieme onttrek word.
(b) Die Romeinse nommers na naam toon die volgorde waarin die ensieme van die bakteriese stam geïsoleer is.
Eco RI kom byvoorbeeld van Escherichia coli RY13 en Eco RII kom van E. coli R 245, ens.
(v) Beperkingsensieme behoort aan 'n klas ensieme wat genoem word Nukleases.
Nuklease is van twee tipes:
Eksonukleases Hulle verwyder nukleotiede van die punte.
Endonukleases Hulle sny op spesifieke posisies binne die DNS.
(a) Elke beperking endonuklease herken 'n spesifieke palindromiese nukleotiedvolgordes in die DNA.
(b) Palindroom in DNA is a. volgorde van basispare wat dieselfde op die twee stringe lees wanneer die oriëntasie van lees dieselfde gehou word.
Byvoorbeeld, die volgende rye lees dieselfde op die twee stringe in 5′ –> 3′ rigting sowel as 3′–> 5′ rigting.
5′ - GAATTC - 3′
3′ - CTAAG - 5′
(vi) Werkingsmeganisme van beperkingsensieme
(a) Beperkingsensieme sny die DNA-string 'n bietjie weg van die middel van die palindroom-plekke, maar tussen dieselfde twee basisse op die teenoorgestelde stringe.
(b) Dit laat enkelstrengige gedeeltes aan die ente.
(c) Daar is oorhangende strekke wat klewerige punte genoem word op elke stringe soos in bostaande figuur gegee. Dit word so genoem omdat hulle waterstofbindings vorm met hul komplementêre gesnyde eweknieë.
(d) Die taaiheid van die punte vergemaklik die werking van die ensiem DNA-ligase.
(e) Beperking-endonukleases word in genetiese ingenieurswese gebruik om rekombinante DNA-molekules te vorm, wat saamgestel is uit DNA van verskillende bronne/genome.
(f) Hierdie taai punte is aanvullend tot mekaar wanneer dit deur dieselfde beperkingsensiem gesny word, en kan dus saamgevoeg word (end-tot-end) deur gebruik te maak van DNA-ligases.

7. Skeiding en isolasie van DNA-fragmente
(i) Die sny van DNA deur restriction’endonucleases lei tot die fragmente van DNA.
(ii) Die tegniek wat DNS-fragmente op grond van hul grootte skei, word genoem
gelelektroforese.
(iii) DNS-fragmente is negatief gelaaide molekules. Hulle kan geskei word deur hulle te dwing om na die anode te beweeg onder 'n elektriese veld deur 'n medium/matriks.
(iv) Die mees algemene medium wat gebruik word, is agarose, 'n natuurlike polimeer wat uit seeonkruide onttrek word.
(v) Die DNA-fragmente skei (oplos) volgens hul grootte deur sif-effek wat deur die agarosegel verskaf word. Hoe kleiner die fragmentgrootte, hoe verder beweeg dit.
(vi) Die geskeide DNS-fragmente kan slegs gevisualiseer word nadat die DNS gekleur is met 'n verbinding bekend as etidiumbromied gevolg deur blootstelling aan UV-straling.
(vii) Die DNS-fragmente kan gesien word as helder oranje gekleurde bande. Hierdie geskeide bande word uit die agarosegel gesny en uit die gelstuk onttrek. Dit word genoem elutie.
(viii) Die gesuiwerde DNA-fragmente kan gebruik word om rekombinante DNA te konstrueer deur hulle met kloningsvektore te verbind.

8. Kloning van vektore is die DNS-molekules wat 'n vreemde DNS-segment in die gasheersel kan dra.
(i) Die vektore wat in rekombinante DNA-tegnologie gebruik word, kan wees:
(a) Plasmiede Outonoom replisering van sirkelvormige ekstra-chromosomale DNA.
(b) Bakteriofage Virusse wat bakterieë besmet.
(c) Kosmiede Hibriede vektore afgelei van plasmiede wat cos-plek van X bevat
(ii) Kopieer nommer kan gedefinieer word as die aantal kopieë van vektore wat in 'n sel teenwoordig is.
(iii) Bakteriofage het 'n hoë getal per sel, so hul kopiegetal is ook hoog in genoom.
(iv) Plasmiede het slegs een of twee kopieë per sel.
(v) Kopienommer kan wissel van 1-100 of meer as 100 kopieë per sel.
(vi) Indien 'n uitheemse stuk DNS met bakteriofaag- of plasmied-DNS gekoppel is, kan sy getal gelyk aan die kopiegetal van die plasmied of bakteriofaag vermenigvuldig word.
(vii) Kenmerke wat benodig word om kloning in vektor te fasiliteer
(a) Oorsprong van replikasie (Ori) (b) Selekteerbare merker
(c) Kloningsplekke (d) Vektore vir die kloning van gene in plante en diere.
(a) Oorsprong van replikasie (Ori) is 'n volgorde van waar replikasie begin.

  • Enige stuk DNS wanneer dit aan hierdie volgorde gekoppel word, kan gemaak word om binne die gasheerselle te repliseer.
  • Die volgorde is ook verantwoordelik vir die beheer van die kopienommer van die gekoppelde DNS.

(b) Kiesbare merker help om nie-transformante te identifiseer en uit te skakel en die groei van die transformante selektief toe te laat.

  • Transformasie is 'n proses waardeur 'n stuk DNA in 'n gasheerbakterie ingebring word.
  • Die gene wat kodeer vir weerstand teen antibiotika soos ampicillien, chlooramfenikol, tetrasiklien of kanamisien, ens., is 'n paar nuttige kiesbare merkers vir coli.


E.coli kloningsvektor pBR322 wat beperkingsplekke toon (Hind III, Eco Rl
Bam HI, Sal I, Pvu II, Pst I, Cla I), ori en antibiotika weerstandigheid gene (amp R en tet R ).
rop-kodes vir die proteïene betrokke by die replikasie van die plasmied.

  • Ligering van uitheemse DNA word uitgevoer by 'n beperkingsplek wat in een van die twee antibiotika-weerstandsgene voorkom. Voorbeeld is die afbinding van 'n vreemde DNA by die Bam HI-plek van tetrasiklienweerstandsgeen in die vektor pBR322.
    –>>Die rekombinante plasmiede sal tetrasiklienweerstand verloor as gevolg van die invoeging van vreemde DNA. Dit kan egter steeds uitgekies word uit nie-rekombinante deur die transformante op ampicillienbevattende medium te plaas.
    –>> Die transformante wat op ampicillien-bevattende medium groei, word dan oorgedra op 'n medium wat tetrasiklien bevat.
    –>>Die rekombinante sal groei in ampicillienbevattende medium, maar nie op dié wat tetrasiklien bevat nie.
    –>>Die nie-rekombinante sal groei op die medium wat beide die antibiotika bevat.
    In hierdie voorbeeld help een antibiotika-weerstandsgeen met die selektering van die transformante, terwyl die ander antibiotika-weerstandsgeen 'geïnaktiveer word as gevolg van die invoeging' van uitheemse DNA en help met die seleksie van rekombinante.
  • Seleksie van rekombinante as gevolg van inaktivering van antibiotika is 'n omslagtige prosedure, dus word alternatiewe selekteerbare merkers ontwikkel wat rekombinante van nie-rekombinante onderskei op grond van hul vermoë om kleur te produseer in die teenwoordigheid van 'n chromogeniese substraat.

–>> In hierdie metode word 'n rekombinante DNA in die koderende volgorde van 'n ensiem J3-galaktosidase ingevoeg.
–>> Dit lei tot inaktivering van die ensiem, P-galaktosidase (insersie-inaktivering).
–>> Die bakteriese kolonies waarvan die plasmiede nie 'n insetsel het nie, produseer blou kleur, maar ander produseer geen kleur wanneer dit op 'n chromogeniese substraat gekweek word nie.
(c) Kloningsterreine word vereis om die uitheemse DNA met die vektor te koppel.

  • Die vektor benodig baie min of enkele herkenningsplekke vir die algemeen gebruikte beperkingsensieme.
  • Die teenwoordigheid van meer as een herkenningsplekke binne die vektor sal verskeie fragmente genereer wat lei tot komplikasies in geenkloning.

(d) Vektore vir die kloning van gene in plante en diere is baie wat gebruik word om gene in plante en diere te kloon.
In plante word die Tumor-induserende (Ti) plasmied van Agrobacterium tumefaciens as 'n kloningsvektor gebruik.
–>>Agrobacterium tumefaciens is 'n patogeen van verskeie tweesaadlobbige plante.
–>> Dit lewer 'n stuk DNA bekend as T-DNA in die Ti-plasmied wat normale plantselle in tumorselle omskep om chemikalieë te produseer wat deur patogene benodig word. Retrovirus, adenovirus, papillomavirus word ook nou as kloningsvektore in diere gebruik vanweë hul vermoë om te transformeer normale selle in kankerselle in.

9. Bekwame gasheerorganisme (vir transformasie met rekombinante DNA) word vereis omdat DNA, wat 'n hidrofiele molekule is, nie deur selmembrane kan gaan nie,
Daarom moet die bakterieë bevoeg gemaak word om die DNA-molekules te aanvaar,
(i) Bevoegdheid is die vermoë van 'n sel om vreemde DNA op te neem.
(ii) Metodes om 'n sel bekwaam te maak is soos volg.
(a) Chemiese metode In hierdie metode word die sel met 'n spesifieke konsentrasie van 'n tweewaardige katioon soos kalsium behandel om porieë in selwand te vergroot.
Die selle word dan met rekombinante DNA op ys geïnkubeer, gevolg deur plasing
hulle kort by 42°C en sit dit dan weer op ys. Dit word hitteskokbehandeling genoem. Dit stel die bakterieë in staat om die rekombinante DNA op te neem.
(b) Fisiese metodes In hierdie metode word 'n rekombinante DNA direk in die kern van 'n diersel ingespuit deur middel van mikro-inspuitingsmetode.
In plante word selle gebombardeer met hoë snelheid mikrodeeltjies van goud of
wolfram bedek met DNA genoem as biolistiek of geengeweermetode.
(c) Ontwapende patogeen-vektore wanneer dit toegelaat word om die sel te infekteer, dra die rekombinante DNA na die gasheer oor.

Vorige Jaar Eksamen Vrae

1 Merk Vrae
1. Hoekom is dit nie moontlik vir 'n uitheemse DNA om enige plek langs sy lengte deel van 'n chromosoom te word en normaalweg te repliseer nie?
[Hele Indië 2014]
Antw.Die integrasie van uitheemse DNA is nodig om deel van chromosoom te word. Aangesien die DNA self nie kan vermenigvuldig en repliseer nie, maar eerder 'n spesifieke volgorde vereis om die replikasie daarvan te begin, genoem oorsprong van replikasie. Daarom moet die uitheemse DNA met die gasheer-DNS verbind word met behulp van ensieme en aan Ori gekoppel word, om deel van chromosoom te wees en normaalweg te repliseer om sy kopieë te produseer.

2. Noem die tipe gasheerselle wat geskik is vir die geengewere om 'n uitheemse DNA bekend te stel. [Delhi 2014]
Antw. Die gasheerselle wat geskik is vir die geengewere om 'n uitheemse DNA bekend te stel, is plantselle.

3. Skryf die twee komponente van die eerste kunsmatige rekombinante DNA-molekule wat deur Cohen en Boyer gebou is. [Buitelandse 2014]
Antw.Die twee komponente van die eerste kunsmatige rekombinante DNA-molekule wat deur Gohen en Boyer gebou is, is:
(i) antibiotika weerstand geen
(ii) plasmied van Salmonella typhimurium

4. Noem die gasheerselle waarin mikro-inspuitingstegniek gebruik word om 'n uitheemse DNA in te voer. [Buitelandse 2014]
Antw. Die mikro-inspuitingstegniek om uitheemse DNA in te voer, word gewoonlik in diersel uitgevoer, dit wil sê direk in die kern.

5. Noem die materiaal wat as matriks in gelelektroforese gebruik word en noem die rol daarvan. [Hele Indië 2014C]
Antw. Die materiaal wat as matriks in gelelektroforese gebruik word, is agarose.
Hierdie agarose-gel dien as 'n sif om die DNA-fragmente volgens hul grootte te skei.

6. Skryf enige vier maniere wat gebruik word om 'n verlangde DNA-segment in 'n bakteriese sel in rekombinante tegnologie-eksperimente in te voer. [Hele Indië 2013]
Antw. Maniere om gewenste DNA in bakteriële sel in te voer is:
(i) mikro-inspuiting (ii) ontwapende patogeen-vektore
(iii) gedeelte deur tweewaardige katioon soos kalsium
(iv) bidlistiese of geengeweer

7. Noem wat gebeur wanneer 'n uitheemse geen by Sal I-plek van pBR322-plasmied geligeer word. [Delhi 2013c]
Antw. Indien 'n uitheemse geen by Sal I-plek van tetrasiklienweerstandsgeen in die vektor pBR322 geligeer word, sal die rekombinante plasmied sy tetrasiklienweerstand verloor.

8. Noem die gebruike van kloningsvektor in biotegnologie? [Delhi 2011]
Antw. Gebruike van kloningsvektor in biotegnologie.
(i) Help in die koppeling van die vreemde/uitheemse DNA met dié van gasheer’s DNA.
(ii) Help met die seleksie van erf-rekombinante uit die nie-rekombinante.

9. Biotegnoloë verwys na Agrobacterium tumefaciens as natuurlike genetiese ingenieur van plante. Gee redes om die stelling te ondersteun.
[ HOTS All India 2011]
Antw. Agrobacterium tumefacieps is 'n patogeen van verskeie tweesaadlobbige plante. Dit word as 'n natuurlike genetiese ingenieur gebruik omdat dit 'n stuk van sy DNA (genoem T-DNA) kan lewer om normale plantselle in tumorselle te transformeer en die tumorselle te lei om die chemikalieë wat deur die patogeen benodig word, te sintetiseer.

10. Waarom is dit noodsaaklik om 'n selekteerbare merker in 'n kloningsvektor te hê? [Hele Indië 2011]
Antw.Selekteerbare merker in kloningsvektor help om die rekombinante te identifiseer en te selekteer en die nie-rekombinante uit te skakel.

11. Waarom beweeg DNS-fragmente na die anode tydens gelelektroforese? [warm Delhi 2011c]
Antw. DNA-fragmente is negatief gelaaide molekules en beweeg dus na die anode tydens gelelektroforese.

12. In die jaar 1963 is twee ensieme wat verantwoordelik was vir die beperking van die groei van bakteriofaag in E. coli geïsoleer. Hoe het ensieme opgetree om die groei van die bakteriofaag te beperk? [Hele Indië 2011c]
Antw.Twee ensieme wat verantwoordelik is vir die beperking van die groei van bakteriofaag in coli is: Eksonukleases Voeg metielgroep by DNA. Endonukleases sny DNA op spesifieke punte.

13. Hoe verskil die werking van eksonuklease van dié van endonuklease.
[Hele Indië 2010]
Antw.Eksonuklease verwyder nukleotiede van die punte van DNA, terwyl endonuklease die DNA op spesifieke posisies sny.

14. Noem die rol van molekulêre skêr in rekombinante DNA-tegnologie. [Hele Indië 2009]
Antw. Molekulêre skêr of beperkingsensieme sny DNS op spesifieke plek, waardeur die verlangde geen onttrek kan word en dit met DNS van die gasheer hou.

15. Noem die tegniek wat gebruik word om DNS-fragmente in die laboratorium te skei. [Delhi 2008]
Antw. Gelelektroforese word gebruik om DNA-fragmente in die laboratorium te skei.

16. Wat is die rol van etidiumbromied tydens agarosegelelektroforese van DNA-fragmente? [Hele Indië 2008C]
Antw. Die geskeide DNS-fragmente tydens agarosegelelektroforese word gevisualiseer nadat die DNS gekleur is met etidiumbromied, in UV-lig. Hierdie kleuring gee aan DNA 'n helder oranje kleur.
2 Punte Vrae
17. Hoe funksioneer 'n beperkingsnuklease? Verduidelik. [Hele Indië 2014]
Antw. Beperkingsnukleases funksioneer deur die lengte van DNA-volgorde te inspekteer, en dan aan spesifieke herkenningsvolgorde te bind en die stringe by suikerfosfaat-ruggraat te sny.
Hierdie nukleases is van twee tipes, afhangende van hul werkswyse.
(i) Beperking eksonukleases sny rye by terminale punte van DNA.
(ii) Beperking endonukleases sny tussen die twee basisse van herkenningsvolgorde.

18.Skryf die rol van Ori en beperkingsplek in 'n kloningsvektor pBR322.
[Delhi 2014]
of
Hoe fasiliteer Ori en kloningswerwe kloning in 'n vektor?
[Hele Indië 2008C]
Antw.Ori is 'n volgorde van DNA vanwaar replikasie begin. Enige stuk DNA wat in die gasheersel moet repliseer, moet daaraan gekoppel word.
Kloningsplekke verwys na die plek/volgorde van DNS waar die uitheemse DNS gekoppel is.

19. Verduidelik met behulp van 'n gepaste voorbeeld die benaming van 'n restriksie-endonuklease. [Delhi 2014]
Antw. Benoeming van beperking endonuklease is:
(i) Die eerste letter van die naam kom van die genus en volgende twee letters van spesies van die prokariotiese sel waaruit ensieme onttrek word.
(ii) Die Romeinse nommers wat die naam volg, toon die volgorde waarin die ensieme uit die bakteriese stam geïsoleer is. Byvoorbeeld, Eco Rl is afkomstig van Escherichia coli RY 13, Hind II van Haemophilus influenzae Rd, ens.

20. Hoe word taai punte op 'n DNS-string gevorm? Hoekom word hulle so genoem? [Delhi 2014]
Antw.Klewerige punte op DNA word gevorm deur die werking van ensieme-beperkingsendonukleases. Hierdie ensieme sny die DNA-string 'n bietjie weg van die middelpunt van die palindroomvolgorde tussen dieselfde twee basisse op beide die stringe. Dit lei tot enkelstrengige strekke op beide die komplementêre stringe aan hul punte.
Hierdie oorhangende streke word klewerige punte genoem aangesien hulle waterstofbindings met die komplementêre basispaarreekse vorm.

21. Hoe word insersie-inaktivering van 'n ensiem as 'n selekteerbare merker gebruik om rekombinante van nie-rekombinante te onderskei?
[Buitelandse 2014]
Antw. Die invoegingsaktivering van J3-galaktosidase-ensiem, dws deur die verlangde geen in die koderende gebied van ensiem in te voeg, lei tot inaktivering van (3-galaktosidase-geen in rekombinante. Die rekombinant op getransformeerde gashere is nie in staat om enige kleur te produseer wanneer dit op chromogeniese substraat gekweek word) , dus dien as 'n selekteerbare merker om rekombinante van nie-rekombinante te onderskei.

22. Verduidelik palindromiese nukleotiedvolgorde met behulp van 'n geskikte voorbeeld. [Buitelandse 2014]
Antw.Die palindromiese nukleotiedvolgorde is die volgorde van basispare in DNS wat dieselfde lees op beide die komplementêre stringe van DNS, met dieselfde oriëntasie van lees.
Byvoorbeeld
5′-GAATTC-3′
3′-CTTAAG-5′

23. Waarom word molekulêre skêr so genoem? Skryf hul gebruik in biotegnologie? [Buitelandse 2014]
Antw. Molekulêre skêr word so genoem omdat dit DNA op spesifieke volgordes tussen basispare sny.
Aangesien molekulêre skêr op beperkingsensieme DNA in gewenste volgordes sny en taai punte genereer wat dit makliker maak om met gasheergenoom of vektor-DNS te verbind, speel hulle 'n belangrike rol in genetiese ingenieurswese of biotegnologie. Dit is omdat ons met behulp van hierdie ensieme die gewenste geen kan sny en in vektore kan inbring vir uitdrukking.

24. Waarom is die maak van selle bekwaam noodsaaklik vir biotegnologie-eksperimente? Noem enige twee maniere waarop dit bereik kan word.
[Delhi 2014C]
Antw. Aangesien DNA-molekules hidrofiel is, kan hulle nie deur selmembrane beweeg nie. Vir rekombinante DNA om in vektor- of gasheergenoom geïntegreer te word, is dit nodig dat die DNA in die sel ingevoeg word. Daarom is dit nodig om die gasheerselle bekwaam te maak in biotegnologie-eksperimente.
Die twee maniere waarop selle bevoeg gemaak kan word om DNA op te neem, is:
(i) Chemiese werking Deur die konsentrasie van tweewaardige katioon, kalsium te verhoog, en sodoende die doeltreffendheid van DNA wat deur porieë in sel, wand binnedring, te verhoog.
(ii) Hitteskokbehandeling Inkubeer die selle met rekombinante DNA op ys, gevolg deur kort behandeling van hitte by 42 °C en plaas hulle weer op ys.

25. Hoe verskil 'n eksonuklease funksioneel van 'n endonuklease? Gee 'n voorbeeld van enige twee endonukleases anders as Sal I. [Delhi 2013C]
Antw. Eksonukleases is die ensieme wat basispare DNS aan hul terminale punte klief en op enkelstring DNS of gapings in dubbelstring DNS inwerk. Terwyl endonukleases DNS op enige punt behalwe die terminale punte klief en sny kan maak op een string of op beide stringe van dubbelstring DNS, bv. Eco Rl en Hind II.

26. Verduidelik die werk wat deur Cohen en Boyer gedoen is wat geweldig bygedra het in biotegnologie. [Delhi 2012]
Antw. (i) Stanley Cohen en Herbert Boyer het die eerste kunsmatige rekombinante DNA (rDNA) molekule gekonstrueer.
(ii) Hulle het die antibiotika-weerstandsgeen geïsoleer deur 'n stuk DNA uit 'n plasmied uit te sny met behulp van beperkingsensiem en dit met behulp van DNAIigase aan 'n inheemse plasmied van Salmonella typhimurium gekoppel.

27. (i) 'n Rekombinante vektor met 'n geen van belang wat binne die geen van a-galaktosidase ensiem ingevoeg is, word in 'n bakterie ingebring. Verduidelik die metode wat sal help met die seleksie van rekombinante kolonies uit nie-rekombinante kolonies.
(ii) Hoekom is hierdie metode (.van seleksie waarna verwys word as invoegingsinaktivering? [HOTS All India 2012]
Antw. (i) Die rekombinante kolonies kan van nie-rekombinante kolonies onderskei word deur hul onvermoë om kleur te produseer in die teenwoordigheid van 'n chromogeniese substraat.
Die rekombinante produseer geen kleur nie, terwyl die nie-rekombinante 'n blou kleur produseer met chromogeniese substraat in die medium.
(ii) Die ensiem a-galaktosidase word geïnaktiveer met die invoeging van rekombinante DNA, binne die koderende volgorde van ensiem. Die metode word dus invoegingsinaktivering genoem.

28. Verduidelik en gee redes waarom 'n uitheemse stuk DNA geïntegreer moet word met 'n spesifieke reeks gasheer-DNS vir die kloning daarvan?
[Hele Indië 2011]
Antw.Die replikasie van DNA word geïnisieer vanaf die spesifieke DNA-volgorde wat oorsprong van replikasie genoem word. Vir vermenigvuldiging van uitheemse DNA in die gasheer, moet dit geïntegreer word met die oorsprong van replikasie (ori).

29. Lys die sleutelinstrumente wat in rekombinante DNA-tegnologie gebruik word. [Delhi 2011]
Antw.Sleutelgereedskap wat in rekombinante tegnologie gebruik word, is beperkingsensieme, polimerases, ligases, kloningsvektore.en bekwame gasheerorganisme of -selle.

30. Verduidelik die rol van Ti-plasmiede in biotegnologie. [Delhi 2011]
Antw.Die Ti-plasmied van Agrobacterium is verantwoordelik vir die natuurlike transformasie van plantselle in gewasse. Dit word dus in 'n nie-patogeen-vektor verander, maar is steeds in staat om die DNA te lewer. Hierdie ontwapende plasmied van Agrobacterium word gebruik as 'n vektor vir die transformasie van plantselle, en het dus bewys dat dit 'n belangrike rol in biotegnologie speel.

31. Hoe word rekombinante vektore geskep? Hoekom is slegs een tipe beperking endonuklease nodig vir die skep van een rekombinante vektor? [Buitelandse 2011]
Antw.Skepping van rekombinante vektore Vektor-DNS word by 'n spesifieke beperkingsplek gesny deur 'n beperkingsensiem, dieselfde wat gebruik is om die verlangde DNA-segment te sny. Die uitheemse DNA word dan met die vektor DNA gekoppel deur ensiem ligase’ te gebruik om die rekombinante vektor te vorm.
Aangesien, 'n beperking ensiem Herken en sny die DNA by 'n spesifieke volgorde
herkenningsplek genoem word, word dieselfde beperkingsensiem gebruik om die DNS-segment van beide die vektor en die ander bron te sny, om dieselfde taai punte in beide DNS-molekules te produseer om hul aansluiting te vergemaklik.

32. Bestudeer die diagram hieronder en beantwoord die volgende vrae
(i) Waarom het DNS-fragmente in bank D verder wegbeweeg in vergelyking met dié in band C?
(ii) Identifiseer die anode-einde in digram.
(iii) Hoe word hierdie DNA-fragmente gevisualiseer? [Buitelandse 2011]
Antw. (i) In band D is DNS-fragmente kleiner as dié op band C. Die fragmente skei volgens hul grootte deur die sif-effek wat deur die jel verskaf word. Dus, die kleiner fragmente beweeg verder weg as die groteres.
(ii) B is anode-einde in die diagram.
(iii) Jelbevattende DNA-fragmente word met etidiumbromied gekleur en aan UV-straling blootgestel. Oranje kleur bande van DNA word sigbaar.

33. 'n Rekombinante DNS word gevorm wanneer taai punte van vektor DNS en vreemde DNS aansluit. Verduidelik hoe die taai punte gevorm word en saamgevoeg word? [Hele Indië 2010]
Antw.Klewerige punte word gevorm wanneer 'n beperkingsensiem die stringe DNA 'n bietjie weg van die middel van die palindromiese volgorde sny.
Die taai punte word verbind via komplementêre faktor van twee polinukleotiedstringe basisse en deur die werking van ensiem, DNA-ligase.

34. Verduidelik die werking van die beperking endonuklease Eco RI.
[Buitelandse 2010]
Antw.Beperkingsendonuklease Eco Rl sny die DNA-stringe 'n bietjie weg van die middel van die palindromiese volgorde, maar tussen dieselfde twee basisse op die twee stringe, d.w.s. G en A.
5′-GAATTC-3′
3′- C T T A A G- 5′
(i) As gevolg hiervan hang enkelstrengige gedeeltes wat klewerige punte genoem word, aan die einde van elke draad oor.
(ii) As gevolg van die klewerigheid vorm hulle maklik waterstofbindings met hul komplementêre eweknieë.

35. Hoe word die DNA-fragmente geskei deur gelelektroforese gevisualiseer en geskei vir gebruik in die konstruksie van rekombinante DNA?
[ Buitelandse 201 Heel Indië 2008]
Antw. Die geskeide DNA-fragmente word met etidiumbromied gekleur.
(i) Deur die blootstelling aan UV-straling word die geskeide DNS-fragmente sigbaar as oranjekleurige bande.
(ii) Die geskeide bande DNS word uit die agarosegel uitgesny en DNS word uit hierdie gelstukke onttrek, hierdie proses word eluering genoem.

36. (i) Illustreer die herkenningsvolgorde van Eco RI en noem wat sulke rye genoem word?
(ii) Hoe werk restriksie-endonuklease op 'n DNA-molekule?
[Hele Indië 2010 C]
Antw.(/’) Erkenning volgorde van Eco Rl
5 & ​​# 8242- G A A T T C -3 & # 8242
3′- C T T A A G -3′
Hierdie rye word palindromiese nukleotiedreekse genoem.
(ii) Beperkingsendonuklease werk op 'n gespesifiseerde lengte van 'n DNA en bind aan die DNS by die spesifieke herkenningsvolgorde. Dit sny beide die dubbele DNA-stringe, by die suikerfosfaat-ruggraat, 'n bietjie weg van die middelpunt van palindromiese plekke tussen die spesifieke volgorde of punte.

37. Noem die bronorganisme waaruit Ti-plasmied geïsoleer is. Verduidelik die gebruik van hierdie plasmied in biotegnologie. [Buitelandse 2009]
Ans. Ti-plasmied word geïsoleer van Agrobacterium tumefaciens-bakterieë.
Die Ti-plasmied van Agrobacterium is verantwoordelik vir die natuurlike transformasie van plantselle in gewasse. Dit word dus in 'n nie-patogeen-vektor verander, maar is steeds in staat om die DNA te lewer. Hierdie ontwapende plasmied van Agrobacterium word gebruik as 'n vektor vir die transformasie van plantselle, en het dus bewys dat dit 'n belangrike rol in biotegnologie speel.

38. Noem die natuurlike bron van agarose. Noem een ​​rol van agarose in biotegnologie. [Delhi 2009c]
Antw.Die natuurlike bron van agarose is seewier. Rol van agarose in biotegnologie
(i) Dit word gebruik om die matriks vir gelelektroforese te ontwikkel.
(ii) Dit help met die skeiding van fragmente op grond van hul grootte.

39. Bestudeer die koppeling van DNA-fragmente wat hieronder getoon word:

E.coli kloningsvektor pBR322 wat beperkingsplekke toon (Hind III, Eco Rl
Bam HI, Sal I, Pvu II, Pst I, Cla I), ori en antibiotika weerstandigheid gene (amp R en tet R ).
rop-kodes vir die proteïene betrokke by die replikasie van die plasmied.

  • Noem A DNA en B DNA.
  • Noem die beperkingsensiem wat hierdie palindroom herken.

Noem die ensiem wat hierdie twee DNS-fragmente kan verbind.
[Delhi 2008]
Antw. (i) 'n & # 8211 Vektor / plasmied DNA
B & # 8211 Buitelandse DNA
(ii) Eco Rl
(iii) DNA-ligase40. Die volgende illustreer die koppeling van DNS-fragmente.

(i) Noem A en B.
(ii) Voltooi die palindroom, wat deur Eco RI erken word.
(iii) Noem die ensiem wat die twee DNS-fragmente kan verbind.
[Buitelandse 2008]
Antw.(i) A & # 8211 Vektor DNA, B-Vreemde DNA
(ii) 5′- GAATTC-3′
3′- CTAAG-5′
(iii) DNA-ligase
3 Punte Vrae

41. Noem en beskryf die tegniek wat help om die DNA-fragmente wat gevorm word deur die gebruik van restriksie-endonuklease te skei. [Hele Indië 2014]
Antw. DNA-fragmente wat gevorm word deur die gebruik van restriksie-endonukleases, word geskei deur gelelektroforese.
(i) DNS-fragmente is negatief gelaaide molekules. Hulle beweeg dus na die anode onder elektriese veld deur die medium.
(ii) DNA-fragmente skei volgens hul grootte as gevolg van sewing effek van agarose gel.
(iii) Die geskeide DNS-fragmente kan bekyk word deur die DNS met etidiumbromied te kleur, gevolg deur blootstelling aan UV-straling.
(iv) Die geskeide bande DNA word gesny en uit gelstuk onttrek. Dit staan ​​bekend as eluering.

42. Teken 'n skematiese diagram van die kolikoloneringsvektor pBR322 en merk die volgende daarin.

  • ori
  • rop
  • ampicillien weerstand geen
  • tetrasiklienweerstandsgeen
  • beperkingsterrein Bam HI
  • beperkingswerf EcoRI

(i) Teken skematiese diagramme van segmente van 'n vektor en 'n vreemde DNA met die volgorde van nukleotiede wat deur Eco herken word
(ii) Teken die vektor-DNS-segment en vreemde DNA-segmente na die werking van EcoRI en merk die taai punte wat geproduseer word. [Delhi 2014C]
of
Teken 'n skematiese skets van pBR322-plasmied en benoem die volgende daarin

  • Enige twee beperkingswebwerwe.
  • Ori en rop
  • ’n Antibiotika-weerstandige geen. [Delhi 2012].

Antw. coli kloningsvektor pBR322.
E.coli kloningsvektor pBR322 wat beperkingsplekke toon (Hind III, Eco Rl
Bam HI, Sal I, Pvu II, Pst I, Cla I), ori en antibiotika weerstandigheid gene (amp R en tet R ).
rop-kodes vir die proteïene betrokke by die replikasie van die plasmied.
of
(a) Beperkingsensieme sny die DNA-string 'n bietjie weg van die middel van die palindroom-plekke, maar tussen dieselfde twee basisse op die teenoorgestelde stringe.
(b) Dit laat enkelstrengige gedeeltes aan die ente.
(c) Daar is oorhangende strekke wat klewerige punte genoem word op elke stringe soos in bostaande figuur gegee. Dit word so genoem omdat hulle waterstofbindings vorm met hul komplementêre gesnyde eweknieë.
(d) Die taaiheid van die punte vergemaklik die werking van die ensiem DNA-ligase.
(e) Beperking-endonukleases word in genetiese ingenieurswese gebruik om rekombinante DNA-molekules te vorm, wat saamgestel is uit DNA van verskillende bronne/genome.
(f) Hierdie taai punte is aanvullend tot mekaar wanneer dit deur dieselfde beperkingsensiem gesny word, en kan dus saamgevoeg word (end-tot-end) deur gebruik te maak van DNA-ligases.43. Wat is ‘kloningwebwerwe’ in 'n kloningsvektor? Verduidelik hul rol. Noem enige twee sulke terreine in pBR322. [Hele Indië 2014C]
Antw.Die kloningsplekke is eintlik die spesifieke unieke herkenningsvolgorde vir 'n spesifieke beperkingsensiem, om die vreemde DNA met die vektor DNA te koppel om 'n rekombinante DNA molekules te skep, (l) Hierdie plekke is belangrik vir die koppeling van DNA fragmente van vektor en uitheemse DNA. En ook veelvuldige herkenningsvolgordes vir 'n spesifieke beperkingsensiem binne 'n DNA of vektor sal die proses van geenkloning bemoeilik.
Die twee kloningsplekke in pBR322 is Bam HI van tetrasiklien-weerstandige geen en Pvu I van ampiciMies-weerstandige gene.

44. Hoe word die DNS-fragmente geskei en geïsoleer vir DNS-vingerafdrukke? Verduidelik. [Buitelandse 2012]
Antw. DNA-fragmente wat gevorm word deur die gebruik van restriksie-endonukleases, word geskei deur gelelektroforese.
(i) DNS-fragmente is negatief gelaaide molekules. Hulle beweeg dus na die anode onder elektriese veld deur die medium.
(ii) DNA-fragmente skei volgens hul grootte as gevolg van sewing effek van agarose gel.
(iii) Die geskeide DNS-fragmente kan bekyk word deur die DNS met etidiumbromied te kleur, gevolg deur blootstelling aan UV-straling.
(iv) Die geskeide bande DNA word gesny en uit gelstuk onttrek. Dit staan ​​bekend as eluering

45. (i) Waarom word restriksie-endonukleases, so genoem?
(ii) Wat is 'n palindromiese nukleotiedvolgorde? Hoe werk beperking-endonukleases op palindromiese terreine om taai punte te skep?
[Delhi 2011C]
Antw. (i) Beperkingsendonukleases word so genoem omdat hulle op spesifieke posisies binne die DNA herken en 'n sny maak en die groei van bakteriofaag beperk.
(ii) (a) Die palindroom in DNS is 'n volgorde van basispare wat dieselfde lees op die twee stringe DNS wanneer die oriëntasie van lees dieselfde gehou word.
Byvoorbeeld,
5’—GAATTG—3′
3’—CTTAAG—5′
(b) Beperkingsensieme sny die DNA-string 'n bietjie weg van die middelpunt van die palindroomplek, maar tussen dieselfde twee basisse in beide die stringe. Dit skep enkelstrengige strekke wat aan die punte van die palindroom oorhang, wat taai punte genoem word.

46. ​​Hoe word die volgende in biotegnologie gebruik?

  • Plasmied DNA
  • Herkenningsvolgorde
  • Gelelektroforese [Hele Indië 2011c]

Antw. (i) Plasmied DNA Dit word gebruik om rekombinante DNA te konstrueer, deur die uitheemse stuk DNA daarmee te bind. Dit word as 'n kloningsvektor gebruik en help met die seleksie van rekombinante uit nie-rekombinante.

(ii) Herkenningsreekse Dit is spesifieke basisvolgordes van DNS, waar beperkingsensiem die DNS sny. Hulle word gebruik om die verlangde geen of fragmente uit DNA-molekules te onttrek.
(iii) Gelelektroforese Dit is 'n tegniek wat gebruik word om die DNA-fragmente volgens hul grootte te skei deur middel van sewing effek van die jel.47. EcoRI word gebruik om 'n segment van vreemde DNA en dié van 'n vektor-DNS te sny om 'n rekombinante DNA te vorm. Toon met behulp van skematiese diagramme.

  • Die stel palindromiese nukleotiedvolgorde van basispare wat die EcoRI in beide die DNA-segmente sal herken. Merk die terrein waar EcoRI sal optree en sny beide die segmente.
  • Klewerige punte word op beide die segmente gevorm, waar die twee DNS-segmente later sal aansluit om 'n rekombinante DNS te vorm. [Delhi 2010]

Antw. Palindromiese volgorde van Eco Rl is

5′ G AATTC 3′
3’C TTAA G 5′ t
(die pyle dui die plek aan waar dit die stringe sny.)
(ii) Klewerige punte op beide die segmente gevorm.
(a) Beperkingsensieme sny die DNA-string 'n bietjie weg van die middel van die palindroom-plekke, maar tussen dieselfde twee basisse op die teenoorgestelde stringe.
(b) Dit laat enkelstrengige gedeeltes aan die ente.
(c) Daar is oorhangende strekke wat klewerige punte genoem word op elke stringe soos in bostaande figuur gegee. Dit word so genoem omdat hulle waterstofbindings vorm met hul komplementêre gesnyde eweknieë.
(d) Die taaiheid van die punte vergemaklik die werking van die ensiem DNA-ligase.
(e) Beperking-endonukleases word in genetiese ingenieurswese gebruik om rekombinante DNA-molekules te vorm, wat saamgestel is uit DNA van verskillende bronne/genome.
(f) Hierdie taai punte is aanvullend tot mekaar wanneer dit deur dieselfde beperkingsensiem gesny word, en kan dus saamgevoeg word (end-tot-end) deur gebruik te maak van DNA-ligases.48. (i) Noem die organisme waarin die vektor wat gewys word, ingevoeg word om die kopieë van die verlangde geen te kry.

  • Noem die area gemerk in die vektor wat verantwoordelik is vir die beheer van die kopiegetal van die ingevoegde geen.
  • Noem en verduidelik die rol van akiesbare merker in die vektor Getoon. [Hele Indië 2010]

Antw. (i) Escherichia coli (E. coli)
(ii) Ori in die vektor is verantwoordelik vir die beheer van die kopiegetal van ingevoegde geen.
(iii) Die gene wat vir weerstand teen antibiotika kodeer soos tet R bestand teen tetrasiklien, amp R bestand teen ampicillien word as kiesbare merkers gebruik. Indien 'n vreemde DNA by die Bam HI-plek van tetrasiklienweerstandsgeen geligeer word, sal die rekombinante plasmiede die tetrasiklienweerstandigheid verloor.
Die selekteerbare merkers help om nie-transformante te identifiseer en uit te skakel en die groei van transformante selektief toe te laat.

49. (i) EcoRI is 'n beperking endonuklease. Hoe word dit so genoem? Verduidelik.
(ii) Skryf die volgorde van DNS-basisse neer wat die ensiem herken. Noem die punt waarop die ensiem 'n sny in die DNA-segment maak. [Delhi 2010c]
Antw.(I) Benoeming van beperking endonuklease is:
(i) Die eerste letter van die naam kom van die genus en volgende twee letters van spesies van die prokariotiese sel waaruit ensieme onttrek word.
(ii) Die Romeinse nommers wat die naam volg, toon die volgorde waarin die ensieme uit die bakteriese stam geïsoleer is. Byvoorbeeld, Eco Rl is afkomstig van Escherichia coli RY 13, Hind II van Haemophilus influenzae Rd, ens.
(II) Die herkenningsvolgorde is 'n palindroom, waar die volgorde van die basispaar dieselfde op beide die DNS-stringe lees, wanneer die oriëntasie van lees dieselfde gehou word,
bv. 5′- GAATTC -3′
3′- CTAAG -5′
Die ensiem Eco Rl dit sny die DNA-segment by basisse G en A op beide die stringe slegs wanneer die volgorde GAATTC

50. (i) Noem die tegniek wat gebruik word vir die skeiding van DNA-fragmente.

  • Skryf die tipe matriks wat in hierdie tegniek gebruik word.
  • Hoe word die geskeide DNA gevisualiseer en onttrek vir gebruik in rekombinante tegnologie? [Hele Indië 2010]

Antw. (i) Gelelektroforese.

(ii) Die materiaal wat as matriks in gelelektroforese gebruik word, is agarose.
Hierdie agarose-gel dien as 'n sif om die DNA-fragmente volgens hul grootte te skei.
(iii) Die geskeide DNA-fragmente word met etidiumbromied gekleur.
(a) Deur die blootstelling aan UV-straling word die geskeide DNS-fragmente sigbaar as oranjekleurige bande.
(b) Die geskeide bande DNS word uit die agarosegel uitgesny en DNS word uit hierdie gelstukke onttrek, hierdie proses word eluering genoem.

51. (i) Identifiseer die kiesbare markte in die diagram van E. coli-vektor wat hieronder getoon word.
Antw. (i) 'n – AmpicillienweerstandD – Tetrasiklienweerstand word as selekteerbare merkers in E.coli kloningsvektor gebruik.
(ii) Kodervolgorde van a-galaktosidase is 'n beter merker, aangesien die rekombinante en nie-rekombinante gedifferensieer word op grond van hul vermoë om kleur te produseer in die teenwoordigheid van 'n chromogeniese substraat, terwyl die seleksie van rekombinante as gevolg van inaktivering van antibiotika weerstandbiedende geen is 'n vervelige en tydrowende proses om hulle gelyktydig op twee antibiotika afsonderlik te laat groei.
(a) Inleiding van rDNA in die koderende volgorde van a-galaktosidase lei tot invoeging inaktivering.
(ii) Die rekombinante produseer nie 'n blou kleur nie, terwyl die nie-recomninante 'n blou kleur produseer.

52. Noem en verduidelik die tegnieke wat gebruik word in die skeiding en isolasie van DNS-fragmente om in rekombinante DNS-tegnologie gebruik te word.
[Hele Indië 2009]
Antw.DNA-fragmente wat gevorm word deur die gebruik van restriksie-endonukleases, word geskei deur gelelektroforese.
(i) DNS-fragmente is negatief gelaaide molekules. Hulle beweeg dus na die anode onder elektriese veld deur die medium.
(ii) DNA-fragmente skei volgens hul grootte as gevolg van sewing effek van agarose gel.
(iii) Die geskeide DNS-fragmente kan bekyk word deur die DNS met etidiumbromied te kleur, gevolg deur blootstelling aan UV-straling.
(iv) Die geskeide bande DNA word gesny en uit gelstuk onttrek. Dit staan ​​bekend as eluering.

53. Waarom word gene wat vir weerstand van antibiotika kodeer, as bruikbare selekteerbare merkers vir coli-kloningsvektor beskou? Verduidelik met behulp van een voorbeeld. [Delhi 2009c]
Antw. Die gene wat vir weerstand teen antibiotika kodeer, word as nuttig gekiesbaar beskou
merkers omdat die normale £. coli-selle dra nie weerstand teen enige van hierdie antibiotika nie.
Voorbeeld 'n Vreemde DNA word geligeer by die Bam HI-plek van tetrasiklienweerstandsgeen in die vektor pBR322. Die rekombinante plasmiede sal tetrasiklienweerstand verloor as gevolg van die invoeging van vreemde DNA maar kan steeds uit nie-rekombinante geselekteer word deur die transformante op ampicillienbevattende medium uit te plat.
Die transformante wat op ampicillien-bevattende medium groei, word dan oorgedra op medium wat tetrasiklien bevat. Die rekombinante sal nie groei nie, terwyl nie-rekombinante sal groei op die medium wat beide die antibiotika bevat. Antibiotiese weerstandsgeen help dus om die transformante te selekteer.

54. (i) Skryf die palindromiese nukleotiedvolgorde vir die volgende DNS-segment
5′- GAATTC- 3′

  • Noem die beperking endonuklease wat hierdie volgorde herken.
  • Hoe word taai punte geproduseer? Noem hul rol. [Hele Indië 2009]

Antw. (i) Palindromiese volgorde vir

5′- GAATTC- 3′
3′- CTAAG -5′.
(ii) Beperking endonuklease Eco Rl herken die bogenoemde palindromiese volgorde.
(iii)Stawerige punte op DNA word gevorm deur die werking van ensiembeperkingsendonukleases. Hierdie ensieme sny die DNA-string 'n bietjie weg van die middelpunt van die palindroomvolgorde tussen dieselfde twee basisse op beide die stringe. Dit lei tot enkelstrengige strekke op beide die komplementêre stringe aan hul punte.
Hierdie oorhangende streke word klewerige punte genoem aangesien hulle waterstofbindings met die komplementêre basispaarreekse vorm.
Rol van die taai punte Hierdie taai punte wat geproduseer word, vorm waterstofbindings met hul komplementêre gesnyde eweknieë. Hierdie klewerigheid van die punte vergemaklik die werking van die ensiem DNA-ligase.

55. (i) Wat is molekulêre skêr?
Gee een voorbeeld.
(ii) Verduidelik hul rol in rekombinante DNA-tegnologie.
[Delhi 2008 Buitelandse 2008]
of
(i) Noem die kategorie van ensieme wat op 'n spesifieke plek binne die DNA-molekule sny. Gee 'n voorbeeld.
(ii) Verduidelik hoe funksioneer hierdie ensieme? Noem hul gebruik in genetiese ingenieurswese. [Hele Indië 2008C]
Antw. (i) Molekulêre skêr is die beperking-endonukleases omdat hulle die DNA-segmente op spesifieke plekke of spesifieke volgorde sny, bv. Eco Rl.
(ii) Die beperkingsensieme sny die DNA-string 'n bietjie weg van die middel van die palindromiese plekke, maar tussen dieselfde twee basisse op die teenoorgestelde stringe. Dit laat enkelstrengige gedeeltes aan die punte met oorhangende strekke wat klewerige punte genoem word op elke string. Hierdie punte vorm waterstofbindings met hul komplementêre gesnyde eweknieë. Hierdie klewerigheid van die punte vergemaklik die werking van die ensiem DNA-ligase.

56. Waarom is Agrobacterium tumefaciens 'n goeie kloningsvektor? Verduidelik.
[Hele Indië 2008]
Antw. Agrobacterium tumefaciens is 'n grondbakterie wat siektes by baie tweesaadlobbige plante veroorsaak. Dit is 'n natuurlike vektor aangesien dit 'n stuk DNA bekend as T-DNA kan lewer om die normale selle in tumorselle te transformeer en hierdie tumorselle te lei om die chemikalieë te produseer wat deur die patogeen benodig word.
Die Tumor-induserende (Ti) plasmied van A. tumefaciens is nou gemodifiseer in 'n kloningsvektor, wat nie meer patogenies vir die plante is nie, maar steeds die geen van belang lewer, wat in genoom van plant geïnkorporeer word.

57. Verduidelik die belangrikheid van
(i) ori (ii) amp R en (iii) rop in die E.coli vektor wat hieronder getoon word.
[Hele Indië 2008]
Antw.(i) Ori is die volgorde van DNS vanwaar replikasie begin en enige stukkie DNS, wanneer dit aan hierdie volgorde gekoppel is, kan gemaak word om binne die gasheerselle te repliseer.
Dit is ook verantwoordelik vir die beheer van die kopienommer van gekoppelde DNS.
(ii) amp R is 'n antibiotika-weerstandsgeen waarin afbinding van uitheemse DNA by 'n beperkingsplek uitgevoer word.
(iii) rop-kodes vir die proteïene betrokke by die replikasie van die plasmied.

58. 'n Vektor is gemanipuleer met drie kenmerke, wat sy klonincj binne die gasheersel vergemaklik. Lys die drie kenmerke en verduidelik elkeen van hulle.
[Buitelandse 2008]
Antw. Kenmerke wat die kloning van vektor vergemaklik, is:
(i) Oorsprong van replikasie (Ori)

  • Dit is die volgorde van DNA vanwaar replikasie begin.
  • Enige stuk uitheemse/vreemde DNA wat daaraan gekoppel word, word gemaak om binne die gasheersel te repliseer. Dit bepaal ook die kopienommer van die gekoppelde[ DNA.
    (ii) Kiesbare merker is 'n merkergeen wat help met die selektering van die gasheerselle, wat transformante/rekombinante van die nie-rekombinante is.
    Byvoorbeeld, ampicillien- en tetrasiklien-weerstandige gene in, £. coli.
    (iii) Kloningsplek is 'n unieke herkenningsplek in 'n vektor om die vreemde DNA te koppel. Die teenwoordigheid van 'n spesifieke klonings-/herkenningsplek help die spesifieke beperkingsensiem om die vektor-DNS te sny. Enkel-herkenningswerf word algemeen verkies.
    (iv) Klein grootte van die vektor Die klein grootte vergemaklik die inbring van die DNA in die gasheer maklik.

59. Waarom 'n sel bevoeg gemaak moet word om DNA op te neem? Verduidelik die stappe waardeur 'n bakteriese selle bevoeg gemaak word om plasmied/rDNA op te neem. [Delhi 2008C]

Antw. DNS wat 'n hidrofiele molekule is, kan nie deur selmembraan beweeg nie. Gevolglik word die bakteriese sel bevoeg gemaak om die DNA-molekule te aanvaar. Bevoegdheid is dus die vermoë van 'n sel om vreemde DNA op te neem.
Die volgende metodes word gebruik om 'n bakteriese sel bekwaam te maak:
die bakterieë moet bevoeg gemaak word om die DNA-molekules te aanvaar,
(i) Bevoegdheid is die vermoë van 'n sel om vreemde DNA op te neem.
(ii) Metodes om 'n sel bekwaam te maak is soos volg.
(a) Chemiese metode In hierdie metode word die sel met 'n spesifieke konsentrasie van 'n tweewaardige katioon soos kalsium behandel om porieë in selwand te vergroot.

  • Die selle word dan met rekombinante DNA op ys geïnkubeer, gevolg deur plasing
  • hulle kort by 42°C en sit dit dan weer op ys. Dit word hitteskokbehandeling genoem.
    • Dit stel die bakterieë in staat om die rekombinante DNA op te neem.
    (b) Fisiese metodes In hierdie metode word 'n rekombinante DNA direk in die kern van 'n diersel ingespuit deur middel van mikro-inspuitingsmetode.
    • In plante word selle gebombardeer met hoë snelheid mikrodeeltjies van goud of
    wolfram bedek met DNA genoem as biolistiek of geengeweermetode.
    (c) Ontwapende patogeen-vektore wanneer dit toegelaat word om die sel te infekteer, dra die rekombinante DNA na die gasheer oor.

60. Lees die volgende basisvolgorde van 'n sekere DNS-string en beantwoord die vrae wat volg:

  • Wat word 'n palindromiese volgorde in 'n DNS genoem?
  • Skryf die palindromiese nukleotiedvolgorde wat in die DNA-string getoon word, en noem die ensiem wat so 'n volgorde sal herken.
  • Noem die belangrikheid van ensieme wat palindromiese nukleotiedvolgordes identifiseer. [Hele Indië 2008C]

Antw. (i) Palindromiese volgorde in 'n DNS is basisvolgordes wat dieselfde lees, beide in vorentoe en agtertoe rigting.
(ii) Palindromiese volgorde in DNA 5′- GAATTC- 3′
3 & # 8211 CTAAG- 5 & # 8242
Die volgorde lees dieselfde op die twee stringe in 5 & # 8242 - & gt 3 & # 8242 rigting. Dit is ook dieselfde as dit in die 3′->5′ rigting gelees word. Beperkingsendonuklease herken so 'n volgorde.
DNS wat 'n hidrofiele molekule is, kan nie deur selmembraan beweeg nie. Gevolglik word die bakteriese sel bevoeg gemaak om die DNA-molekule te aanvaar. Bevoegdheid is dus die vermoë van 'n sel om vreemde DNA op te neem.
Die volgende metodes word gebruik om 'n bakteriese sel bekwaam te maak:
die bakterieë moet bevoeg gemaak word om die DNA-molekules te aanvaar,
(i) Bevoegdheid is die vermoë van 'n sel om vreemde DNA op te neem.
(ii) Metodes om 'n sel bekwaam te maak is soos volg.
(a) Chemiese metode In hierdie metode word die sel met 'n spesifieke konsentrasie van 'n tweewaardige katioon soos kalsium behandel om porieë in selwand te vergroot.

hulle kort by 42°C en sit dit dan weer op ys. Dit word hitteskokbehandeling genoem.
• Dit stel die bakterieë in staat om die rekombinante DNA op te neem.
(b) Fisiese metodes In hierdie metode word 'n rekombinante DNA direk in die kern van 'n diersel ingespuit deur middel van mikro-inspuitingsmetode.
• In plante word selle gebombardeer met hoë snelheid mikrodeeltjies van goud of
wolfram bedek met DNA genoem as biolistiek of geengeweermetode.
(c) Ontwapende patogeen-vektore wanneer dit toegelaat word om die sel te infekteer, dra die rekombinante DNA na die gasheer oor.
Belangrikheid van beperking endonukleases Hulle word gebruik in genetiese ingenieurswese om rekombinante molekules van DNA te vorm,
wat saamgestel is uit DNA van verskillende bronne/genome en dit moontlik maak om die verlangde geenfragment te isoleer en dit met gasheer op vektor DNA te verbind as gevolg van taai punte wat gegenereer word.
5 Punte Vrae

61. (i) Beskryf die eienskappe wat 'n kloningsvektor moet besit.
(ii) Waarom kan DNS nie deur die selmembraan beweeg nie? Verduidelik. Hoe word 'n bakteriese sel bevoeg gemaak om rekombinante DNA uit die medium op te neem? [Hele Indië 2011]
Antw.(I) Die volgende kenmerke word benodig om kloning in 'n vektor te vergemaklik
Kenmerke wat die kloning van vektor vergemaklik, is:
(i) Oorsprong van replikasie (Ori)

  • Dit is die volgorde van DNA vanwaar replikasie begin.
  • Enige stuk uitheemse/vreemde DNA wat daaraan gekoppel word, word gemaak om binne die gasheersel te repliseer. Dit bepaal ook die kopienommer van die gekoppelde[ DNA.

(ii) Kiesbare merker is 'n merkergeen wat help met die selektering van die gasheerselle, wat transformante/rekombinante van die nie-rekombinante is.
Byvoorbeeld, ampicillien- en tetrasiklien-weerstandige gene in, £. coli.
(iii) Kloningsplek is 'n unieke herkenningsplek in 'n vektor om die vreemde DNA te koppel. Die teenwoordigheid van 'n spesifieke klonings-/herkenningsplek help die gedeeltelike beperkingsensiem om die vektor-DNS te sny. Enkel-herkenningswerf word algemeen verkies.
(iv) Klein grootte van die vektor Die klein grootte vergemaklik die inbring van die DNA in die gasheer maklik.
(II) DNS wat 'n hidrofiele molekule is, kan nie deur selmembraan beweeg nie. Gevolglik word die bakteriese sel bevoeg gemaak om die DNA-molekule te aanvaar. Bevoegdheid is dus die vermoë van 'n sel om vreemde DNA op te neem.
Die volgende metodes word gebruik om 'n bakteriese sel bekwaam te maak:
die bakterieë moet bevoeg gemaak word om die DNA-molekules te aanvaar,
(i) Bevoegdheid is die vermoë van 'n sel om vreemde DNA op te neem.
(ii) Metodes om 'n sel bekwaam te maak is soos volg.
(a) Chemiese metode In hierdie metode word die sel met 'n spesifieke konsentrasie van 'n tweewaardige katioon soos kalsium behandel om porieë in selwand te vergroot.

hulle kort by 42°C en sit dit dan weer op ys. Dit word hitteskokbehandeling genoem.
• Dit stel die bakterieë in staat om die rekombinante DNA op te neem.
(b) Fisiese metodes In hierdie metode word 'n rekombinante DNA direk in die kern van 'n diersel ingespuit deur middel van mikro-inspuitingsmetode.
• In plante word selle gebombardeer met hoë snelheid mikrodeeltjies van goud of
wolfram bedek met DNA genoem as biolistiek of geengeweermetode.
(c) Ontwapende patogeen-vektore wanneer dit toegelaat word om die sel te infekteer, dra die rekombinante DNA na die gasheer oor.62. (i) Toon met behulp van diagramme die verskillende stappe in die vorming van rekombinante DNA deur aksie van restriksie-endonuklease-ensiem Eco RI.
(ii) Noem die tegniek wat gebruik word om die fragmente van DNA wat deur restriksie-endonukleases gesny is te skei. [Hele Indië 2011]
Antw. (i) Vorming van rekombinante DNA deur die werking van restriksie-endonuklease-ensiem Eco Rl.
Die beperkingsensiem sny beide DNA-stringe op dieselfde plek, wat taai punte produseer.
(a) Beperkingsensieme sny die DNA-string 'n bietjie weg van die middel van die palindroom-plekke, maar tussen dieselfde twee basisse op die teenoorgestelde stringe.
(b) Dit laat enkelstrengige gedeeltes aan die ente.
(c) Daar is oorhangende strekke wat klewerige punte genoem word op elke stringe soos in bostaande figuur gegee. Dit word so genoem omdat hulle waterstofbindings vorm met hul komplementêre gesnyde eweknieë.
(d) Die taaiheid van die punte vergemaklik die werking van die ensiem DNA-ligase.
(e) Beperking-endonukleases word in genetiese ingenieurswese gebruik om rekombinante DNA-molekules te vorm, wat saamgestel is uit DNA van verskillende bronne/genome.
(f) Hierdie taai punte is aanvullend tot mekaar wanneer dit deur dieselfde beperkingsensiem gesny word, en kan dus saamgevoeg word (end-tot-end) deur gebruik te maak van DNA-ligases.
(ii) Gelelektroforese.

63. (i) Waarom word gemanipuleerde vektore deur biotegnoloë verkies om die verlangde gene na 'n ander organisme oor te dra?(ii) Verduidelik hoe fasiliteer ori, selekteerbare merker en kloningsplekke kloning in 'n vektor? [Buitelandse 2009]
Antw. (I) Gemanipuleerde vektore word deur biotegnoloë verkies omdat hulle help met die maklike koppeling van vreemde DNA en seleksie van rekombinante van nie-rekombinante.
(II) Kenmerke wat kloning van vektor vergemaklik is:
(i) Oorsprong van replikasie (Ori)

  • Dit is die volgorde van DNA vanwaar replikasie begin.
  • Enige stuk uitheemse/vreemde DNA wat daaraan gekoppel word, word gemaak om binne die gasheersel te repliseer. Dit bepaal ook die kopienommer van die gekoppelde[ DNA.

(ii) Kiesbare merker is 'n merkergeen wat help met die selektering van die gasheerselle, wat transformante/rekombinante van die nie-rekombinante is.
Byvoorbeeld, ampicillien- en tetrasiklien-weerstandige gene in, £. coli.
(iii) Kloningsplek is 'n unieke herkenningsplek in 'n vektor om die vreemde DNA te koppel. Die teenwoordigheid van 'n spesifieke klonings-/herkenningsplek help die gedeeltelike beperkingsensiem om die vektor-DNS te sny. Enkel-herkenningswerf word algemeen verkies.
(iv) Klein grootte van die vektor Die klein grootte vergemaklik die inbring van die DNA in die gasheer maklik.


Hoe is die beperkingsplek van EcoRI opgevolg? - Biologie

Beperking webwerwe, of beperking herkenningsplekke, is spesifieke volgordes van nukleotiede wat herken word deur beperking ensieme. Die terreine is oor die algemeen palindromies, en 'n besondere beperking ensiem kan die volgorde tussen twee nukleotiede binne sy sny.
Volledige artikel >>>

A beperking ensiem is 'n ensiem wat dubbel- of enkelstrengs DNA sny by spesifieke herkenningsnukleotiedvolgordes bekend as beperking werwe. Daar word vermoed dat sulke ensieme, wat in bakterieë en archaea voorkom, het.
Volledige artikel >>>

Hoe kan ek 'n byvoeg Werf na Internet Explorer's Beperk Werwe Sone? . Omdat ons praat oor die Beperk Werwe sone wat jy waarskynlik sal wil hê.
Volledige artikel >>>

Vind beperking endonuklease splitsing werwe in DNA-volgordes. Ondersteun lineêre en sirkelvormige DNA en bied verskeie maniere om uitset te sorteer en te filter.
Volledige artikel >>>

CLC bio bied 'n wye reeks wêreldklas bioinformatika-oplossings: Van hoogs gevorderde volgorde-analise. interaktief beperking werf ontleding .
Volledige artikel >>>

CLC bio bied 'n wye reeks wêreldklas bioinformatika-oplossings: Van hoogs gevorderde volgorde-analise. Beperking werf opsporing. Omgekeerde.
Volledige artikel >>>

. sones in Microsoft Internet Explorer, en hoe om verskillende vlakke van sekuriteit vir die web op te stel werwe wat jy besoek. . werf na die Beperk Werwe sone,.
Volledige artikel >>>

Dui aan beperking werwe van Fermentas-ensieme wat sensitief is (splyting . Daar is geen beperking werwe in PhiX174 DNA vir die volgende ensieme: .
Volledige artikel >>>

Dui aan beperking werwe van Fermentas-ensieme wat sensitief is (splyting . Daar is geen beperking werwe in M13mp18 DNA vir die volgende ensieme: .
Volledige artikel >>>

beperking werf sinonieme, beperking werf antonieme. Inligting oor beperking werf . beperking-werf polimorfisme. Beperkend. beperkingisme.
Volledige artikel >>>

Beperk Werf. Hierdie werf is vir die gebruik van die personeel van die Northeast Georgia Council, Boy. vertroulike of private inligting wat op hierdie web vervat is werf. .
Volledige artikel >>>

Hierdie artikel verskaf besonderhede oor die blokkering van ongewenste advertensies, baniere, opspringers, parasiete, kapers en soekenjins, deur dit in die Beperk Sone
Volledige artikel >>>

Ontaarde rye Ontleed beperking kaarte van rye. Dui asseblief aan hoe jy die beperking werwe vertoon. Kaart van beperking werwe .
Volledige artikel >>>

Jy kan ons lys sien van beperk werwe is baie groot. . Kom ons voeg 'n by werf na die Beperk Werwe lys. Let op die formaat van die inskrywing. .
Volledige artikel >>>

Hoe branderplankryers hul weg in tye van oorlog vind om beperk of gesensor werwe . Albei het beperk gratis weergawes. Hierdie werwe versteek jou ligging en beskerm .
Volledige artikel >>>

Werwe in die hoë sekuriteitsone geplaas sal word beperk in die toegang. Jy word beskerm as a werf is in jou beperk sone. .
Volledige artikel >>>

Die lengte van beperking erkenning werwe wissel: Die ensieme EcoRI, SacI en . Anders beperking ensieme kan dieselfde herkenning hê werf - sulke ensieme.
Volledige artikel >>>


Reguleerders van G-proteïensein, Deel B

Patrizia Tosetti, Kathleen Dunlap, in Methods in Enzymology, 2004

Produksie van replikasie-kompetente retrovirusse.

'n 5′ Xba I-beperkingsplek (TCT AGA) gevolg deur 'n translasie/transkripsie-bykomstige volgorde (CCA CGT TGG CCA GGC GGT AGC TGG GAC GTG CAG CCG ACC ACC) en 'n 3' HA epitoop (TAC GAC GTG CCC GAC TAC GCC) gevolg deur 'n stop kodon (TAG) en a HindIII-beperkingsplek (AAG CTT) word in-raam in RGS3-variant cDNA's gemanipuleer deur PCR, met behulp van primers wat die toepaslike volgordes dra. Die PCR-produkte word dan verteer en in raam gesubkloneer in die Xbaek/HindIII-plekke van die adaptorplasmied Cla12 NCO. Die reekse van belang word dan uit die adapterplasmied gesny deur ClaEk vertering en word nie-rigting gesubkloneer in die ClaI-plek van RCASBP retrovirale variante van die B-subgroep (albei plasmiede was 'n ruim geskenk van Dr. Donna Fekete, Purdue Universiteit, West Lafayette, IN). Alle afbindings word uitgevoer met behulp van die vinnige DNA-ligasie-stel van Boehringer Mannheim (Indianapolis, IN), volgens die vervaardiger se instruksies. Die beperkingsensieme is van New England Biolabs (Beverly, MA). Behoorlik georiënteerde konstrukte word geïdentifiseer deur PCR en volgordebepaling.


Jy kan ook ensieme filter volgens waar of hoeveel keer hulle op die volgorde sny. Byvoorbeeld, jy kan filter om slegs ensieme te sien wat enkel- of dubbelsnyers is. Jy kan ook ensieme sien wat op enige plek buite jou huidige keuse sny.

Klik weer op die skêr-ikoon om die Digests-paneel toe te maak. Dubbelklik op 'n snyplek op die volgordekaart, en let op dat die paneel outomaties oopmaak om meer inligting oor die ensiem te wys.


Bakteriese outo-immuniteit as gevolg van 'n beperking-modifikasiestelsel

Beperkings-modifikasie (RM) stelsels verteenwoordig 'n minimale en alomteenwoordige biologiese stelsel van self/nie-self diskriminasie in prokariote [1], wat gashere beskerm teen eksogene DNA [2]. Die meganisme is gebaseer op die balans tussen metieltransferase (M) en verwante beperking endonuklease (R). M merk endogene DNS as self deur kort spesifieke DNS-volgordes wat beperkingsplekke genoem word, te metileer, terwyl R ongemetileerde beperkingsplekke as nie-self herken en 'n dubbelstrengs DNS-breuk instel [3]. Beperkingsplekke is aansienlik onderverteenwoordig in prokariotiese genome [4-7], wat daarop dui dat die diskriminasiemeganisme onvolmaak is en soms lei tot outo-immuniteit as gevolg van self-DNA-splyting (selfbeperking) [8]. Verder kan RM-stelsels DNA-rekombinasie bevorder [9] en bydra tot genetiese variasie in mikrobiese populasies, en sodoende adaptiewe evolusie [10] fasiliteer. Splyting van self-DNA deur RM-stelsels as elemente wat prokariotiese genome vorm, is egter nie direk opgespoor nie, en die oorsaak, frekwensie en uitkoms daarvan is onbekend. Ons kwantifiseer selfbeperking wat veroorsaak word deur twee RM-stelsels van Escherichia coli en vind dat, in ooreenstemming met vlakke van beperkingsterreinvermyding, EcoRI, maar nie EcoRV nie, self-DNA teen 'n meetbare tempo klief. Selfbeperking is 'n stogastiese proses, wat tydelik die SOS-reaksie veroorsaak, en word gevolg deur DNA-herstel, wat die lewensvatbaarheid van selle handhaaf. Ons vind dat RM-stelsels met hoër beperkingsdoeltreffendheid teen bakteriofaaginfeksies 'n hoër koers van selfbeperking toon, en dat hierdie koers verder verhoog kan word deur stogastiese wanbalans tussen R en M. Ons resultate identifiseer molekulêre geraas in RM-stelsels as 'n faktor wat prokarioties vorm genome.


Frekwensies van beperkingsterreine

Die tabel hieronder som die frekwensies op waarmee beperking-endonuklease-plekke voorkom in algemeen gebruikte DNA-molekules. Gedetailleerde beperkingskaarte kan op DNS-volgordes en kaarte gevind word. Die terreine wat in hierdie tabelle gelys is, is geïdentifiseer deur rekenaaranalise van gepubliseerde rye. Alhoewel ons probeer het om hul akkuraatheid te verseker, is die webwerwe nie noodwendig deur eksperimentering bevestig nie. Wanneer dieselfde spesifisiteit deur verskeie ensieme vertoon word, word die webwerf gelys deur die naam van die ensiem wat by New England Biolabs beskikbaar is. Ander ensieme met dieselfde spesifisiteit word in die tabel van isoskizomere gelys. Herkenningsreekse word 5&akuut tot 3&akuut geskryf.

DNASU is 'n sentrale bewaarplek vir plasmiedklone en versamelings wat ook nuttig kan wees.

Ensiem Herkenningsvolgorde Adeno-2 Lambda** M13mp18* pBR322 pKLAC2 pMAL-p5x pSNAPf pTXB1 pTYB21 pUC19 T7
AatII GACGT/C 3 10 0 1 0 0 5 1 0 1 1
AbaSI CNNNNNNNNNNN/NNNNNNNNNG
AccI GT/MKAC 17 9 1 2 5 1 2 5 3 1 33
Acc65I G/GTACC 8 2 1 0 0 0 2 0 1 1 5
AciI CCGC(-3/-1) 582 516 42 67 81 80 75 102 92 34 199
AclI AA/CGTT 3 7 2 4 2 5 3 12 9 2 19
AkuI CTGAAG(16/14) 23 40 0 2 8 4 5 2 2 2 1
AfeI AGC/GCT 13 2 1 4 0 2 0 1 2 0 0
AflII C/TTAAG 4 3 0 0 0 0 0 0 0 0 19
AflIII A/CRYGT 25 20 3 1 4 2 5 3 4 1 23
Ouderdom I § A/CCGGT 5 13 0 0 1 0 1 1 0 0 2
AgeI-HF® A/CCGGT 5 13 0 0 1 0 1 1 0 0 2
AhdI GACNNN/NGTC 9 9 0 1 1 2 1 2 2 1 14
AleI-v2 CACNN/NNGTG 10 20 1 0 1 0 1 0 2 0 8
AluI AG/CT 158 143 27 17 38 28 27 30 34 16 140
AlwI GGATC(4/5) 35 58 3 12 18 12 20 15 16 10 1
AlwNI CAGNNN/CTG 25 41 1 1 5 2 4 1 2 1 15
ApaI GGGCC/C 12 1 0 0 0 1 1 1 1 0 0
ApaLI G/TGCAC 7 4 0 3 3 6 4 4 4 3 1
ApeKI G/CWGC 179 199 10 21 27 25 20 27 29 12 116
ApoI § R/AATTY 29 58 11 0 19 5 3 5 7 1 13
ApoI-HF R/AATTY 29 58 11 0 19 5 3 5 7 1 13
AscI GG/CGCGCC 2 2 0 0 0 0 1 0 0 0 0
AseI AT/TAAT 3 17 7 1 5 4 7 10 4 3 12
AsiSI GCGAT/CGC 1 0 0 0 0 0 0 0 0 0 0
AvaI C/YCGRG 40 8 2 1 2 1 2 3 1 1 4
AvaII G/GWCC 73 35 1 8 7 9 6 6 8 2 54
AvrII C/CTAGG 2 2 0 0 0 0 1 0 0 0 3
BaeGI GKGCM/C 45 10 1 3 8 8 8 6 5 3 16
BaeI (10/15)ACNNNNGTAYC(12/7) 5 10 3 0 1 0 0 0 1 0 3
BamHI § G/GATCC 3 5 1 1 1 1 1 1 1 1 0
BamHI-HF® G/GATCC 3 5 1 1 1 1 1 1 1 1 0
BanI G/GYRCC 57 25 7 9 7 4 8 8 12 4 33
BanII GRGCY/C 57 7 2 2 5 2 5 3 6 1 1
BbsI § GAAGAC(2/6) 27 24 0 3 3 3 2 4 4 0 38
BbsI-HF ® GAAGAC(2/6) 27 24 0 3 3 3 2 4 4 0 38
BbvCI CCTCAGC(-5/-2) 9 7 2 0 0 0 0 0 0 0 10
BbvI GCAGC(8/12) 179 199 10 21 27 25 20 27 29 12 116
BccI CCATC(4/5) 62 145 14 9 22 16 8 14 25 3 121
BceAI ACGGC(12/14) 80 115 7 3 13 11 8 13 10 2 47
BcgI (10/12)CGANNNNNNTGC(12/10) 10 28 0 3 6 4 1 4 6 1 19
BciVI GTATCC(6/5) 9 26 0 2 3 4 3 4 4 2 23
BclI § T/GATCA 5 8 0 0 2 2 1 1 2 0 1
BclI-HF T/GATCA 5 8 0 0 2 2 1 1 2 0 1
BcoDI GTCTC(1/5) 60 37 5 3 11 8 4 8 9 4 95
BfaI C/TAG 54 13 5 5 19 3 14 8 8 4 60
BfuAI ACCTGC(4/8) 39 41 3 1 5 4 4 2 3 1 18
BglI GCCNNNN/NGGC 20 29 1 3 3 1 7 2 3 2 2
BglII A/GATCT 11 6 1 0 1 1 2 0 2 0 1
BlpI GC/TNAGC 8 6 0 0 0 1 0 1 1 0 20
BmgBI CACGTC(-3/-3) 15 17 0 0 1 1 2 0 0 0 8
BmrI ACTGGG(5/4) 22 4 1 5 2 5 11 8 2 6
BmtI § GCTAG/C 4 1 0 1 4 0 1 1 1 0 1
BmtI-HF® GCTAG/C 4 1 0 1 4 0 1 1 1 0 1
BpmI CTGGAG(16/14) 32 25 2 4 3 4 1 5 6 1 23
BpuEI CTTGAG(16/14) 19 13 4 6 7 5 9 7 9 4 56
Bpu10I CCTNAGC(-5/-2) 23 19 4 1 0 1 2 0 2 0 39
BsaAI YAC/GTR 22 14 5 1 4 0 3 2 4 0 35
BsaBI GATNN/NNATC 2 21 2 1 2 2 1 1 3 0 7
BsaHI GR/CGYC 44 40 1 6 6 5 8 12 7 3 8
BsaI-HF®v2 GGTCTC(1/5) 18 2 0 1 3 2 2 2 2 1 29
BsaJI C/CNNGG 234 105 9 8 18 10 17 15 15 5 85
BsaWI W/CCGGW 28 81 6 5 8 7 5 8 6 3 32
BsaXI (9/12)ACNNNNNCTCC(10/7) 29 19 4 0 3 1 1 2 3 1 12
BseRI GAGGAG(10/8) 63 19 1 0 2 0 3 0 0 0 13
BseYI CCCAGC(-5/-1) 31 32 3 2 3 4 5 4 4 1 29
BsgI GTGCAG(16/14) 34 41 0 1 4 6 3 5 4 0 21
BsiEI CGRY/CG 50 22 3 7 11 8 6 9 8 5 17
BsiHKAI GWGCW/C 38 28 3 8 8 9 9 7 7 5 24
BsiWI § C/GTACG 4 1 0 0 0 1 0 1 0 0 0
BsiWI-HF ® C/GTACG 4 1 0 0 0 1 0 1 0 0 0
BslI CCNNNNN/NNGG 216 176 17 20 18 16 26 31 25 6 90
BsmAI GTCTC(1/5) 60 37 5 3 11 8 8 10 4 95
BsmBI-v2 CGTCTC 21 14 1 1 2 2 0 2 2 2 16
BsmFI GGGAC(10/14) 59 38 2 4 4 1 5 4 6 0 46
BsmI GAATGC(1/-1) 10 46 1 1 3 1 5 1 0 0 15
BsoBI C/YCGRG 40 8 2 1 2 1 2 3 1 1 4
BspCNI CTCAG(9/7) 75 80 24 7 10 10 9 20 16 5 142
BspDI AT/CGAT 2 15 2 1 2 0 0 0 0 0 3
BspEI T/CCGGA 8 24 0 1 1 2 0 1 1 0 0
BspHI T/CATGA 3 8 1 4 2 1 2 2 3 3 13
Bsp1286I GDGCH/C 105 38 5 10 16 11 15 11 12 5 40
BspMI ACCTGC(4/8) 39 41 3 1 5 4 4 2 3 1 18
BspQI GCTCTTC(1/4) 7 10 0 1 2 1 3 1 1 1 4
BsrBI CCGCTC(-3/-3) 28 17 4 2 6 4 6 9 5 3 17
BsrDI GCAATG(2/0) 14 44 3 2 7 4 4 4 4 2 18
BsrFI-v2 R/CCGGY 40 61 1 7 9 2 6 11 9 1 3
BsrGI § T/GTACA 5 5 1 0 1 0 1 1 2 0 13
BsrGI-HF® T/GTACA 5 5 1 0 1 0 1 1 2 0 13
BsrI ACTGG(1/-1) 86 110 19 18 23 26 19 32 28 11 118
BssHII G/CGCGC 52 6 0 0 1 2 2 1 1 0 1
BssSI-v2 CACGAG(-5/-1) 11 8 0 3 5 3 4 2 4 3 31
BstAPI GCANNNN/NTGC 20 34 0 2 3 2 0 3 2 1 12
BstBI TT/CGAA 1 7 0 0 2 0 0 0 1 0 7
BstEII § G/GTNACC 10 13 0 0 1 1 0 1 1 0 1
BstEII-HF® G/GTNACC 10 13 0 0 1 1 2 1 1 0 1
BstNI CC/WGG 136 71 7 6 15 14 19 19 14 5 2
BstUI CG/CG 303 157 17 23 26 31 19 41 35 10 65
BstXI CCANNNNN/NTGG 10 13 0 0 2 4 1 4 3 0 11
BstYI R/GATCY 22 21 2 8 12 9 11 10 12 7 2
BstZ17I-HF ® GTATAC 3 3 0 1 3 0 1 1 1 0 8
Bsu36I CC/TNAGG 7 2 1 0 1 1 1 0 0 0 30
BtgI C/CRYGG 82 46 2 2 4 3 6 1 4 0 26
BtgZI GCGATG(10/14) 23 45 4 3 4 6 6 4 3 0 24
BtsCI GGATG(2/0) 78 150 4 12 20 17 7 12 18 5 97
BtsIMutI CAGTG(2/0) 20
BtsI-v2 GCAGTG(2/0) 22 34 1 2 7 5 5 4 4 3 20
Cac8I GCN/NGC 285 238 28 31 33 32 41 49 42 14 104
ClaI AT/CGAT 2 15 2 1 2 0 0 0 0 0 3
CspCI (11/13)CAANNNNNGTGG(12/10) 6 7 1 0 1 0 1 0 0 0 9
CviAII C/ATG 183 181 14 26 38 23 21 23 31 11 148
CviKI-1 RG/CY 680 692 103 73 131 86 119 112 121 45 562
CviQI G/TAC 83 113 19 3 15 7 14 6 11 3 168
DdeI C/TNAG 97 104 30 8 17 11 11 20 19 6 282
DpnI GA/TC 87 116 6 22 35 23 31 24 29 15 6
DpnII /GATC 87 116 6 22 35 23 31 24 29 15 6
DraI TTT/AAA 12 13 5 3 5 1 6 3 2 3 9
DraIII-HF® CACNNN/GTG 10 10 1 0 2 0 6 1 1 0 16
DrdI GACNNNN/NGTC 6 3 1 2 5 2 2 4 4 2 11
EaeI J/GGCCR 70 39 3 6 10 5 15 4 8 3 2
EagI-HF® C/GGCCG 19 2 0 1 4 1 2 2 2 0 0
OorI CTCTTC(1/4) 29 34 2 2 11 6 4 3 5 3 46
EciI GGCGGA(11/9) 29 32 2 4 6 6 8 9 8 3 2
Eco53kI GAG/CTC 16 2 1 0 2 1 2 0 1 1 0
EcoNI CCTNN/NNNAGG 10 9 0 1 3 0 0 2 1 0 1
EcoO109I RG/GNCCY 44 3 0 4 1 2 5 1 3 1 22
EcoP15I CAGCAG(25/27) 50 72 4 7 7 10 6 6 5 3 36
EcoRI § G/AATTC 5 5 1 1 1 1 1 1 1 1 0
EcoRI-HF® G/AATTC 5 5 1 1 1 1 1 1 1 1 0
EcoRV § GAT/ATC 9 21 0 1 1 1 1 1 3 0 0
EcoRV-HF® GAT/ATC 9 21 0 1 1 1 1 1 3 0 0
Esp3I CGTCTC(1/5) 21 14 1 1 2 2 0 2 2 2 16
VetI /CATG 183 181 14 26 38 23 21 23 31 11 148
FauI CCCGC(4/6) 147 90 10 10 14 17 11 28 22 5 24
Fnu4HI GC/NGC 411 380 17 42 52 42 47 49 52 19 156
FokI GGATG(9/13) 78 150 4 12 20 17 7 12 18 5 97
FseI GGCCGG/CC 3 0 0 0 0 0 0 0 0 0 0
FspEI BK(12/16)
FspI TGC/GCA 17 15 1 4 3 2 2 1 2 2 7
HaeII RGCGC/Y 76 48 6 11 6 9 3 7 12 3 26
HaeIII GG/CC 216 149 15 22 31 23 36 34 36 11 68
HgaI GACGC(5/10) 87 102 7 11 10 12 7 20 15 4 70
HhaI GCG/C 375 215 26 31 36 39 41 46 17 103
HincII GTY/RAC 25 35 1 2 9 7 4 7 6 1 61
HindIII § A/AGCTT 12 6 1 1 1 1 4 0 2 1 0
HindIII-HF® A/AGCTT 12 6 1 1 1 1 4 0 2 1 0
HinfI G/ANTC 72 148 26 10 31 9 11 16 20 6 218
HinP1I G/CGC 375 215 26 31 36 39 27 41 46 17 103
HpaI GTT/AAC 6 14 0 0 3 1 1 1 2 0 18
HpaII C/CGG 171 328 18 26 32 25 24 50 35 13 58
HphI GGTGA(8/7) 99 168 18 12 15 19 14 21 20 7 102
HpyAV CCTTC(6/5) 84 106 14 10 24 14 11 16 20 6 110
HpyCH4III ACN/GT 122 187 31 14 25 20 15 18 22 8 174
HpyCH4IV A/KWB 83 143 22 10 21 10 19 23 22 5 170
HpyCH4V TG/CA 207 273 18 21 39 28 30 26 27 13 116
Hpy188I TCN/GA 80 170 31 15 24 19 17 19 28 10 153
Hpy99I CGWCG/ 61 102 8 9 14 9 13 18 16 5 29
Hpy166II GTN/NAC 116 125 10 8 29 20 13 27 24 5 199
Hpy188III TC/NNGA 103 185 28 19 32 22 25 27 28 13 173
Ek-CeuI TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13) 0 0 0 0 0 0
I-SceI TAGGGATAACAGGGTAAT(-9/-13) 0 0 0 0 0 0
KasI G/GCGCC 20 1 1 4 1 1 1 1 4 1 2
KpnI § GGTAC/C 8 2 1 0 0 0 2 0 1 1 5
KpnI-HF® GGTAC/C 8 2 1 0 0 0 2 0 1 1 5
LpnPI CCDG(10/14)
MboI /GATC 87 116 6 22 35 23 31 24 29 15 6
MboII GAAGA(8/7) 113 130 10 11 38 15 14 14 18 8 140
MfeI § C/AATTG 4 8 0 0 2 1 2 1 1 0 8
MfeI-HF® C/AATTG 4 8 0 0 2 1 2 1 1 0 8
MluCI /AATT 87 189 62 8 43 22 19 31 44 7 79
MluI § A/CGCGT 5 7 0 0 0 1 2 2 1 0 1
MluI-HF® A/CGCGT 5 7 0 0 0 1 2 2 1 0 1
MlyI GAGTC(5/5) 40 61 8 4 17 5 6 11 10 4 115
MmeI TCCRAC(20/18) 25 18 3 4 8 3 5 4 4 2 33
MnlI CCTC(7/6) 397 262 62 26 56 24 41 35 39 13 342
MscI TGG/CCA 17 18 1 1 0 1 2 0 1 0 2
MseI T/TAA 115 195 63 15 41 24 23 32 39 13 207
MslI CAYNN/NNRTG 35 62 3 7 10 10 6 7 9 3 38
MspA1I CMG/CKG 95 75 4 6 14 11 8 10 12 6 35
MspI C/CGG 171 328 18 26 32 25 24 50 35 13 58
MspJI CNNR(9/13)
MwoI GCNNNNN/NNGC 391 347 19 34 33 30 42 41 43 13 170
NaeI GCC/GGC 13 1 1 4 3 0 2 5 5 0 0
NarI GG/CGCC 20 1 1 4 1 1 1 1 4 1 2
Nb.BbvCI CCTCAGC 9 7 2 0 0 0 0 0 0 10
Nb.BsmI GAATGC 10 46 1 1 3 1 1 0 0 15
Nb.BsrDI GCAATG 14 44 3 2 7 4 4 4 2 18
Nb.BssSI CACGAG 11 8 0 3 5 3 2 4 3 31
Nb.BtsI GCAGTG 22 34 1 2 7 5 4 4 3 20
NciI CC/SGG 97 114 4 10 10 13 9 27 15 7 9
NcoI § C/CATGG 20 4 0 0 1 1 3 0 1 0 1
NcoI-HF® C/CATGG 20 4 0 0 1 1 3 0 1 0 1
NdeI CA/TATG 2 7 3 1 1 1 1 1 1 1 7
NgoMIV G/CCGGC 13 1 1 4 3 0 2 5 5 0 0
NheI-HF® G/CTAGC 4 1 0 1 4 0 1 1 0 1
NlaIII CATG/ 183 181 14 26 38 23 21 23 31 11 148
NlaIV GGN/NCC 178 82 18 24 22 14 20 22 30 11 99
NmeAIII GCCGAG(21/19) 17 8 0 3 2 3 2 2 4 1 14
NieI § GC/GGCCGC 7 0 0 0 1 1 1 1 1 0 0
NotI-HF® GC/GGCCGC 7 0 0 0 1 1 1 1 1 0 0
NruI § TCG/CGA 5 5 0 1 1 0 1 1 0 0 3
NruI-HF® TCG/CGA 5 5 0 1 1 0 1 1 0 0 3
NsiI § ATGCA/T 9 14 0 0 6 0 1 0 0 0 8
NsiI-HF® ATGCA/T 9 14 0 0 6 0 1 0 0 0 8
NspI RCATG/Y 41 32 6 4 9 3 5 5 5 3 24
Nt.AlwI GGATC(4/-5) 35 58 3 12 18 12 15 16 10 1
Nt.BbvCI CCTCAGC(-5/-7) 9 7 2 0 0 0 0 0 0 10
Nt.BsmAI GTCTC(1/-5) 60 37 5 3 11 8 8 10 4 95
Nt.BspQI GCTCTTC(1/-7) 7 10 0 1 2 1 1 1 1 4
Nt.BstNBI GAGTC(4/-5) 40 61 8 4 17 5 6 11 10 4 115
Nt.CviPII (0/-1)CCD 4148 4641 570 457 806 570 609 716 729 251 3575
Pas TTAAT/TAA 1 0 1 0 0 0 1 0 0 0 1
PaeR7I C/TCGAG 6 1 0 0 1 0 1 1 0 0 0
PaqCI CACCTGC(4/8) 9 12 0 0 0 0 1 0 0 0 5
PciI A/CATGT 9 2 3 1 3 1 2 1 1 1 6
PflFI GACN/NGTC 12 2 0 1 1 1 1 1 2 0 1
PflMI CCANNNN/NTGG 18 14 0 2 3 1 5 2 2 0 8
PI-PspI TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17) 0 0 0 0 0 0
PI-SceI ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19) 0 0 0 0 0 0
PleI GAGTC(4/5) 40 61 8 4 17 5 6 11 10 4 115
PluTI GGCGC/C
PmeI GTTT/AAAC 1 2 0 0 0 0 1 1 0 0 2
PmlI CAC/GTG 10 3 0 0 0 0 1 0 1 0 1
PpuMI RG/GWCCY 23 3 0 2 1 2 1 0 0 0 12
PshAI GACNN/NGTC 2 7 0 1 1 0 0 1 2 0 6
PsiI-v2 TTA/TAA 4 12 2 0 2 1 1 1 1 0 5
PspGI /CCWGG 136 71 7 6 15 14 19 19 14 5 2
PspOMI G/GGCCC 12 1 0 0 0 1 1 1 1 0 0
PspXI VC/TCGAGB 3 1 0 0 0 0 1 1 0 0 0
PstI § CTGCA/G 30 28 1 1 3 1 4 1 1 1 0
PstI-HF® CTGCA/G 30 28 1 1 3 1 4 1 1 1 0
PvuI § CGAT/CG 7 3 1 1 2 1 1 2 2 0
PvuI-HF® CGAT/CG 7 3 1 1 3 2 1 1 2 2 0
PvuII § CAG/CTG 24 15 3 1 3 3 3 3 4 2 3
PvuII-HF® CAG/CTG 24 15 3 1 3 3 3 3 4 2 3
RsaI GT/AC 83 113 19 3 15 7 14 6 11 3 168
RsrII CG/GWCCG 2 5 0 0 0 1 1 0 0 0 1
SacI § GAGCT/C 16 2 1 0 2 1 2 0 1 1 0
SacI-HF® GAGCT/C 16 2 1 0 2 1 2 0 1 1 0
SacII CCGC/GG 33 4 0 0 2 0 1 1 1 0 0
SalI § G/TCGAC 3 2 1 1 1 1 1 4 1 1 0
SalI-HF® G/TCGAC 3 2 1 1 1 1 1 4 1 1 0
SapI GCTCTTC(1/4) 7 10 0 1 2 1 3 1 1 1 4
Sau3AI /GATC 87 116 6 22 35 23 31 24 29 15 6
Sau96I G/GNCC 164 74 4 15 14 20 21 26 24 6 79
SbfI § CCTGCA/GG 3 5 1 0 1 1 1 0 1 1 0
SbfI-HF® CCTGCA/GG 3 5 1 0 1 1 1 0 1 1 0
ScaI-HF® AGT/ACT 5 5 0 1 2 1 1 2 1 4
ScrFI CC/NGG 233 185 11 16 25 27 28 46 29 12 11
SexAI A/CCWGGT 9 5 0 0 3 0 0 0 0 0 0
SfaNI GCATC(5/9) 85 169 7 22 18 20 17 23 19 8 96
SfcI C/TRYAG 47 38 7 4 9 4 10 6 8 4 48
SfiI GGCCNNNN/NGGCC 3 0 0 0 0 0 1 0 0 0 1
SfoI GGC/GCC 20 1 1 4 1 1 1 1 4 1 2
SgrAI CR/CCGGYG 6 6 0 1 0 0 0 1 1 0 0
SmaI CCC/GGG 12 3 1 0 1 0 1 0 0 1 0
SmlI C/TYRAG 29 17 4 6 8 5 10 8 9 4 75
SnaBI TAC/GTA 0 1 1 0 1 0 1 0 0 0 13
SpeI § A/CTAGT 3 0 0 0 0 0 1 1 1 0 2
SpeI-HF® A/CTAGT 3 0 0 0 0 0 1 1 1 0 2
SphI § GCATG/C 8 6 1 1 2 0 2 2 1 1 0
SphI-HF® GCATG/C 8 6 1 1 2 0 2 2 1 1 0
SrfI GCCC/GGGC
SspI § AAT/ATT 5 20 6 1 6 2 1 3 5 1 6
SspI-HF® AAT/ATT 5 20 6 1 6 2 1 3 5 1 6
StuI AGG/CCT 11 6 0 0 1 0 0 1 1 0 1
StyD4I /CCNGG 233 185 11 16 25 27 28 46 29 12 11
StyI-HF® C/CWWGG 44 10 0 1 4 1 4 2 4 0 36
SwaI ATTT/AAAT 1 0 1 0 0 0 1 1 1 0 1
TaqI-v2 T/CGA 50 121 12 7 32 16 15 22 17 4 111
TfiI G/AWTC 32 87 18 6 14 4 5 5 10 2 103
TseI G/CWGC 179 199 10 21 27 25 20 27 29 12 116
Tsp45I /GTSAC 73 81 9 9 9 7 5 12 13 4 108
TspMI C/CCGGG 12 3 1 0 1 0 1 0 0 1 0
TspRI NNCASTGNN/ 83 119 9 11 22 14 16 16 15 10 94
Tth111I GACN/NGTC 12 2 0 1 1 1 1 1 2 0 1
XbaI T/CTAGA 5 1 1 0 1 0 1 1 1 1 3
XcmI CCANNNNN/NNNNTGG 14 12 0 0 1 3 0 3 4 0 8
XhoI C/TCGAG 6 1 0 0 1 0 1 1 0 0 0
Kersfees C/CCGGG 12 3 1 0 1 0 1 0 0 1 0
XmnI GAANN/NNTTC 5 24 2 2 3 1 3 7 2 1 12
ZraI GAC/GTC 3 10 0 1 0 0 5 1 0 1 1

&sek 'n HF-weergawe van hierdie ensiem is beskikbaar.

* Vir M13mp18 sal slegs dubbelstrengige streke gesny word.
** Verwys na die wilde-tipe DNA-substraat Hind III het 6 beperkingsplekke op die wildtipe lambda-faag-DNS, terwyl NEB se lambda-faagmutant (Lambda DNA, NEB #N3011) 7 Hind III-plekke het.


Frekwensies van beperkingsterreine

Die tabel hieronder som die frekwensies op waarmee beperking-endonuklease-plekke voorkom in algemeen gebruikte DNA-molekules. Gedetailleerde beperkingskaarte kan op DNS-volgordes en kaarte gevind word. Die terreine wat in hierdie tabelle gelys is, is geïdentifiseer deur rekenaaranalise van gepubliseerde rye. Alhoewel ons probeer het om hul akkuraatheid te verseker, is die webwerwe nie noodwendig deur eksperimentering bevestig nie. Wanneer dieselfde spesifisiteit deur verskeie ensieme vertoon word, word die webwerf gelys deur die naam van die ensiem wat by New England Biolabs beskikbaar is. Ander ensieme met dieselfde spesifisiteit word in die tabel van isoskizomere gelys. Herkenningsreekse word 5&akuut tot 3&akuut geskryf.

DNASU is 'n sentrale bewaarplek vir plasmiedklone en versamelings wat ook nuttig kan wees.

Ensiem Herkenningsvolgorde Adeno-2 Lambda** M13mp18* pBR322 pKLAC2 pMAL-p5x pSNAPf pTXB1 pTYB21 pUC19 T7
AatII GACGT/C 3 10 0 1 0 0 5 1 0 1 1
AbaSI CNNNNNNNNNNN/NNNNNNNNNG
AccI GT/MKAC 17 9 1 2 5 1 2 5 3 1 33
Acc65I G/GTACC 8 2 1 0 0 0 2 0 1 1 5
AciI CCGC(-3/-1) 582 516 42 67 81 80 75 102 92 34 199
AclI AA/CGTT 3 7 2 4 2 5 3 12 9 2 19
AkuI CTGAAG(16/14) 23 40 0 2 8 4 5 2 2 2 1
AfeI AGC/GCT 13 2 1 4 0 2 0 1 2 0 0
AflII C/TTAAG 4 3 0 0 0 0 0 0 0 0 19
AflIII A/CRYGT 25 20 3 1 4 2 5 3 4 1 23
Ouderdom I § A/CCGGT 5 13 0 0 1 0 1 1 0 0 2
AgeI-HF® A/CCGGT 5 13 0 0 1 0 1 1 0 0 2
AhdI GACNNN/NGTC 9 9 0 1 1 2 1 2 2 1 14
AleI-v2 CACNN/NNGTG 10 20 1 0 1 0 1 0 2 0 8
AluI AG/CT 158 143 27 17 38 28 27 30 34 16 140
AlwI GGATC(4/5) 35 58 3 12 18 12 20 15 16 10 1
AlwNI CAGNNN/CTG 25 41 1 1 5 2 4 1 2 1 15
ApaI GGGCC/C 12 1 0 0 0 1 1 1 1 0 0
ApaLI G/TGCAC 7 4 0 3 3 6 4 4 4 3 1
ApeKI G/CWGC 179 199 10 21 27 25 20 27 29 12 116
ApoI § R/AATTY 29 58 11 0 19 5 3 5 7 1 13
ApoI-HF R/AATTY 29 58 11 0 19 5 3 5 7 1 13
AscI GG/CGCGCC 2 2 0 0 0 0 1 0 0 0 0
AseI AT/TAAT 3 17 7 1 5 4 7 10 4 3 12
AsiSI GCGAT/CGC 1 0 0 0 0 0 0 0 0 0 0
AvaI C/YCGRG 40 8 2 1 2 1 2 3 1 1 4
AvaII G/GWCC 73 35 1 8 7 9 6 6 8 2 54
AvrII C/CTAGG 2 2 0 0 0 0 1 0 0 0 3
BaeGI GKGCM/C 45 10 1 3 8 8 8 6 5 3 16
BaeI (10/15)ACNNNNGTAYC(12/7) 5 10 3 0 1 0 0 0 1 0 3
BamHI § G/GATCC 3 5 1 1 1 1 1 1 1 1 0
BamHI-HF® G/GATCC 3 5 1 1 1 1 1 1 1 1 0
BanI G/GYRCC 57 25 7 9 7 4 8 8 12 4 33
BanII GRGCY/C 57 7 2 2 5 2 5 3 6 1 1
BbsI § GAAGAC(2/6) 27 24 0 3 3 3 2 4 4 0 38
BbsI-HF ® GAAGAC(2/6) 27 24 0 3 3 3 2 4 4 0 38
BbvCI CCTCAGC(-5/-2) 9 7 2 0 0 0 0 0 0 0 10
BbvI GCAGC(8/12) 179 199 10 21 27 25 20 27 29 12 116
BccI CCATC(4/5) 62 145 14 9 22 16 8 14 25 3 121
BceAI ACGGC(12/14) 80 115 7 3 13 11 8 13 10 2 47
BcgI (10/12)CGANNNNNNTGC(12/10) 10 28 0 3 6 4 1 4 6 1 19
BciVI GTATCC(6/5) 9 26 0 2 3 4 3 4 4 2 23
BclI § T/GATCA 5 8 0 0 2 2 1 1 2 0 1
BclI-HF T/GATCA 5 8 0 0 2 2 1 1 2 0 1
BcoDI GTCTC(1/5) 60 37 5 3 11 8 4 8 9 4 95
BfaI C/TAG 54 13 5 5 19 3 14 8 8 4 60
BfuAI ACCTGC(4/8) 39 41 3 1 5 4 4 2 3 1 18
BglI GCCNNNN/NGGC 20 29 1 3 3 1 7 2 3 2 2
BglII A/GATCT 11 6 1 0 1 1 2 0 2 0 1
BlpI GC/TNAGC 8 6 0 0 0 1 0 1 1 0 20
BmgBI CACGTC(-3/-3) 15 17 0 0 1 1 2 0 0 0 8
BmrI ACTGGG(5/4) 22 4 1 5 2 5 11 8 2 6
BmtI § GCTAG/C 4 1 0 1 4 0 1 1 1 0 1
BmtI-HF® GCTAG/C 4 1 0 1 4 0 1 1 1 0 1
BpmI CTGGAG(16/14) 32 25 2 4 3 4 1 5 6 1 23
BpuEI CTTGAG(16/14) 19 13 4 6 7 5 9 7 9 4 56
Bpu10I CCTNAGC(-5/-2) 23 19 4 1 0 1 2 0 2 0 39
BsaAI YAC/GTR 22 14 5 1 4 0 3 2 4 0 35
BsaBI GATNN/NNATC 2 21 2 1 2 2 1 1 3 0 7
BsaHI GR/CGYC 44 40 1 6 6 5 8 12 7 3 8
BsaI-HF®v2 GGTCTC(1/5) 18 2 0 1 3 2 2 2 2 1 29
BsaJI C/CNNGG 234 105 9 8 18 10 17 15 15 5 85
BsaWI W/CCGGW 28 81 6 5 8 7 5 8 6 3 32
BsaXI (9/12)ACNNNNNCTCC(10/7) 29 19 4 0 3 1 1 2 3 1 12
BseRI GAGGAG(10/8) 63 19 1 0 2 0 3 0 0 0 13
BseYI CCCAGC(-5/-1) 31 32 3 2 3 4 5 4 4 1 29
BsgI GTGCAG(16/14) 34 41 0 1 4 6 3 5 4 0 21
BsiEI CGRY/CG 50 22 3 7 11 8 6 9 8 5 17
BsiHKAI GWGCW/C 38 28 3 8 8 9 9 7 7 5 24
BsiWI § C/GTACG 4 1 0 0 0 1 0 1 0 0 0
BsiWI-HF ® C/GTACG 4 1 0 0 0 1 0 1 0 0 0
BslI CCNNNNN/NNGG 216 176 17 20 18 16 26 31 25 6 90
BsmAI GTCTC(1/5) 60 37 5 3 11 8 8 10 4 95
BsmBI-v2 CGTCTC 21 14 1 1 2 2 0 2 2 2 16
BsmFI GGGAC(10/14) 59 38 2 4 4 1 5 4 6 0 46
BsmI GAATGC(1/-1) 10 46 1 1 3 1 5 1 0 0 15
BsoBI C/YCGRG 40 8 2 1 2 1 2 3 1 1 4
BspCNI CTCAG(9/7) 75 80 24 7 10 10 9 20 16 5 142
BspDI AT/CGAT 2 15 2 1 2 0 0 0 0 0 3
BspEI T/CCGGA 8 24 0 1 1 2 0 1 1 0 0
BspHI T/CATGA 3 8 1 4 2 1 2 2 3 3 13
Bsp1286I GDGCH/C 105 38 5 10 16 11 15 11 12 5 40
BspMI ACCTGC(4/8) 39 41 3 1 5 4 4 2 3 1 18
BspQI GCTCTTC(1/4) 7 10 0 1 2 1 3 1 1 1 4
BsrBI CCGCTC(-3/-3) 28 17 4 2 6 4 6 9 5 3 17
BsrDI GCAATG(2/0) 14 44 3 2 7 4 4 4 4 2 18
BsrFI-v2 R/CCGGY 40 61 1 7 9 2 6 11 9 1 3
BsrGI § T/GTACA 5 5 1 0 1 0 1 1 2 0 13
BsrGI-HF® T/GTACA 5 5 1 0 1 0 1 1 2 0 13
BsrI ACTGG(1/-1) 86 110 19 18 23 26 19 32 28 11 118
BssHII G/CGCGC 52 6 0 0 1 2 2 1 1 0 1
BssSI-v2 CACGAG(-5/-1) 11 8 0 3 5 3 4 2 4 3 31
BstAPI GCANNNN/NTGC 20 34 0 2 3 2 0 3 2 1 12
BstBI TT/CGAA 1 7 0 0 2 0 0 0 1 0 7
BstEII § G/GTNACC 10 13 0 0 1 1 0 1 1 0 1
BstEII-HF® G/GTNACC 10 13 0 0 1 1 2 1 1 0 1
BstNI CC/WGG 136 71 7 6 15 14 19 19 14 5 2
BstUI CG/CG 303 157 17 23 26 31 19 41 35 10 65
BstXI CCANNNNN/NTGG 10 13 0 0 2 4 1 4 3 0 11
BstYI R/GATCY 22 21 2 8 12 9 11 10 12 7 2
BstZ17I-HF ® GTATAC 3 3 0 1 3 0 1 1 1 0 8
Bsu36I CC/TNAGG 7 2 1 0 1 1 1 0 0 0 30
BtgI C/CRYGG 82 46 2 2 4 3 6 1 4 0 26
BtgZI GCGATG(10/14) 23 45 4 3 4 6 6 4 3 0 24
BtsCI GGATG(2/0) 78 150 4 12 20 17 7 12 18 5 97
BtsIMutI CAGTG(2/0) 20
BtsI-v2 GCAGTG(2/0) 22 34 1 2 7 5 5 4 4 3 20
Cac8I GCN/NGC 285 238 28 31 33 32 41 49 42 14 104
ClaI AT/CGAT 2 15 2 1 2 0 0 0 0 0 3
CspCI (11/13)CAANNNNNGTGG(12/10) 6 7 1 0 1 0 1 0 0 0 9
CviAII C/ATG 183 181 14 26 38 23 21 23 31 11 148
CviKI-1 RG/CY 680 692 103 73 131 86 119 112 121 45 562
CviQI G/TAC 83 113 19 3 15 7 14 6 11 3 168
DdeI C/TNAG 97 104 30 8 17 11 11 20 19 6 282
DpnI GA/TC 87 116 6 22 35 23 31 24 29 15 6
DpnII /GATC 87 116 6 22 35 23 31 24 29 15 6
DraI TTT/AAA 12 13 5 3 5 1 6 3 2 3 9
DraIII-HF® CACNNN/GTG 10 10 1 0 2 0 6 1 1 0 16
DrdI GACNNNN/NGTC 6 3 1 2 5 2 2 4 4 2 11
EaeI J/GGCCR 70 39 3 6 10 5 15 4 8 3 2
EagI-HF® C/GGCCG 19 2 0 1 4 1 2 2 2 0 0
OorI CTCTTC(1/4) 29 34 2 2 11 6 4 3 5 3 46
EciI GGCGGA(11/9) 29 32 2 4 6 6 8 9 8 3 2
Eco53kI GAG/CTC 16 2 1 0 2 1 2 0 1 1 0
EcoNI CCTNN/NNNAGG 10 9 0 1 3 0 0 2 1 0 1
EcoO109I RG/GNCCY 44 3 0 4 1 2 5 1 3 1 22
EcoP15I CAGCAG(25/27) 50 72 4 7 7 10 6 6 5 3 36
EcoRI § G/AATTC 5 5 1 1 1 1 1 1 1 1 0
EcoRI-HF® G/AATTC 5 5 1 1 1 1 1 1 1 1 0
EcoRV § GAT/ATC 9 21 0 1 1 1 1 1 3 0 0
EcoRV-HF® GAT/ATC 9 21 0 1 1 1 1 1 3 0 0
Esp3I CGTCTC(1/5) 21 14 1 1 2 2 0 2 2 2 16
VetI /CATG 183 181 14 26 38 23 21 23 31 11 148
FauI CCCGC(4/6) 147 90 10 10 14 17 11 28 22 5 24
Fnu4HI GC/NGC 411 380 17 42 52 42 47 49 52 19 156
FokI GGATG(9/13) 78 150 4 12 20 17 7 12 18 5 97
FseI GGCCGG/CC 3 0 0 0 0 0 0 0 0 0 0
FspEI BK(12/16)
FspI TGC/GCA 17 15 1 4 3 2 2 1 2 2 7
HaeII RGCGC/Y 76 48 6 11 6 9 3 7 12 3 26
HaeIII GG/CC 216 149 15 22 31 23 36 34 36 11 68
HgaI GACGC(5/10) 87 102 7 11 10 12 7 20 15 4 70
HhaI GCG/C 375 215 26 31 36 39 41 46 17 103
HincII GTY/RAC 25 35 1 2 9 7 4 7 6 1 61
HindIII § A/AGCTT 12 6 1 1 1 1 4 0 2 1 0
HindIII-HF® A/AGCTT 12 6 1 1 1 1 4 0 2 1 0
HinfI G/ANTC 72 148 26 10 31 9 11 16 20 6 218
HinP1I G/CGC 375 215 26 31 36 39 27 41 46 17 103
HpaI GTT/AAC 6 14 0 0 3 1 1 1 2 0 18
HpaII C/CGG 171 328 18 26 32 25 24 50 35 13 58
HphI GGTGA(8/7) 99 168 18 12 15 19 14 21 20 7 102
HpyAV CCTTC(6/5) 84 106 14 10 24 14 11 16 20 6 110
HpyCH4III ACN/GT 122 187 31 14 25 20 15 18 22 8 174
HpyCH4IV A/KWB 83 143 22 10 21 10 19 23 22 5 170
HpyCH4V TG/CA 207 273 18 21 39 28 30 26 27 13 116
Hpy188I TCN/GA 80 170 31 15 24 19 17 19 28 10 153
Hpy99I CGWCG/ 61 102 8 9 14 9 13 18 16 5 29
Hpy166II GTN/NAC 116 125 10 8 29 20 13 27 24 5 199
Hpy188III TC/NNGA 103 185 28 19 32 22 25 27 28 13 173
Ek-CeuI TAACTATAACGGTCCTAAGGTAGCGAA(-9/-13) 0 0 0 0 0 0
I-SceI TAGGGATAACAGGGTAAT(-9/-13) 0 0 0 0 0 0
KasI G/GCGCC 20 1 1 4 1 1 1 1 4 1 2
KpnI § GGTAC/C 8 2 1 0 0 0 2 0 1 1 5
KpnI-HF® GGTAC/C 8 2 1 0 0 0 2 0 1 1 5
LpnPI CCDG(10/14)
MboI /GATC 87 116 6 22 35 23 31 24 29 15 6
MboII GAAGA(8/7) 113 130 10 11 38 15 14 14 18 8 140
MfeI § C/AATTG 4 8 0 0 2 1 2 1 1 0 8
MfeI-HF® C/AATTG 4 8 0 0 2 1 2 1 1 0 8
MluCI /AATT 87 189 62 8 43 22 19 31 44 7 79
MluI § A/CGCGT 5 7 0 0 0 1 2 2 1 0 1
MluI-HF® A/CGCGT 5 7 0 0 0 1 2 2 1 0 1
MlyI GAGTC(5/5) 40 61 8 4 17 5 6 11 10 4 115
MmeI TCCRAC(20/18) 25 18 3 4 8 3 5 4 4 2 33
MnlI CCTC(7/6) 397 262 62 26 56 24 41 35 39 13 342
MscI TGG/CCA 17 18 1 1 0 1 2 0 1 0 2
MseI T/TAA 115 195 63 15 41 24 23 32 39 13 207
MslI CAYNN/NNRTG 35 62 3 7 10 10 6 7 9 3 38
MspA1I CMG/CKG 95 75 4 6 14 11 8 10 12 6 35
MspI C/CGG 171 328 18 26 32 25 24 50 35 13 58
MspJI CNNR(9/13)
MwoI GCNNNNN/NNGC 391 347 19 34 33 30 42 41 43 13 170
NaeI GCC/GGC 13 1 1 4 3 0 2 5 5 0 0
NarI GG/CGCC 20 1 1 4 1 1 1 1 4 1 2
Nb.BbvCI CCTCAGC 9 7 2 0 0 0 0 0 0 10
Nb.BsmI GAATGC 10 46 1 1 3 1 1 0 0 15
Nb.BsrDI GCAATG 14 44 3 2 7 4 4 4 2 18
Nb.BssSI CACGAG 11 8 0 3 5 3 2 4 3 31
Nb.BtsI GCAGTG 22 34 1 2 7 5 4 4 3 20
NciI CC/SGG 97 114 4 10 10 13 9 27 15 7 9
NcoI § C/CATGG 20 4 0 0 1 1 3 0 1 0 1
NcoI-HF® C/CATGG 20 4 0 0 1 1 3 0 1 0 1
NdeI CA/TATG 2 7 3 1 1 1 1 1 1 1 7
NgoMIV G/CCGGC 13 1 1 4 3 0 2 5 5 0 0
NheI-HF® G/CTAGC 4 1 0 1 4 0 1 1 0 1
NlaIII CATG/ 183 181 14 26 38 23 21 23 31 11 148
NlaIV GGN/NCC 178 82 18 24 22 14 20 22 30 11 99
NmeAIII GCCGAG(21/19) 17 8 0 3 2 3 2 2 4 1 14
NieI § GC/GGCCGC 7 0 0 0 1 1 1 1 1 0 0
NotI-HF® GC/GGCCGC 7 0 0 0 1 1 1 1 1 0 0
NruI § TCG/CGA 5 5 0 1 1 0 1 1 0 0 3
NruI-HF® TCG/CGA 5 5 0 1 1 0 1 1 0 0 3
NsiI § ATGCA/T 9 14 0 0 6 0 1 0 0 0 8
NsiI-HF® ATGCA/T 9 14 0 0 6 0 1 0 0 0 8
NspI RCATG/Y 41 32 6 4 9 3 5 5 5 3 24
Nt.AlwI GGATC(4/-5) 35 58 3 12 18 12 15 16 10 1
Nt.BbvCI CCTCAGC(-5/-7) 9 7 2 0 0 0 0 0 0 10
Nt.BsmAI GTCTC(1/-5) 60 37 5 3 11 8 8 10 4 95
Nt.BspQI GCTCTTC(1/-7) 7 10 0 1 2 1 1 1 1 4
Nt.BstNBI GAGTC(4/-5) 40 61 8 4 17 5 6 11 10 4 115
Nt.CviPII (0/-1)CCD 4148 4641 570 457 806 570 609 716 729 251 3575
Pas TTAAT/TAA 1 0 1 0 0 0 1 0 0 0 1
PaeR7I C/TCGAG 6 1 0 0 1 0 1 1 0 0 0
PaqCI CACCTGC(4/8) 9 12 0 0 0 0 1 0 0 0 5
PciI A/CATGT 9 2 3 1 3 1 2 1 1 1 6
PflFI GACN/NGTC 12 2 0 1 1 1 1 1 2 0 1
PflMI CCANNNN/NTGG 18 14 0 2 3 1 5 2 2 0 8
PI-PspI TGGCAAACAGCTATTATGGGTATTATGGGT(-13/-17) 0 0 0 0 0 0
PI-SceI ATCTATGTCGGGTGCGGAGAAAGAGGTAAT(-15/-19) 0 0 0 0 0 0
PleI GAGTC(4/5) 40 61 8 4 17 5 6 11 10 4 115
PluTI GGCGC/C
PmeI GTTT/AAAC 1 2 0 0 0 0 1 1 0 0 2
PmlI CAC/GTG 10 3 0 0 0 0 1 0 1 0 1
PpuMI RG/GWCCY 23 3 0 2 1 2 1 0 0 0 12
PshAI GACNN/NGTC 2 7 0 1 1 0 0 1 2 0 6
PsiI-v2 TTA/TAA 4 12 2 0 2 1 1 1 1 0 5
PspGI /CCWGG 136 71 7 6 15 14 19 19 14 5 2
PspOMI G/GGCCC 12 1 0 0 0 1 1 1 1 0 0
PspXI VC/TCGAGB 3 1 0 0 0 0 1 1 0 0 0
PstI § CTGCA/G 30 28 1 1 3 1 4 1 1 1 0
PstI-HF® CTGCA/G 30 28 1 1 3 1 4 1 1 1 0
PvuI § CGAT/CG 7 3 1 1 2 1 1 2 2 0
PvuI-HF® CGAT/CG 7 3 1 1 3 2 1 1 2 2 0
PvuII § CAG/CTG 24 15 3 1 3 3 3 3 4 2 3
PvuII-HF® CAG/CTG 24 15 3 1 3 3 3 3 4 2 3
RsaI GT/AC 83 113 19 3 15 7 14 6 11 3 168
RsrII CG/GWCCG 2 5 0 0 0 1 1 0 0 0 1
SacI § GAGCT/C 16 2 1 0 2 1 2 0 1 1 0
SacI-HF® GAGCT/C 16 2 1 0 2 1 2 0 1 1 0
SacII CCGC/GG 33 4 0 0 2 0 1 1 1 0 0
SalI § G/TCGAC 3 2 1 1 1 1 1 4 1 1 0
SalI-HF® G/TCGAC 3 2 1 1 1 1 1 4 1 1 0
SapI GCTCTTC(1/4) 7 10 0 1 2 1 3 1 1 1 4
Sau3AI /GATC 87 116 6 22 35 23 31 24 29 15 6
Sau96I G/GNCC 164 74 4 15 14 20 21 26 24 6 79
SbfI § CCTGCA/GG 3 5 1 0 1 1 1 0 1 1 0
SbfI-HF® CCTGCA/GG 3 5 1 0 1 1 1 0 1 1 0
ScaI-HF® AGT/ACT 5 5 0 1 2 1 1 2 1 4
ScrFI CC/NGG 233 185 11 16 25 27 28 46 29 12 11
SexAI A/CCWGGT 9 5 0 0 3 0 0 0 0 0 0
SfaNI GCATC(5/9) 85 169 7 22 18 20 17 23 19 8 96
SfcI C/TRYAG 47 38 7 4 9 4 10 6 8 4 48
SfiI GGCCNNNN/NGGCC 3 0 0 0 0 0 1 0 0 0 1
SfoI GGC/GCC 20 1 1 4 1 1 1 1 4 1 2
SgrAI CR/CCGGYG 6 6 0 1 0 0 0 1 1 0 0
SmaI CCC/GGG 12 3 1 0 1 0 1 0 0 1 0
SmlI C/TYRAG 29 17 4 6 8 5 10 8 9 4 75
SnaBI TAC/GTA 0 1 1 0 1 0 1 0 0 0 13
SpeI § A/CTAGT 3 0 0 0 0 0 1 1 1 0 2
SpeI-HF® A/CTAGT 3 0 0 0 0 0 1 1 1 0 2
SphI § GCATG/C 8 6 1 1 2 0 2 2 1 1 0
SphI-HF® GCATG/C 8 6 1 1 2 0 2 2 1 1 0
SrfI GCCC/GGGC
SspI § AAT/ATT 5 20 6 1 6 2 1 3 5 1 6
SspI-HF® AAT/ATT 5 20 6 1 6 2 1 3 5 1 6
StuI AGG/CCT 11 6 0 0 1 0 0 1 1 0 1
StyD4I /CCNGG 233 185 11 16 25 27 28 46 29 12 11
StyI-HF® C/CWWGG 44 10 0 1 4 1 4 2 4 0 36
SwaI ATTT/AAAT 1 0 1 0 0 0 1 1 1 0 1
TaqI-v2 T/CGA 50 121 12 7 32 16 15 22 17 4 111
TfiI G/AWTC 32 87 18 6 14 4 5 5 10 2 103
TseI G/CWGC 179 199 10 21 27 25 20 27 29 12 116
Tsp45I /GTSAC 73 81 9 9 9 7 5 12 13 4 108
TspMI C/CCGGG 12 3 1 0 1 0 1 0 0 1 0
TspRI NNCASTGNN/ 83 119 9 11 22 14 16 16 15 10 94
Tth111I GACN/NGTC 12 2 0 1 1 1 1 1 2 0 1
XbaI T/CTAGA 5 1 1 0 1 0 1 1 1 1 3
XcmI CCANNNNN/NNNNTGG 14 12 0 0 1 3 0 3 4 0 8
XhoI C/TCGAG 6 1 0 0 1 0 1 1 0 0 0
Kersfees C/CCGGG 12 3 1 0 1 0 1 0 0 1 0
XmnI GAANN/NNTTC 5 24 2 2 3 1 3 7 2 1 12
ZraI GAC/GTC 3 10 0 1 0 0 5 1 0 1 1

&sek 'n HF-weergawe van hierdie ensiem is beskikbaar.

* Vir M13mp18 sal slegs dubbelstrengige streke gesny word.
** Verwys na die wilde-tipe DNA-substraat Hind III het 6 beperkingsplekke op die wildtipe lambda-faag-DNS, terwyl NEB se lambda-faagmutant (Lambda DNA, NEB #N3011) 7 Hind III-plekke het.


Kyk die video: Restriction Enzymes - Class 12 (Augustus 2022).