Inligting

1.5: Suur-Basis Balans - Biologie

1.5: Suur-Basis Balans - Biologie


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Leerdoelwitte

Aan die einde van hierdie afdeling sal jy in staat wees om:

  • Identifiseer die kragtigste bufferstelsel in die liggaam
  • Verduidelik die manier waarop die asemhalingstelsel bloed pH beïnvloed

Behoorlike fisiologiese funksionering hang af van 'n baie nou balans tussen die konsentrasies van sure en basisse in die bloed. Suurbalansbalans word gemeet deur die pH-skaal te gebruik, soos getoon in. 'n Verskeidenheid bufferstelsels laat bloed en ander liggaamsvloeistowwe toe om 'n smal pH-reeks te handhaaf, selfs in die lig van versteurings. 'n Buffer is 'n chemiese sisteem wat 'n radikale verandering in vloeistof pH voorkom deur die verandering in waterstofioonkonsentrasies in die geval van oormaat suur of basis te demp. Mees algemeen is die stof wat die ione absorbeer óf 'n swak suur, wat hidroksielione opneem, óf 'n swak basis, wat waterstofione opneem.

Tabel 1. Die pH-skaal
pHVoorbeelde van oplossings
0Batterysuur, sterk fluoorsuur
1Soutsuur afgeskei deur maagvoering
2Suurlemoensap, maagsuur, asyn
3Pomelosap, lemoensap, koeldrank
4Tamatiesap, suurreën
5Sagte drinkwater, swart koffie
6Urine speeksel
7"Suiwer water
8Seewater
9Koeksoda
10Great Salt Lake, melk van magnesia
11Ammoniak oplossing
12Seepwater
13Bleikmiddel, oondskoonmaker
14Vloeibare dreinskoonmaker

Bufferstelsels in die liggaam

Die bufferstelsels in die menslike liggaam is uiters doeltreffend, en verskillende stelsels werk teen verskillende tempo's. Dit neem slegs sekondes vir die chemiese buffers in die bloed om aanpassings aan pH te maak. Die respiratoriese kanaal kan die bloed pH binne minute opwaarts aanpas deur CO uit te asem2 uit die liggaam. Die nierstelsel kan ook bloed pH aanpas deur die uitskeiding van waterstofione (H+) en die bewaring van bikarbonaat, maar hierdie proses neem ure tot dae om 'n effek te hê.

Die bufferstelsels wat in bloedplasma funksioneer, sluit plasmaproteïene, fosfaat, en bikarbonaat- en koolsuurbuffers in. Die niere help om suur-basis balans te beheer deur waterstofione uit te skei en bikarbonaat te genereer wat help om bloedplasma pH binne 'n normale omvang te handhaaf. Proteïenbufferstelsels werk hoofsaaklik binne selle.

Proteïenbuffers in bloedplasma en selle

Byna alle proteïene kan as buffers funksioneer. Proteïene bestaan ​​uit aminosure, wat positief gelaaide aminogroepe en negatief gelaaide karboksielgroepe bevat. Die gelaaide streke van hierdie molekules kan waterstof- en hidroksielione bind, en funksioneer dus as buffers. Buffer deur proteïene is verantwoordelik vir twee derdes van die bufferkrag van die bloed en die meeste van die buffering binne selle.

Hemoglobien as 'n buffer

Hemoglobien is die hoofproteïen binne-in rooibloedselle en is verantwoordelik vir een derde van die massa van die sel. Tydens die omskakeling van CO2 in bikarbonaat word waterstofione wat in die reaksie vrygestel word, gebuffer deur hemoglobien, wat verminder word deur die dissosiasie van suurstof. Hierdie buffering help om normale pH te handhaaf. Die proses word omgekeer in die pulmonêre kapillêre om CO te hervorm2, wat dan in die lugsakke kan diffundeer om in die atmosfeer uitgeasem te word. Hierdie proses word breedvoerig in die hoofstuk oor die respiratoriese stelsel bespreek.

Bikarbonaat-koolstofsuurbuffer

Die bikarbonaat-koolsuurbuffer werk op 'n manier soortgelyk aan fosfaatbuffers. Die bikarbonaat word in die bloed deur natrium gereguleer, so ook die fosfaatione. Wanneer natriumbikarbonaat (NaHCO3), kom in kontak met 'n sterk suur, soos HCl, koolsuur (H2CO3), wat 'n swak suur is, en NaCl word gevorm. Wanneer koolsuur in aanraking kom met 'n sterk basis, soos NaOH, word bikarbonaat en water gevorm.




Soos met die fosfaatbuffer, vang 'n swak suur of swak basis die vrye ione op, en 'n beduidende verandering in pH word voorkom. Bikarbonaatione en koolsuur is teenwoordig in die bloed in 'n verhouding van 20:1 as die bloed pH binne die normale omvang is. Met 20 keer meer bikarbonaat as koolsuur, is hierdie vangstelsel die doeltreffendste om veranderinge te buffer wat die bloed suurder sal maak. Dit is nuttig omdat die meeste van die liggaam se metaboliese afvalstowwe, soos melksuur en ketone, sure is. Koolstofsuurvlakke in die bloed word beheer deur die verstryking van CO2 deur die longe. In rooibloedselle dwing koolstofanhidrase die dissosiasie van die suur af, wat die bloed minder suur maak. As gevolg van hierdie suur dissosiasie, CO2 word uitgeasem (sien vergelykings hierbo). Die vlak van bikarbonaat in die bloed word beheer deur die nierstelsel, waar bikarbonaatione in die nierfiltraat bewaar word en terug in die bloed oorgedra word. Die bikarbonaatbuffer is egter die primêre bufferstelsel van die IF wat die selle in weefsels regdeur die liggaam omring.

Respiratoriese regulering van suur-basis-balans

Die asemhalingstelsel dra by tot die balans van sure en basisse in die liggaam deur die bloedvlakke van koolsuur te reguleer. CO2 in die bloed reageer geredelik met water om koolsuur te vorm, en die vlakke van CO2 en koolsuur in die bloed is in ewewig. Wanneer die CO2 vlak in die bloed styg (soos wanneer jy jou asem ophou), die oortollige CO2 reageer met water om bykomende koolsuur te vorm, wat bloed pH verlaag. Deur die tempo en/of diepte van asemhaling te verhoog (wat jy dalk die "drang" kan voel om te doen nadat jy jou asem opgehou het) laat jou toe om meer CO uit te asem2. Die verlies van CO2 van die liggaam verminder bloedvlakke van koolsuur en verstel daardeur die pH opwaarts, na normale vlakke. Soos jy dalk kon vermoed, werk hierdie proses ook in die teenoorgestelde rigting. Oormatige diep en vinnige asemhaling (soos in hiperventilasie) verwyder die bloed van CO2 en verlaag die vlak van koolsuur, wat die bloed te alkalies maak. Hierdie kort alkalose kan reggestel word deur lug wat uitgeasem is in 'n papiersak weer in te asem. As u uitgeasemde lug weer inasem, sal die pH van die bloed vinnig na normaal verlaag.

Die chemiese reaksies wat die vlakke van CO reguleer2 en koolsuur kom in die longe voor wanneer bloed deur die long se pulmonêre kapillêre beweeg. Geringe aanpassings in asemhaling is gewoonlik voldoende om die pH van die bloed aan te pas deur die hoeveelheid CO te verander2 word uitgeasem. Trouens, verdubbeling van die respiratoriese tempo vir minder as 1 minuut, wat "ekstra" CO verwyder2, sou die bloed pH met 0,2 verhoog. Hierdie situasie is algemeen as jy oor 'n tydperk strawwe oefen. Om die nodige energieproduksie vol te hou, sal jy oortollige CO produseer2 (en melksuur as jy buite jou aërobiese drempel oefen). Om die verhoogde suurproduksie te balanseer, gaan die respirasietempo op om die CO te verwyder2. Dit help om te verhoed dat jy asidose ontwikkel.

Die liggaam reguleer die respiratoriese tempo deur die gebruik van chemoreseptore, wat hoofsaaklik CO gebruik2 as 'n sein. Perifere bloedsensors word gevind in die wande van die aorta en karotis arteries. Hierdie sensors sein die brein om onmiddellike aanpassings aan die respiratoriese tempo te verskaf as CO2 vlakke styg of daal. Nog ander sensors word in die brein self gevind. Veranderinge in die pH van CSF beïnvloed die respiratoriese sentrum in die medulla oblongata, wat asemhalingstempo direk kan moduleer om die pH terug te bring na die normale omvang.

Hiperkapnie, of abnormaal verhoogde bloedvlakke van CO2, kom voor in enige situasie wat respiratoriese funksies benadeel, insluitend longontsteking en kongestiewe hartversaking. Verminderde asemhaling (hipoventilasie) as gevolg van dwelms soos morfien, barbiturate of etanol (of selfs om net asem op te hou) kan ook hiperkapnie tot gevolg hê. Hipokapnie, of abnormaal lae bloedvlakke van CO2, kom voor met enige oorsaak van hiperventilasie wat die CO afdryf2, soos salisilaattoksisiteit, verhoogde kamertemperature, koors of histerie.

Renale regulering van suur-basisbalans

Die nierregulering van die liggaam se suur-basis-balans spreek die metaboliese komponent van die bufferstelsel aan. Terwyl die asemhalingstelsel (tesame met asemhalingsentrums in die brein) die bloedvlakke van koolsuur beheer deur die uitaseming van CO2 te beheer2, die nierstelsel beheer die bloedvlakke van bikarbonaat. 'n Afname in bloedbikarbonaat kan die gevolg wees van die inhibisie van koolsuuranhidrase deur sekere diuretika of van oormatige bikarbonaatverlies as gevolg van diarree. Bloedbikarbonaatvlakke is ook tipies laer by mense met Addison se siekte (chroniese bynierinsufficiëntie), waarin aldosteroonvlakke verlaag word, en by mense wat nierskade het, soos chroniese nefritis. Laastens kan lae bikarbonaatbloedvlakke die gevolg wees van verhoogde vlakke van ketone (algemeen in onbestuurde diabetes mellitus), wat bikarbonaat in die filtraat bind en die bewaring daarvan voorkom.

Bikarbonaatione, HCO3, wat in die filtraat gevind word, is noodsaaklik vir die bikarbonaatbufferstelsel, tog is die selle van die buis nie deurlaatbaar vir bikarbonaatione nie. Die stappe betrokke by die verskaffing van bikarbonaatione aan die stelsel word in die vorige diagram gesien en word hieronder opgesom:

  • Stap 1: Natriumione word uit die filtraat herabsorbeer in ruil vir H+ deur 'n antipoortmeganisme in die apikale membrane van selle wat die nierbuisie beklee.
  • Stap 2: Die selle produseer bikarbonaatione wat na peritubulêre kapillêre geskuif kan word.
  • Stap 3: Wanneer CO2 beskikbaar is, word die reaksie gedryf tot die vorming van koolsuur, wat dissosieer om 'n bikarbonaatioon en 'n waterstofioon te vorm.
  • Stap 4: Die bikarbonaatioon gaan in die peritubulêre kapillêre in en keer terug na die bloed. Die waterstofioon word in die filtraat afgeskei, waar dit deel kan word van nuwe watermolekules en as sodanig herabsorbeer kan word, of in die urine verwyder kan word.

Dit is ook moontlik dat soute in die filtraat, soos sulfate, fosfate of ammoniak, waterstofione sal opvang. As dit gebeur, sal die waterstofione nie beskikbaar wees om met bikarbonaatione te kombineer en CO te produseer nie2. In sulke gevalle word bikarbonaatione nie van die filtraat na die bloed bewaar nie, wat ook sal bydra tot 'n pH-wanbalans en asidose.

Die waterstofione kompeteer ook met kalium om met natrium in die nierbuisies uit te ruil. As meer kalium teenwoordig is as normaal, sal kalium, eerder as die waterstofione, uitgeruil word, en verhoogde kalium kom die filtraat binne. Wanneer dit gebeur, neem minder waterstofione in die filtraat deel aan die omskakeling van bikarbonaat na CO2 en minder bikarbonaat word bewaar. As daar minder kalium is, gaan meer waterstofione die filtraat binne om met natrium uitgeruil te word en meer bikarbonaat word bewaar.

Chloriedione is belangrik om positiewe ioonladings in die liggaam te neutraliseer. As chloried verlore gaan, gebruik die liggaam bikarbonaatione in die plek van die verlore chloriedione. Verlore chloried lei dus tot 'n verhoogde herabsorpsie van bikarbonaat deur die nierstelsel.

Versteurings van die suur-basisbalans: Ketoasidose

Diabetiese asidose, of ketoasidose, kom die meeste voor by mense met swak beheerde diabetes mellitus. Wanneer sekere weefsels in die liggaam nie voldoende hoeveelhede glukose kan kry nie, is hulle afhanklik van die afbreek van vetsure vir energie. Wanneer asetielgroepe die vetsuurkettings afbreek, kombineer die asetielgroepe dan nie-ensiematies om ketoonliggame, asetoasynsuur, beta-hidroksibottersuur en asetoon te vorm, wat almal die suurheid van die bloed verhoog. In hierdie toestand word die brein nie voorsien van genoeg van sy brandstof—glukose—om al die ATP te produseer wat dit benodig om te funksioneer nie.

Ketoasidose kan ernstig wees en, indien dit nie behoorlik opgespoor en behandel word nie, kan dit lei tot diabetiese koma, wat dodelik kan wees. ’n Algemene vroeë simptoom van ketoasidose is diep, vinnige asemhaling soos die liggaam probeer om CO af te dryf2 en kompenseer vir die asidose. Nog 'n algemene simptoom is vrugtige asem, as gevolg van die uitaseming van asetoon. Ander simptome sluit in droë vel en mond, 'n blosende gesig, naarheid, braking en maagpyn. Behandeling vir diabetiese koma is inname of inspuiting van suiker; die voorkoming daarvan is die behoorlike daaglikse toediening van insulien.

'n Persoon wat diabeet is en insulien gebruik, kan ketoasidose inisieer as 'n dosis insulien gemis word. Onder mense met tipe 2-diabetes is dié van Spaanse en Afro-Amerikaanse afkoms meer geneig om in ketoasidose te gaan as dié van ander etniese agtergronde, hoewel die rede hiervoor onbekend is.

Hoofstuk hersiening

'n Verskeidenheid bufferstelsels bestaan ​​in die liggaam wat help om die pH van die bloed en ander vloeistowwe binne 'n smal reeks te handhaaf - tussen pH 7.35 en 7.45. 'n Buffer is 'n stof wat 'n radikale verandering in vloeistof pH voorkom deur oortollige waterstof of hidroksielione te absorbeer. Mees algemeen is die stof wat die ioon absorbeer óf 'n swak suur, wat 'n hidroksielioon (OH) opneem), of 'n swak basis, wat 'n waterstofioon opneem (H+). Verskeie stowwe dien as buffers in die liggaam, insluitend sel- en plasmaproteïene, hemoglobien, fosfate, bikarbonaatione en koolsuur. Die bikarbonaatbuffer is die primêre bufferstelsel van die IF wat die selle in weefsels regdeur die liggaam omring. Die respiratoriese en nierstelsels speel ook 'n groot rol in suur-basis homeostase deur CO2 te verwyder2 en waterstofione, onderskeidelik, uit die liggaam.

Selfkontrole

Beantwoord die onderstaande vrae om te sien hoe goed u die onderwerpe in die vorige afdeling verstaan.

Vrae oor kritiese denke

  1. Beskryf die behoud van bikarbonaatione in die nierstelsel.
  2. Beskryf die beheer van bloedkoolsuurvlakke deur die respiratoriese stelsel.

[reveal-answer q=”635497″]Wys antwoorde[/reveal-answer]
[verborge-antwoord a="635497″]

  1. Bikarbonaatione word vrylik deur die glomerulus gefiltreer. Hulle kan nie vrylik in die nierbuisselle ingaan nie en moet in CO omgeskakel word2 in die filtraat, wat deur die selmembraan kan gaan. Natriumione word by die membraan herabsorbeer, en waterstofione word in die filtraat uitgestoot. Die waterstofione kombineer met bikarbonaat en vorm koolsuur, wat dissosieer in CO2 gas en water. Die gas diffundeer na die nierselle waar koolstofanhidrase die omskakeling daarvan terug in 'n bikarbonaat-ioon kataliseer, wat die bloed binnedring.
  2. Koolstofsuur bloedvlakke word deur die respiratoriese stelsel beheer deur die uitsetting van CO2 uit die longe. Die formule vir die produksie van bikarbonaatione is omkeerbaar as die konsentrasie CO2 afneem. Soos dit in die longe gebeur, word koolsuur in 'n gas omgeskakel, en die konsentrasie van die suur neem af. Die tempo van asemhaling bepaal die hoeveelheid CO2 uitgeasem. As die tempo toeneem, is minder suur in die bloed; as die tempo afneem, kan die bloed suurder word.

[/hidden-answer]

Woordelys

hiperkapnie: abnormaal verhoogde bloedvlakke van CO2

hipokapnie: abnormaal lae bloedvlakke van CO2


Henderson-Hasselbalch Vergelyking

Elke klinikus wat met suur-basis-abnormaliteite te doen het, is vertroud met die Henderson-Hasselbalch-vergelyking, waarskynlik die bekendste vergelyking in biologie. Ongelukkig is die meeste klinici nie bewus van die beperkings van hierdie vergelyking nie: Dit bevat 'n aantal anomalieë en is meer beskrywend as meganisties.

Die tradisionele benadering vir die assessering van suur-basis balans fokus op hoe plasma koolstofdioksied spanning (P co 2), plasmabikarbonaatkonsentrasie ([HCO3 − ]), die negatiewe logaritme van die skynbare dissosiasiekonstante (pK1′) vir koolsuur (H2CO3) in plasma, en die oplosbaarheid (S) van CO2 in plasma interaksie om plasma pH te bepaal. Die ewewigsreaksie is soos volg:

By ewewig kan die verwantskap uitgedruk word as die Henderson-Hasselbalch-vergelyking, soos volg 2, 14 :

Die Henderson-Hasselbalch-vergelyking het van onskatbare waarde bewys om die begrip van soogdier-suur-basis-fisiologie te help en word gereeld gebruik in die behandeling van suur-basis-abnormaliteite. Met die tradisionele Henderson-Hasselbalch-benadering is die volgende primêre suur-basis-versteurings gedefinieer (Fig. 111-1 en 111-2) 15 :

Respiratoriese asidose (verhoogde P co 2)

Respiratoriese alkalose (verlaagde P co 2)

Metaboliese asidose (verminderde ekstrasellulêre basisoormaat, werklike HCO3 − konsentrasie, of standaard HCO3 − [bikarbonaatkonsentrasie onder standaardtoestande])

Metaboliese alkalose (verhoogde ekstrasellulêre basisoormaat, werklike HCO3 − konsentrasie, of standaard HCO3 − )

Dit was reeds in 1922 duidelik dat ander faktore as P co 2, [HCO3 − ], blK1", en S plasma pH beïnvloed. 16 In 1925, blK1Daar is getoon dat ′ (en dus pH) beïnvloed word deur ioniese sterkte (μ) 17 en temperatuur, 18 die ΔpK1′/ΔT is −0,005 eenhede/° C oor 'n temperatuurreeks van 20° tot 38° C. Daar is verwag dat pK1′, soos alle ewewigskonstantes gebaseer op molaliteite, sal verander word deur veranderinge in ioniese sterkte en temperatuur. Daar is egter onverwags gevind dat die gemete ΔpH/ΔT van plasma −0,015 tot −0,020 eenhede/° C was, 'n waarde drie tot vier keer die −0,005 eenhede/° C voorspel deur pK1". 6 Hierdie bevinding toon dat die Henderson-Hasselbalch-vergelyking nie akkuraat toegepas kan word op soogdierbloed wat in vitro afgekoel is of op poikilotermiese diere nie.

Bepaling van akkurate blK1′ waardes vir plasma was meer problematies, omdat die eksperimentele waarde vir pK1′ (die skynbare dissosiasiekonstante) in plasma verskil marginaal van die waarde wat in waterige nieplasma-oplossings verkry word. 'n Aantal studies het getoon dat die waarde vir pK1′ in plasma word beïnvloed deur pH, proteïenkonsentrasie en natriumkonsentrasie. 19–22 Alhoewel hierdie waarnemings die meeste ondersoekers gekwel het, het die waarde vir blK1′ in plasma word gereeld aangepas deur die gebruik van nomogramme, tabelle of polinoomvergelykings om rekening te hou met veranderinge in plasma pH, proteïenkonsentrasie en natriumkonsentrasie. Die meganistiese basis vir hierdie aanpassings is tans onbekend.

Die waarde vir pK1′ by 'n ioniese sterkte van 0.16 (soogdier ekstrasellulêre vloeistof) word verkry uit die som van pKs (die skynbare dissosiasiekonstante) (6.029 by 37° C) 19 en die negatiewe logaritme van die aktiwiteitskoëffisiënt van die waterstofioon (0.091), 22 wat 'n waarde van 6.120 by 37° C produseer. Die waarde vir pK1′ moet slegs vir temperatuur en ioniese sterkte gekorrigeer word wanneer dit op biologiese vloeistowwe toegedien word. Die waarde wat gebruik word vir S in plasma by 37°C is 0,0307 mm Hg −1 S wissel met ioniese sterkte, temperatuur en proteïenkonsentrasie, en akkurate waardes is beskikbaar vir soogdierplasma. 23

Omdat die Henderson-Hasselbalch-vergelyking nie die temperatuurafhanklikheid van plasma pH of vir die oënskynlike afhanklikheid van p bevredigend verantwoord nie.K1′ in plasma op pH, proteïenkonsentrasie en natriumkonsentrasie, kan die benadering akkuraat toegepas word op slegs soogdierbloed by normale liggaamstemperature en ongeveer normale pH, proteïenkonsentrasie en natriumkonsentrasie. Die empiriese aard van die aanpassings aan die waarde van pK1′ in plasma dui daarop dat die Henderson-Hasselbalch-vergelyking meer beskrywend as meganisties is. 'n Meer meganistiese benadering is dus wenslik, en sterk ioonverskil teorie verskaf so 'n model.


1.5: Suur-Basis Balans - Biologie

Elektroliete speel 'n belangrike rol in die handhawing van homeostase in die liggaam.

Leerdoelwitte

Identifiseer die belangrikheid van natrium en vloeistof/elektrolietbalans

Belangrike wegneemetes

Kern punte

  • Elektroliete help om miokardiale en neurologiese funksies, vloeistofbalans, suurstoflewering, suur-basis-balans, en nog baie meer te reguleer.
  • Die ernstigste elektrolietversteurings behels abnormaliteite in die vlakke van natrium, kalium en/of kalsium.
  • Die niere werk om die elektrolietkonsentrasies in die bloed konstant te hou ten spyte van veranderinge in die liggaam.

Sleutel terme

  • homeostase: Die vermoë van 'n sisteem of lewende organisme om sy interne omgewing aan te pas om 'n stabiele ewewig te handhaaf soos die vermoë van warmbloedige diere om 'n konstante temperatuur te handhaaf.
  • elektroliet: Enige van die verskillende ione (soos natrium of chloried) wat die elektriese lading op selle en die vloei van water oor hul membrane reguleer.
  • natrium: 'n Chemiese element met simbool Na (van Latyn: natrium) en atoomgetal 11. Dit is 'n sagte, silwerwit, hoogs reaktiewe metaal en is 'n lid van die alkalimetale.

Belangrikheid van elektrolietbalans

Elektroliete speel 'n belangrike rol in die handhawing van homeostase in die liggaam. Hulle help om miokardiale en neurologiese funksie, vloeistofbalans, suurstoflewering, suur-basis-balans en ander biologiese prosesse te reguleer.

Elektroliete is belangrik omdat dit is wat selle (veral dié van die senuwee, hart en spiere) gebruik om spanning oor hul selmembrane te handhaaf en om elektriese impulse (senuwee-impulse, spiersametrekkings) oor hulself en na ander selle te dra.

Elektrolietwanbalanse kan ontwikkel as gevolg van oormatige of verminderde inname en uit die oormatige of verminderde eliminasie van 'n elektroliet. Die mees algemene oorsaak van elektrolietversteurings is nierversaking. Die ernstigste elektrolietversteurings behels abnormaliteite in die vlakke van natrium, kalium en/of kalsium.

Ander elektrolietwanbalanse is minder algemeen, en kom dikwels voor saam met groot elektrolietveranderinge. Chroniese lakseermiddelmisbruik of erge diarree of braking (gastro-enteritis) kan lei tot elektrolietversteurings gekombineer met dehidrasie. Mense wat aan bulimie of anorexia nervosa ly, loop veral 'n hoë risiko vir 'n elektrolietwanbalans.

Die niere werk om die elektrolietkonsentrasies in die bloed konstant te hou ten spyte van veranderinge in jou liggaam. Byvoorbeeld, tydens swaar oefening gaan elektroliete verlore deur sweet, veral natrium en kalium, en sweet kan die behoefte aan elektroliet (sout) vervanging verhoog. Dit is nodig om hierdie elektroliete te vervang om hul konsentrasies in die liggaamsvloeistowwe konstant te hou.

Dehidrasie

Daar is drie tipes dehidrasie:

  1. Hipotonies of hiponatremies (hoofsaaklik 'n verlies aan elektroliete, veral natrium).
  2. Hipertonies of hipernatremies (hoofsaaklik 'n verlies aan water).
  3. Isotonies of isonatremies ('n gelyke verlies aan water en elektroliete).

By mense is die mees algemene tipe dehidrasie verreweg isotoniese (isonatremiese) dehidrasie wat effektief gelykstaande is aan hipovolemie, maar die onderskeid van isotoniese van hipotoniese of hipertoniese dehidrasie kan belangrik wees wanneer mense met dehidrasie behandel word.

Fisiologies, en ten spyte van die naam, beteken dehidrasie nie bloot verlies van water nie, aangesien beide water en opgeloste stowwe (hoofsaaklik natrium) gewoonlik in ongeveer gelyke hoeveelhede verlore gaan met betrekking tot hoe hulle in bloedplasma voorkom. In hipotoniese dehidrasie skuif intravaskulêre water na die ekstravaskulêre ruimte en oordryf die intravaskulêre volume-uitputting vir 'n gegewe hoeveelheid totale liggaamswaterverlies.

Neurologiese komplikasies kan voorkom in hipotoniese en hipertoniese toestande. Eersgenoemde kan lei tot aanvalle, terwyl laasgenoemde kan lei tot osmotiese serebrale edeem by vinnige rehidrasie.

In meer ernstige gevalle word die regstelling van 'n gedehidreerde toestand bewerkstellig deur die aanvulling van nodige water en elektroliete (deur orale rehidrasieterapie of vloeistofvervanging deur binneaarse terapie). Aangesien orale rehidrasie minder pynlik, minder indringend, goedkoper en makliker is om te verskaf, is dit die voorkeurbehandeling vir ligte dehidrasie. Oplossings wat vir binneaarse rehidrasie gebruik word, moet isotonies of hipotonies wees.

Selelektroliete: Hierdie diagram illustreer die meganisme vir die vervoer van water en elektroliete oor die epiteelselle in die sekretoriese kliere.


Diagnose van hipokalemie: 'n probleemoplossende benadering tot kliniese gevalle

In situasies waar die oorsaak van hipokalemie nie duidelik is nie, is meting van urinêre kaliumuitskeiding en bloeddruk en assessering van suur-basis balans dikwels nuttig. 'n Ewekansige urine-kalium-kreatinienverhouding (K/C) minder as 1,5 dui op swak inname, gastro-intestinale verliese of 'n verskuiwing van kalium in selle. As hipokalemie met verlamming geassosieer word, moet ons hipertireose, familiële of sporadiese periodieke verlamming oorweeg. Metaboliese asidose met 'n urine K/C-verhouding van minder as 1,5 dui op laer gastro-intestinale verliese as gevolg van diarree of misbruik van lakseermiddels. Metaboliese asidose met 'n K/C-verhouding van 1,5 hoër is dikwels as gevolg van diabetiese ketoasidose of tipe 1 of tipe 2 distale renale tubulêre asidose. Metaboliese alkalose met 'n K/C-verhouding van minder as 1,5 en 'n normale bloeddruk is dikwels as gevolg van sluikbrake. Metaboliese alkalose met 'n hoër K/C-verhouding en 'n normale bloeddruk dui op diuretiese gebruik, Bartter-sindroom of Gitelman-sindroom. Metaboliese alkalose met 'n hoë urine K/C-verhouding en hipertensie dui op primêre hiperaldosteronisme, Cushing-sindroom, aangebore bynierhiperplasie, renale arteriestenose, oënskynlike mineralokortikoïed oormaat, of Liddle-sindroom. Hipomagnesemie kan lei tot verhoogde urinêre kaliumverliese en hipokalemie. Die differensiaal berus op meting van bloedmagnesium-, aldosteroon- en renienvlakke, diuretiese sifting in urine, reaksie op spironolaktoon en amiloried, meting van plasmakortisolvlak en die urinêre kortisol-kortisoonverhouding, en genetiese toetsing.


Kliniese betekenis

Metaboliese alkalose is 'n relatief algemene diagnose in medisyne. Die biologiese effekte van metaboliese alkalose is direk die gevolg van gepaardgaande probleme soos hipovolemie en kalium- en chlorieduitputting. Hierdie veranderinge lei tot verminderde miokardiale kontraktiliteit, aritmieë, verminderde serebrale bloedvloei, verwarring, verhoogde neuromuskulêre prikkelbaarheid en verswakte perifere suurstofontlading sekondêr tot die verskuiwing van die suurstofdissosiasiekurwe na links.  Daarbenewens is daar 'n kompenserende toename in arteriële pCO deur hipoventilasie. In die algemeen is daar 'n netto effek op die liggaam wat lei tot hipoksie.

Klinies is dit belangrik om die verwantskappe tussen koolstofdioksied en bikarbonaat in die bufferstelsel te verstaan ​​en om die interaksies van hoe hierdie komponente gereguleer word te verstaan. Daarbenewens is dit noodsaaklik om die meganisme te verstaan ​​waardeur natrium, kalium en waterstof funksioneer om pH te moduleer wanneer hierdie ioonkanale met medikasie verander word. Daarom is die behandeling van chloried-weerstandige metaboliese alkalose gefokus op die behandeling van die onderliggende toestand wat die alkalotiese gebeurtenis veroorsaak het. Aangesien baie van hierdie patologieë die gevolg is van die effek op die renien-angiotensien-aldosteroonstelsel, sluit behandeling die inhibering van die effek van aldosteroon op die nefron in met behulp van kaliumbesparende diuretika soos amiloried en triamterene. Daarbenewens moet 'n ondersoek na 'n kwaadaardige bron oorweeg word, soos met primêre hiperaldosteronisme en Conn-sindroom. In chloried-responsiewe metaboliese alkalose sluit dit die aanvulling van elektroliete in, spesifiek chloried en kalium saam met die aanvulling van vloeistof. In scenario's, soos kongestiewe hartversaking (CHF) of edematiese toestande, is diurese noodsaaklik met behulp van kaliumbesparende diuretika.[12][13]


BESPREKING

Hierdie VNBE het bewys dat dit 'n suksesvolle laboratorium-eksperiment is wat die bioveiligheidskwessies van urineversameling, hantering en wegdoening vermy en kan maklik in baie biochemie-kursusse vir veelvuldige strome van groot klasse gebruik word. Dit is van belang dat ander oefeninge met behulp van gesimuleerde urine beskryf is [11, 12] dit vermy ook enige moontlike gesondheidsrisiko's en oorkom etiese kwessies van die gebruik van diere vir onderrig. In een oefening [12] is guarurine, 'n gesimuleerde urine wat verskeie vlakke van glukose en ketone bevat wat verteenwoordigend van verskillende pasiënte bevat, voorgestel om urine-analise van diabete te leer. In die ander [11] word monsters gesimuleer om effekte van suur-basis-balans na te boots en studente bepaal titreerbare suurheid. Ons voorsien dat hierdie oefeninge saam met ons s'n die basis kan vorm van 'n omvattende reeks gesimuleerde oefeninge wat baie aspekte van metabolisme dek.

Nog 'n voordeel van hierdie VNBE is dat dit die inherente foute van skatting van dieetproteïen-inname uit dieetrekords en in die versameling van 24-uur-urienmonsters vermy. Ons het gevind dat in klaseksperimente hierdie foute uiters moeilik was om te minimaliseer en te beheer. Die VNBE oorkom die frustrasies wat studente voorheen gehad het met die bepaling van stikstofbalans met voldoende akkuraatheid om sinvolle gevolgtrekkings te maak. Die akkuraatheid waarmee studente dieselfde waarde vir 'n enkele steekproef kon verkry, was nie baie hoog nie, selfs vir die VNBE soos aangetoon deur 'n mediaan variasiekoëffisiënt van 17% (reeks 8–33%), en is waarskynlik 'n weerspieëling van die onervarenheid van die studente met hierdie nuwe tegnieke.


Diagnose van Metaboliese Suur�se versteurings in kritiek siek pasiënte

Ons vergelyk twee algemeen gebruikte diagnostiese benaderings, een wat staatmaak op plasmabikarbonaatkonsentrasie en "anioongaping," die ander op "basisoormaat," met 'n derde metode gebaseer op fisies-chemiese beginsels, vir hul waarde in die opsporing van komplekse metaboliese suur-basis-versteurings. Ons het arteriële bloedmonsters van 152 pasiënte en nege normale proefpersone ontleed vir pH, P co 2, en konsentrasies van plasma elektroliete en proteïene. Ses-en-negentig persent van die pasiënte het serumalbumienkonsentrasie ⩽ 3 SD onder die gemiddelde van die kontrolepersone gehad. By ongeveer een sesde van die pasiënte was die oormaat basis en plasmabikarbonaat normaal. In 'n groot meerderheid van hierdie oënskynlik normale monsters, het die derde metode gelyktydige teenwoordigheid van versurende en alkaliserende steurnisse opgespoor, baie van hulle ernstig. Die byna alomteenwoordige hipoalbuminemie het die interpretasie van suur-basis data verwar toe die gebruiklike benaderings toegepas is. Basiese oormaat het ernstige suur-basis abnormaliteite in ongeveer een sesde van die pasiënte gemis, hierdie metode misluk wanneer die plasmakonsentrasies van die nie-bikarbonaatbuffers (hoofsaaklik albumien) abnormaal is. Anioongaping het 'n versteekte "gapingasidose" opgespoor in slegs 31% van daardie monsters met normale plasmabikarbonaat waarin sulke asidose gediagnoseer is deur die derde metode toe aangepas vir hipoalbuminemie, dit het die verborge abnormale anione betroubaar opgespoor. Die voorgestelde derde metode identifiseer en kwantifiseer individuele komponente van komplekse suur-basis abnormaliteite en verskaf insigte in hul patogenese.

Twee diagnostiese stelsels word algemeen gebruik vir die interpretasie van suur-basis data. Een sentreer op plasmabikarbonaatkonsentrasie ([HCO3 − ]) (1) en “anioongaping” (AG) (2), en die ander op “basisoorskot/tekort” (BE) (3). Hierdie twee stelsels skryf nie 'n eksplisiete rol toe aan abnormale konsentrasies van plasma-nie-bikarbonaatbuffers in die patogenese van nierespiratoriese (metaboliese) suur-basis abnormaliteite nie. Ons beweer dat, as gevolg van hierdie weglating, belangrike metaboliese suur-basis abnormaliteite gemis kan word in die komplekse versteurings wat by kritiek siek pasiënte gesien word.

Die belangrikste "nie-bikarbonaatbuffers" in bloedplasma is die plasmaproteïene (4), 'n ander (klein) komponent van hierdie bufferstelsel is anorganiese fosfaat (Pi) (5). Onder die plasmaproteïene is dit die serumalbumien wat deelneem aan die chemiese ewewigte wat die suur-basis-status van plasma bepaal deur 'n veranderlike netto negatiewe lading te dra by pH-waardes wat versoenbaar is met lewe (6, 7). Omdat hierdie negatiewe lading in die elektroneutraliteit van plasma figureer, kan die amfiprotiese molekule van albumien beskou word as 'n nie-vlugtige swak suur in plasma se chemiese ewewigte. Normale serumglobuliene dra nie 'n beduidende netto elektriese lading by pH-waardes wat in plasma heers nie (6, 7).

Hipoalbuminemie is 'n algemene bevinding in kritiek siek pasiënte (8) dit kan die gebruiklike interpretasie van suur-basis-data verwar, as gevolg van die bydrae van albumien tot plasma se suur-basis-ewewigte. In die besonder, in die diagnostiese stelsel staatmaak op plasma [HCO3 − ], is dit bekend dat hipoalbuminemie onsekerheid veroorsaak in die interpretasie van die AG (2, 9-11) as AG aangepas word vir abnormale albumienkonsentrasie (12, 13), moet die bruikbaarheid daarvan verbeter (14). Met die BE-benadering (3) word geen onderskeid getref tussen 'n tekort/oormaat swak of sterk nie-vlugtige sure (11) daarom kan die alkaliserende effek van hipoalbuminemie (= tekort aan 'n swak nie-vlugtige suur) 'n oormaat van ongemeet anione (soos laktaat of ketosure).

Ons bied 'n derde stelsel van evaluering van alle primêre oorsake van suur-basis abnormaliteite in plasma (7, 15, 16). Dit pas Stewart se benadering tot suur-basis-chemie toe (17) en is gebaseer op 'n wiskundige model van plasma wat deur eksperimente bekragtig is in vitro (6, 7) dit word in M ​​etods uiteengesit en elders in detail beskryf (15). Deur kliniese data van kritiek siek pasiënte te gebruik, vergelyk ons ​​die drie diagnostiese benaderings vir hul vermoë om komplekse metaboliese suur-basis-abnormaliete wat by sulke pasiënte gesien word, op te spoor, te karakteriseer en te kwantifiseer.

Die studie is goedgekeur deur die Toelaekomitee van die Ministerie van Gesondheid, Tsjeggiese Republiek. Arteriële bloedmonsters is geneem van nege gesonde proefpersone in die postprandiale toestand (5 mans, 4 vroue, ouderdom 20 tot 25 jr) het almal skriftelike ingeligte toestemming gegee. Die pasiëntdata is enkelmetings in 152 pasiënte in die intensiewe sorgeenheid (ICU) van die Fakulteitshospitaal Bulovka in Praag (37% met trauma, insluitend kranioserebrale trauma 20% met akute respiratoriese noodsindroom [ARDS] en verwante toestande, die meeste van hulle meganies geventileer 18% met kardiovaskulêre versaking, insluitend akute miokardiale infarksie, kardiopulmonêre resussitasie 16% met postoperatiewe komplikasies, insluitend sepsis, nier- en veelvuldige orgaanversaking 9% met metaboliese versteurings, insluitend diabetiese ketoasidose en dronkenskap. Arteriële bloedgasse, serumelektroliete en proteïene is in dieselfde bloedmonster gemeet. Die rou data is deel van 'n databasis wat vir 'n ander studie gedien het (12).

pH en P co 2 is gemeet met die ABL300 Bloedgas Ontleder (Radiometer) of met die AVL 990 ontleder. Monsters van geskeide plasma is ontleed vir Na en K (FLM3 vlamfotometer, Radiometer), Ca en Mg (atoomabsorpsiespektrofotometer AAS2, Zeiss), Cl - (Chloried Titrator CMT10, Radiometer), anorganiese fosfaat met molibdaat, totale proteïen met biuret, en serumalbumien met bromcresyl-pers fotometrieë.

Van die gemete pH en P co 2 ons het [HCO3 − ] met behulp van die Henderson-Hasselbalch-vergelyking, en BE met Siggaard-Andersen se formules vir BE in plasma en in ekstrasellulêre vloeistof (18). Anioongaping is bereken as ([Na + ]+[K + ]) − ([Cl − ]+[HCO3 − ]), en aangepas vir die effek van abnormale albumienkonsentrasie met die formule: AGaangepaste (millie-ekwivalente per liter) = AGwaargeneem + 0,25 × ([normale albumien] − [waargenome albumien]) (in gram per liter) (12, 13).

Suur-basis toestand in 'n liggaamsvloeistof word fisies bepaal deur verskeie "onafhanklike veranderlikes" (veranderlikes wat hoofsaaklik en onafhanklik van mekaar kan verander). In bloedplasma in vivo, die onafhanklike veranderlikes is: (1) P co 2 (2) die “sterk ioon verskil” (SID), dit wil sê, die verskil tussen die somme van al die sterk (ten volle gedissosieerde, chemies nie-reagerende) katione (Na + , K + , Ca 2+ , Mg 2+ ) en al die sterk anione (Cl − en ander sterk anione) en (3) konsentrasies van nie-vlugtige swak sure (d.i. vir elkeen van hulle, die som van sy gedissosieerde en ongedissosieerde vorms, Stewart se simbool Atot). Normale suur-basis status verkry wanneer die onafhanklike veranderlikes normale (empiries gevestigde) waardes het. Abnormaliteit van een of meer van die onafhanklike veranderlikes lê onder alle suur-basis versteurings. Aanpassing van die onafhanklike veranderlikes is die essensie van alle terapeutiese intervensies, want nie een van die "afhanklike veranderlikes" (bv. pH, BE, [HCO)3 − ]) kan primêr of individueel verander word: die afhanklike veranderlikes verander, almal gelyktydig as, en slegs as een of meer van die onafhanklike veranderlikes verander.

'n Klassifikasie van suur-basis-versteurings gebaseer op hierdie benadering word in Tabel 1 getoon. In hierdie siening kan metaboliese suur-basis-versteurings veroorsaak word deur twee tipes abnormaliteite, wat vervolgens bespreek word: abnormale SID en abnormale konsentrasies van nie-vlugtige swak sure.

Tabel 1. KLASSIFIKASIE VAN PRIMÊRE SUUR-BASISVERSTURINGS

Definisie van afkortings: [Alb] = konsentrasie serumalbumien [Pi] = konsentrasie van anorganiese fosfaat SID = sterk ioonverskil (Σ[sterk katione] − Σ[sterk anione]) [XA − ] = konsentrasie van ongeïdentifiseerde sterk anione.

* Verdunningsasidose en konsentrasiealkalose: wanneer daar 'n tekort of oormaat water in plasma is (volgens die maatstaf van 'n abnormale [Na + ]), word die sterk katione en anione gelyk gekonsentreer of verdun, dit verhoog of verminder die SID met dieselfde graad: as C − A = D, dan moet 'n × C − a × A = a × D konsentrasiealkalose en verdunningsasidose soos hier gebruik word nie verwar word met "kontraksie alkalose" en "verdunningsasidose" (19). Laasgenoemde terme is gebruik met verwysing na veronderstelde suur-basis-effekte van onderskeidelik afname en toename in ekstrasellulêre vloeistofvolume. Veranderinge in volume verander egter nie op sigself enige van die veranderlikes wat suur-basis toestand bepaal nie. As die ekstrasellulêre volume uitgebrei word deur infusie van NaCl-soutoplossing, lei hiperchloremiese asidose (20, 21).

† Hiperchloremiese asidose en hipochloremiese alkalose.

‡ Sluit organiese sure in (laktaat, ketosure in "metaboliese asidose" sensu strictiori formiaat of salisilaat in dronkenskap), en sulfaat en ander anione in chroniese nierversaking (die pK-waardes van al hierdie organiese sure is ten minste drie ordes van grootte laer as die plasma pH versoenbaar met lewe, daarom is hulle altyd > 99.9% gedissosieer in plasma en hul anione kan ingesluit word in die definisie van die SID) anders as "anioongaping," [XA] sluit nie anorganiese fosfaat in nie (wat hier afsonderlik en direk geëvalueer word, as een van die nie-vlugtige swak sure).

§ Komponent van asidose in ernstige ekstrasellulêre volumeverlies, soos in cholera (22).

‖ Hierdie bron van alkalose is klinies onbeduidend: die normale waarde van [Pi] (∼ 1 mmol/L) kan nie genoeg verminder om 'n merkbare suur-basis effek te hê nie. Aangepas uit (15).

Wat die SID betref, kan die waarde daarvan op twee algemene maniere verander: eerstens, deur oormaat of tekort aan water in plasma, waardeur die sterk katione en die sterk anione ewe verdun of gekonsentreer word (verdunningsasidose en konsentrasie-alkalose), opgespoor deur abnormale [Na + ] en tweedens, deur slegs die totale konsentrasie van die sterk anione te verander (dit is waar omdat konsentrasies van sterk katione anders as Na + gereguleer word in ekstrasellulêre vloeistowwe binne nou grense, vir doeleindes wat nie verband hou met suur-basis balans of osmolariteit nie) .

Daar is twee stowwe wat as nie-vlugtige swak sure optree en konsentrasies in plasma groot genoeg het sodat veranderinge daarin beduidende suur-basis versteurings kan veroorsaak: anorganiese fosfaat ([Pi], millimol per liter of milligram per desiliter) en serumalbumien ([ Alb], gram per liter).

'n Mens kan uit Tabel 1 sien dat veranderinge in hierdie drie onafhanklik veranderlike hoeveelhede [Alb], [Pi] en SID additiewe of verrekende effekte op die metaboliese suur-basis balans kan hê. Sulke verrekeningseffekte kan lei tot normale waardes van die afhanklike veranderlikes [HCO3 − ] en BE, terwyl sommige onafhanklike veranderlikes abnormaal is. Sodanige toestand word nie as 'n normale suur-basis status beskou nie. Dit verskil van die diagnostiese benadering gebaseer op BE daar die toestand BE = 0 (d.w.s. pH = 7.40 by P co 2 = 40 mm Hg) is per definisie normale suur-basis status, ongeag die waardes van die onafhanklike veranderlikes SID en Atot is (14 sien Bylaag in die aanlyn webbewaarplek van die Tydskrif).

Die hoeveelhede [Alb] (gram per liter) en [Pi] (millimol per liter) kan direk geëvalueer word uit gereelde beskikbare serumontledings. Die inligting wat nodig is vir die evaluering van SID en sterk anione anders as Cl − ([XA − ] in Tabel 1) kan volgens die volgende lyne afgelei word.

Figuur 1 toon hoe dit uit die vereiste van elektroneutraliteit volg dat SID in plasma afgelei kan word as die som van [HCO3 − ] plus die negatiewe elektriese ladings bygedra deur albumien ([Alb − ]) en deur anorganiese fosfaat ([Pi − ]) (7, 15, 23):

SID = [ HCO 3 − ] + [ Alb − ] + [ Pi − ] Vergelyking 1

Fig. 1. Elektroneutraliteit in bloedplasma: som van positiewe ladings is gelyk aan die som van negatiewe ladings, soos aangedui deur gelyke hoogtes van die kolomme wat katione en anione verteenwoordig. Weggelaat (so onbeduidend op die skaal wat gewys word) is ione met mikromolêre of nanomolêre konsentrasies in plasma (OH − , CO3 2− , en H + ). Alb − en Pi − is negatiewe elektriese ladings wat onderskeidelik deur serumalbumien en anorganiese fosfaat vertoon word. XA − = ongeïdentifiseerde sterk anione SID = sterk ioon verskil.

Hiervoor het [HCO3 − ] is beskikbaar vanaf arteriële bloedgasmetings, en [Alb − ] en [Pi − ] (millie-ekwivalente per liter) word bereken uit die gemete [Alb] (gram per liter), [Pi] (millimol per liter) en pH (5,7 Bylaag B):

[ Alb − ] = [ Alb ] × ( 0,123 × pH − 0,631 ) Vergelyking 2a
[ Pi − ] = [ Pi ] × ( 0,309 × pH − 0,469 ) Vergelyking 2b

(vir kliniese bepalings van SID is eenvoudiger skattings bevredigend sien D bespreking).

"Ongeïdentifiseerde sterk anione" (XA - in Figuur 1) is sterk anione anders as Cl - (laktaat, ketosure en ander organiese anione, sulfaat) in sekere siektetoestande, hul konsentrasies neem toe (sien Tabel 1). Totale [XA − ] kan nie direk in plasma gemeet word nie. Figuur 1 toon dat hulle soos volg afgelei kan word:

[ XA − ] = ( [ Na + ] + [ K + ] + [ Ca 2 + ] + [ Mg 2 + ] ) − [ Cl − ] − SID Vergelyking 3

Wateroormaat/tekort word as abnormaal bespeur [Na + ] (Tabel 1). Om 'n Cl − oormaat of tekort te waardeer en te kwantifiseer wanneer abnormaliteite van plasmawater teenwoordig is, moet die waargenome [Cl − ] gekorrigeer word vir die gevolglike verdunning/konsentrasie. Dit kan gedoen word deur die waargenome [Cl − ] te vermenigvuldig met 'n korrektiewe faktor, bv.

[ Cl − ] gekorrigeer = [ Cl − ] waargeneem × ( [ Na + ] normaal / [ Na + ] waargeneem ) , Vergelyking 4

en chloried oormaat/tekort (millimol per liter) ≈ [Cl − ]normaal − [Cl − ]gekorrigeer. Soortgelyke oorwegings geld vir die evaluering van [XA − ].

Indien [Alb], [Pi], en SID met [XA − ], [Cl − ], en [Na + ] bekend is, is al die inligting wat nodig is vir 'n gedetailleerde patofisiologiese interpretasie van die metaboliese suur-basis data beskikbaar (Tabel 1).

Tabel 2 toon die gemete en 'n paar afgeleide suur-basis veranderlikes. In die normale vakke, die gemete hoeveelhede sowel as die gebruiklike afgeleide hoeveelhede BE, [HCO3 - ], en anioongaping was binne die omvang van gevestigde normale waardes (2, 3, 24). SID was 39 ± 1 en [XA − ] 8 ± 2 (mEq/L beteken ± SD).

Tabel 2. SUUR-BASIS VERANDERLIKE IN ARTERIESE BLOEDPLASMA

Definisie van afkortings: AGaangepaste = anioongaping aangepas vir abnormale albumienkonsentrasie = AGwaargeneem + 0.25 × ([normale albumien] − [waargeneem albumien]) (12) AGwaargeneem = waargenome anioongaping = ([Na + ] + [K + ]) − ([Cl − ] + [HCO3 − ]) BE = basis oormaat/tekort vir plasma of ekstrasellulêre vloeistof (18) Pi = anorganiese fosfaat (mg/dL = 3.09 mmol/L) SID = sterk ioon verskil (sien Metodes, Vergelyking 1) TP = totale plasmaproteïene [XA − ] = konsentrasie van ongeïdentifiseerde sterk anione (Vergelyking 3).

§ Gekorrigeer vir wateroorskot/-tekort (Vergelyking 4). SID = [HCO3 − ] + [Alb x− ] + [Pi y− ].

In die pasiënte het pH ernstige suurdemie tot uitgesproke alkalemie aangedui, as gevolg van uitgebreide respiratoriese of metaboliese abnormaliteite. Metaboliese suur-basis abnormaliteite erken deur die tradisionele diagnostiese benaderings-BE of [HCO3 − ] met AG—verskei wyd in grootte. Hipoalbuminemie ([Alb] ⩽ 3 SD onder die gemiddelde van die normale) was teenwoordig in 96% van die pasiënte. Die klassifikasie wat hier in Tabel 1 en voorheen (15) voorgestel word, sal verskeie individuele metaboliese alkaliserende en versurende abnormaliteite identifiseer en kwantifiseer. Onder die alkaliserende afwykings van normaal is hipoalbuminemie (laagste waargenome [Alb] 4 g/L), hipofosfatemie (laagste [Pi] 0,2 mmol/L of 0,6 mg/dl), en verhoogde SID (hoogste 47 mEq/L). Die versurende nierespiratoriese afwykings is hiperfosfatemie (hoogste [Pi] 3,4 mmol/L of 10,5 mg/dl), en verminderde SID (laagste 18 mEq/L). Onder die abnormaliteite wat die waarde van SID verander, word die volgende gevind: (1) abnormaliteite in waterinhoud in plasma, wat verdunningsasidose (laagste [Na +] 117 mEq/L) of konsentrasie-alkalose (hoogste [Na + ] 159 mEq/L) (2) abnormaal [Cl − ], wat hipochloremiese alkalose produseer (laagste [Cl − ]gekorrigeer 90 mEq/L) of hiperchloremiese asidose (hoogste [Cl − ]gekorrigeer 123 mEq/L) (3) teenwoordigheid van oormaat “sterk anione anders as Cl − ”: hoogste [XA − ]gekorrigeer 37 mEq/L (gekorrigeer vir wateroormaat/tekort in plasma, Vergelyking 4).

Werklike voorbeelde van metaboliese suur-basis abnormaliteite wat met hierdie benadering opgespoor is, sommige van hulle kompleks, word in Tabel 3 (sien Tabel 2 vir verwysing normale waardes van die veranderlikes). By Pasiënt 18 (chroniese obstruktiewe longsiekte [COPD], brongopneumonie, kongestiewe hartversaking), is hipoalbuminemie die enigste bron van die ernstige metaboliese alkalose. Die tradisionele metodes rapporteer 'n baie hoë [HCO3 − ] en BE van +9 mEq/L, SID, [Na + ], [Cl − ], en [XA − ] is egter almal normaal (soos AGaangepaste). Dit is 'n geval van eenvoudige hipoalbuminemiese alkalose. In pasiënt 59 (postoperatiewe veelvuldige orgaanversaking), word SID verminder met ~ 20 mEq/L, wat veroorsaak word deur die kombinasie van plasmawateroormaat ([Na + ] = 117 mEq/L), chloriedoormaat (waardeer slegs met [Cl] − ]gekorrigeer), en deur verhoogde [XA − ] versag die alkaliserende hipoalbuminemie die SID asidose: BEpl, wat beweer word dat dit 'n maatstaf is van die verandering in plasma SID (25, 26), is − 10 mEq/L, dit wil sê, dit bespeur slegs die helfte van die verandering in SID. AGwaargeneem is laag normaal (maar abnormale anione word getoon deur die hoë [XA − ].) Die suurdemie word versag deur hipokapnie.

Tabel 3. VOORBEELDE VAN KOMPLEKSE SUUR-BASISVERSTURINGS

Definisie van afkortings: AGwaargeneem en AGaangepaste = anioongaping waargeneem en aangepas -abnormale albumien, onderskeidelik BEpl en WEESvgl = basisoormaat in plasma en in ekstrasellulêre vloeistof, onderskeidelik (18) Cl − gekorrigeer en XA - gekorrigeer = chloried en ongeïdentifiseerde anione, gekorrigeer vir wateroormaat/tekort, onderskeidelik Pi = anorganiese fosfaat .

In pasiënt 63 (hartstilstand, kardiopulmonêre resussitasie, hipoksiese enkefalopatie) is die verlaging van SID met ~ 10 mEq/L die gevolg van die teenverklaarende effekte van hoë [XA − ] (verlagende SID), en plasmawatertekort ([Na + = 159 mEq. /L, toenemende SID). Die gevolglike lae-SID asidose word versteek deur die alkaliserende hipoalbuminemie. BE mis die hoë-[XA − ] asidose en interpreteer die suur-basis status as 'n ligte metaboliese alkalose. [HCO3 − ] is hoog-normaal en AGwaargeneem mis die hoë abnormale anione. Geen groot chloriedoormaat is teenwoordig nie, alhoewel die gemete [Cl − ] dit sou voorstel. Die alkalemie is die gevolg van ernstige hipokapnie.

In pasiënt 81 (meervoudige trauma, ARDS, sepsis), word SID verminder met ~ 12 mEq/L (as gevolg van plasmawateroormaat en baie hoë [XA − ]) en [Pi] is verhoog. Hierdie asidoses word versag deur alkalose van chloriedtekort en hipoalbuminemie: [HCO3 − ] is slegs effens verlaag AGwaargeneem is verhoogde basistekort slegs − 4 mEq/L d.w.s. die erns van die asidose word grootliks onderskat.

By pasiënt 29 (diabetiese ketoasidose), word SID verlaag tot 31 mEq/L, as gevolg van die verrekenende effekte van hoë [XA − ] met plasmawateroormaat (verlaging van SID), en Cl − tekort (toenemende SID). Die lae-SID asidose word byna presies gebalanseer deur alkalose van hipoalbuminemie, sodat BE en [HCO3 − ] is binne normale perke AGwaargeneem is hoog normaal. Beide tradisionele diagnostiese benaderings mis die hoë-[XA-] asidose en interpreteer die data as 'n eenvoudige respiratoriese alkalose, met geen metaboliese abnormaliteite nie.

In pasiënt 51 (koptrauma, koma, akute nierversaking), word SID verminder met ~ 10 mEq/L. Dit word veroorsaak deur verhoogde [XA − ] en deur plasmawateroormaat ([Na + ] = 133 mEq/L). Geen chloriedtekort is teenwoordig nie, alhoewel die gemete [Cl − ] dit sou voorstel. Die lae-SID asidose word gebalanseer deur hipoalbuminemiese alkalose, sodat beide BE en [HCO3 − ] met AGwaargeneem normaal voorkom. BE mis die verhoogde [XA − ] en interpreteer die data as eenvoudige respiratoriese asidose, sonder metaboliese abnormaliteite.

In pasiënt 88 (postoperatiewe meervoudige orgaanversaking), word SID verminder met ~ 13 mEq/L as gevolg van baie hoë [XA - ]. Hierdie asidose word presies ooreenstem met die alkaliserende hipoalbuminemie, sodat beide BE en [HCO3 − ] (en AGwaargeneem) binne normale perke is, word 'n ernstige metaboliese asidose gemis. In alle monsters waar [XA-] of [Pi] egter verhoog is, het die aanpassing van AG vir hipoalbuminemie (12) - soos verwag - die opsporing van hierdie abnormaliteit moontlik gemaak.

In pasiënt 41 (meervoudige trauma), word SID verminder tot 32 mEq/L deur chloriedoormaat. Die hiperchloremiese asidose word presies ooreenstem met alkalose van hipoalbuminemie, sodat beide BE en [HCO3 − ] is normaal.

In pasiënt 53 (lewersirrose, bloeding spatare), word SID verminder met ~ 10 mEq/L, as gevolg van oormaat plasmawater ([Na + ] = 125 mEq/L) en Cl − (laasgenoemde word slegs waardeer met [ Cl − ]gekorrigeer). Hierdie gemengde lae-SID asidose word presies ooreenstem met hipoalbuminemiese alkalose. BE en [HCO3 − ] is normaal, beide tradisionele diagnostiese benaderings mis hierdie gemengde metaboliese asidose.

In Tabel 4 het ons daardie pasiënte gekies in wie die waardes van BE en [HCO3 − ] was binne die omvang van hul normale waardes (binne ± 2 SD van kontrole in Tabel 2). In hierdie monsters met oënskynlik normale gebruiklike indekse van die metaboliese suur-basis status, het die benadering wat in Tabel 1 uiteengesit is, abnormaliteite met verrassende frekwensie opgespoor, sommige van hulle ernstig en ernstig. Die versurende effek van lae SID (teenwoordig in 95% van hierdie monsters met normale BE en [HCO3 −], en veroorsaak deur oormaat Cl − of XA −, of deur plasmaverdunning) is geneutraliseer en dus weggesteek deur die alkaliserende effek van hipoalbuminemie (gesien in 100% van hierdie oënskynlik normale monsters). Hipochloremiese alkalose (teenwoordig in 40% en 32% onderskeidelik) is geneutraliseer deur verhoogde [XA − ], of deur verdunnings- of hiperfosfatemiese asidoses. In 14% van die monsters met normale [HCO3 − ], was die waargenome anioongaping verhoog (⩾ 3 SD bo die gemiddelde van normale) deur die anioongaping vir hipoalbuminemie aan te pas (12) het die opsporing van abnormale "gaping anione" viervoudig verhoog.

Tabel 4. VERBORGDE METABOLIESE SUUR-BASIS VERSTURINGS IN PASIENTE MET NORMALE * BASIS OORSTYD OF PLASMA BICARBONATE KONSENTRASIE

Definisie van afkortings: AGaangepaste (millie-ekwivalente per liter) = anioongaping aangepas vir abnormale albumienkonsentrasie = AGwaargeneem + 0.25 × ([normale albumien] − [waargeneem albumien]) (gram per liter) (12) AGwaargeneem = waargenome anioongaping = ([Na + ] + [K + ]) − ([Cl − ]+[HCO3 + ]) [Pi] = anorganiese fosfaatkonsentrasie SID = sterk ioonverskil (sien Metodes, Vergelyking 1) [XA − ] = konsentrasie van ongemeet sterk anione (Vergelyking 3).

* Binne ± 2 SD van gemiddelde kontrolewaarde (sien Tabel 2).

† Baseer oormaat/tekort vir ekstrasellulêre vloeistof (15).

‡ ⩽ 3 SD onder die gemiddelde van kontroles (sien Tabel 2).

§ ⩾ 3 SD bo die gemiddelde van kontroles.

‖ Gekorrigeer vir wateroorskot/-tekort (Vergelyking 4).

** Data tussen hakies is uiterste waardes in die groepe.

Al die suur-basis versteurings wat hier gesien word, kon maklik geïnterpreteer en direk en kwantitatief geëvalueer word as abnormaliteite van die onafhanklike veranderlikes P co 2, [Alb], [Pi] en SID. Die data wat benodig word vir so 'n omvattende evaluering (P co 2 en pH, [Alb], [Pi], en die konsentrasies van die elektroliete Na + , K + , Ca 2+ , Mg 2+ , Cl − ) is beskikbaar vanaf bloedgasmetings en serumchemieprofiele.

Alhoewel bepaling van [Mg 2+ ] nie by roetine-chemie-profiele ingesluit is nie, is die veranderinge daarvan gewoonlik so klein dat hulle verwaarloos kan word en 'n konstante waarde vir [Mg 2+ ] kan aanvaar word in die berekening van [XA − ] (Vergelyking 3). In ons data van baie siek pasiënte het [Mg 2+ ] gewissel van 0.8 tot 2.6 mEq/L wanneer die gemete [Mg 2+ ] vervang is deur 'n konstante van 1.7, die effek op die berekende waardes van [XA − ] was weglaatbaar : die gemiddelde verskil was 0.1 mEq/L (±0.3, SD-reeks -0.9 tot +0.9 mEq/L). Hierdie vereenvoudiging is nie van toepassing as groot dosisse Mg-soute parenteraal toegedien word nie (bv. in die behandeling van preeklampsie) (25). Vir bedkantsevaluering van data kan die formule vir SID (vergelykings 1, 2a en 2b) ook vereenvoudig word om

SID ≈ [ HCO 3 − ] + 0,28 × [ Alb ] ( g / L ) + 1,8 × [ Pi ] ( mmol / L ) Vergelyking 5

Die faktore 0.28 en 1.8 is negatiewe elektriese ladings (in milli-ekwivalente) wat onderskeidelik deur 1 g albumien en 1 mmol fosfaat in plasma by pH = 7.40 (7) vertoon word as die eenhede van [Pi] milligram per desiliter is, die faktor want [Pi − ] is 0.6. Die variasie van hierdie faktore met die werklike pH of met ioonbinding is weglaatbaar vir die doel van hierdie berekeninge. Die ooreenkoms tussen SID-waardes wat met vergelykings 1, 2a en 2b bereken is, en dié wat met vergelyking 5 beraam is, was bevredigend in ons data: die gemiddelde verskil was 0.0 ± 0.2 mEq/L (± SD-reeks - 1.2 tot +0.8 mEq/L) .

In ongekompliseerde kliniese situasies is die gebruiklike benaderings gebaseer op BE, of op [HCO3 − ] aangevul met anioongaping, kan bevredigend wees. In die komplekse steurnisse van kritiek siek pasiënte, kan alkaliserende en versurende steurnisse egter beide teenwoordig wees, hulle kan opsporing vryspring as gevolg van hul verrekenende effekte op die gebruiklike indekse van die metaboliese suur-basis status (Tabelle 3 en 4).

Met die [HCO3 − ] benadering, berekening van AGwaargeneem moet voorstel dat die oënskynlike normaliteit in die metings met normale [HCO3 − ] was vals, maar dit sou gehelp het in slegs twee van die 13 pasiënte met verborge asidose van verhoogde [XA − ] of [Pi], of albei. Toe AG aangepas is om rekening te hou met die effekte van hipoalbuminemie (12), soos verwag, was dit verhoog in al die monsters met normale [HCO3 − ] wat [XA − ] en [Pi] verhoog het.

BE het belangrike metaboliese suur-basis-abnormaliteite in die komplekse versteurings by ons pasiënte gemis. Onder die 20 pasiënte met normale BE (Tabel 4), het 19 baie lae SID-waardes gehad. Hierdie asidotiese abnormaliteite was die gevolg van verhoogde [XA-], plasmaverdunning of hiperchloremie (of hul kombinasies). Dit is nie deur BE opgespoor nie omdat die lae-SID asidose gemasker is deur die alkaliserende effek van hipoalbuminemie, teenwoordig in al hierdie pasiënte. Die redes vir hierdie mislukking van BE om metaboliese asidose op te spoor in die teenwoordigheid van hipoalbuminemie is soos volg.

BE word beweer dat dit gelyk is aan die afwyking van SID van sy normale waarde (26, 27). Dit is egter slegs waar as die plasmakonsentrasies van die niebikarbonaatbuffers (albumien en fosfaat) normaal is.Wanneer hierdie voorwaarde nie nagekom word nie, moet die verwysingstoestand vir “normale SID” aangepas word (14 sien ook Bylaag in die aanlyn bylaag tot hierdie artikel). Dit is wat die BE-metode inderdaad doen (3, 26): vir die toestand van BE = 0, wanneer hipoalbuminemie teenwoordig is, word 'n aangepaste SID as normaal beskou, dit moet laer wees as wat verkry word wanneer serumalbumienkonsentrasie normaal is, om te voldoen die toestand van pH = 7.40 by P co 2 = 40 mm Hg, wat die enigste definisie is van BE = 0 veranderinge in albumienkonsentrasie word nie as suur-basis-abnormaliteite beskou nie (26). Sulke aangepaste (verlaagde) SID kan egter die gevolg wees van drie verskillende meganismes: hiperchloremie, verhoogde [XA - ] of plasmaverdunning (sien Tabel 1).* Wilkes (28) beweer dat, met hipoalbuminemie SID verlaag word deur die verhoging van plasma [Cl − ], deur 'n renale kompensasie vir hipoalbuminemie, sy gevolgtrekking is gebaseer op 223 metings van suur-basis veranderlikes in 91 ICU pasiënte. In ons enkele metings in kritiek siek pasiënte vind ons geen korrelasie tussen serumalbumienkonsentrasie en [Cl − ]waargeneem of [Cl − ]gekorrigeer. Dit is nie verbasend nie, want in die meeste ICU-pasiënte verander baie roetine-intervensies die plasma [Cl − ] tot 'n mate wat die omvang van regulering van hierdie anioon deur die niere kan oorweldig (bv. diuretika, nasogastriese suiging, oortappings van sitraatbloedprodukte, intraveneuse hiperalimentasie, groot infusies van NaCl-oplossings). Aan die ander kant was hoë [XA - ] (⩾ 3 SD bo die gemiddelde van die kontrolepersone) teenwoordig in meer as die helfte van al ons pasiënte met hipoalbuminemie, en in een derde van diegene met normale BE (Tabel 4) .

In vier van die 152 pasiënte was [XA -] (gekorrigeer vir wateroormaat/tekort) blykbaar minder as 4 mEq/L (> 2 SD onder die gemiddelde van die kontroledata). Omdat dit onwaarskynlik is, moet 'n mens vermoed dat sommige ongeïdentifiseerde katione in plasma teenwoordig was, soos kationiese paraproteïene (29) of kationiese middels in millimolêre (toksiese) konsentrasies (30, 31). Wanneer sulke katione teenwoordig is, is die waarde van [XA − ] bereken met Vergelyking 3 nie 'n geldige maatstaf van "alle sterk anione behalwe Cl − ." In plaas daarvan los dit op vir ([XA − ] − ongeïdentifiseerde katione), dit wil sê, dit onderskat die ware waarde van [XA − ]. Gelukkig is hoë konsentrasies van ongeïdentifiseerde katione skaars, selfs in ICU-instellings en wanneer vermoed word, bestaan ​​metodes waardeur hulle geïdentifiseer kan word.

Hipoalbuminemie, 'n byna alomteenwoordige abnormaliteit in kritiek siek pasiënte, kan die interpretasie van suur-basis data verwar wanneer die gebruiklike diagnostiese benaderings gebaseer op BE of plasma [HCO]3 − ] met AG toegepas word.

BE misluk as 'n maatstaf van metaboliese asidose wanneer die konsentrasie van serumalbumien, die hoof nie-bikarbonaatbuffer in plasma, laag is.

Die metode wat staatmaak op plasma [HCO3 − ] en AGwaargeneem kan "gaping acidoses" mis of onderskat wanneer serumalbumien laag is. Wanneer dit egter aangepas word vir abnormale albumienkonsentrasie (12), is AG betroubaar om sulke verborge "gaping" asidoses op te spoor. Die bruikbaarheid van hierdie benadering is onlangs bevraagteken (32).

Die derde benadering tot ontleding van suur-basis-data wat hier aangebied word, laat 'n mens toe om al die verskillende individuele komponente van selfs die mees komplekse suur-basis-versteurings wat by kritiek siek pasiënte gesien word, op te spoor en te kwantifiseer. Daarbenewens gee dit insigte in die patogenese van metaboliese suur-basis versteurings, wat die keuse van toepaslike spesifieke terapeutiese intervensies verduidelik. Al die berekeninge wat nodig is vir die voorgestelde stelsel van evaluering kan maklik by die bed gedoen word, met 'n eenvoudige handrekenaar. Die stelsel leen hom tot 'n outomatiese omvattende evaluering van komplekse suur-basis data. 'n Eenvoudige rekenaarprogram hiervoor kan by die skrywers verkry word.

Die skrywers bedank Dr. Zdena Krupková en Karel Zı́tko vir hulp met die herwinning van pasiëntdata, en dr. D. E. Leith vir nuttige kommentaar.


Materiale en metodes

Eksperimentele diere

Volwasse monsters van enige geslag van die Afrika-longvis Protopterus annectens Owen (143±6 g gemiddelde massa ± s.e.m. N=46) is vanaf Sentraal-Afrika na Singapoer ingevoer deur 'n plaaslike visplaas. Longvisse is toe per lugvrag na Ottawa verskeep. Tydens transito is longvisse in gedeeltelik gevulde sakke met suurstofhoudende water geplaas wat in geïsoleerde houers gehou is en met aankoms is die visse oorgeplaas na individuele bedekte plastiekakwariums gevul met 2-3 l gedechloramineerde stad Ottawa kraanwater wat tot 25°C verhit is. Die tenkwater is op alternatiewe dae verander of gouer indien duidelike vervuiling van die water plaasgevind het. Longvisse is in 'n kamer gehou waarin die lugtemperatuur op 25°C gehandhaaf is, onder 'n kunsmatige fotoperiode van 10 uur:14 uur lig:donker. Visse is op alternatiewe dae gevoer met bevrore bloedwurms of stukkies reënboogforelvleis, en is toegelaat om by hierdie toestande aan te pas vir ten minste 1 maand voor eksperimentering.

Om periodieke bloedmonsters sowel as suur- of basisinfusie moontlik te maak, is 'n kanule (Clay-Adams PE50 poliëtileenbuis VWR, Montreal, QC, Kanada) in die dorsale aorta van alle visse geplaas, soos beskryf deur Perry et al. (Perry et al. al., 2005). Chirurgie is uitgevoer op longvisse wat eers verdoof is deur onderdompeling in 'n oplossing van MS-222 (etiel-bl-aminobensoaat 0.67 g l –1 ) aangepas na neutrale pH met NaHCO3 (1.3 g l –1 ) verdowing is gehandhaaf tydens die operasie deur die vis in papierhanddoeke wat met die verdowingsoplossing geweek is, toe te draai. 'n Subset van longvisse (N=7) is toegerus met 'n eksterne urinêre kateter volgens die prosedure van Curtis en Wood (Curtis en Wood, 1991). Die gebruik van 'n eksterne urinêre kateter laat die versameling van urine toe, aangesien dit natuurlik uit die urogenitale papilla ontslaan word. Na die operasie is longvisse na hul houers teruggebring vir 'n herstelperiode van 24 uur. Kanules is daagliks met Cortland-soutoplossing gespoel (Wolf, 1963).

Eksperimentele protokol

Reeks 1. Respiratoriese versus metaboliese kompensasie van suur-basis versteurings

Vis (N=19) wat voorheen toegerus was met 'n dorsale aorta-kanule, is ongeveer 2 uur voor 'n eksperiment begin is in pasgemaakte respirometrie-kamers geplaas. Die silindriese kamers is gevul met water (~1 l) afgesien van 'n verstelbare lugspasie (60 ml maksimum volume tipies gestel op ~30 ml) aan die een kant van die respirometer presiese water en lugvolumes is vir elke vis aangeteken. Longvisse het vinnig bewus geword van die teenwoordigheid van die lugruimte, en sou normaalweg met gereelde tussenposes lug begin inasem en 'n posisie in die respirometer inneem waar hul kop net onder die lugruim was. Die voorkoms van elke lugasem is vasgevang deur 'n pasgemaakte toestel wat onderbrekings opgespoor het in twee infrarooi ligstrale wat oor die oppervlak van die water gerig is. Beide kompartemente is voorsien van voortdurend vloeiende media (water of bevogtigde lug, by 25°C) behalwe tydens metings van die tempo van O2 verbruik(O2), CO2 uitskeiding (CO2), en netto suuruitskeiding in die water. Tydens hierdie metings is die water met 'n peristaltiese pomp hersirkuleer, en die lugkamer is verseël. Optiese vesel O2 elektrodes (Ocean Optics AL300, Dunedin, FL, VSA) wat verseël is in die lugkamer en in die buis waardeur water hersirkuleer, is gebruik om lug- en water te meet PO2, onderskeidelik. Lugfoto PCO2 is gemeet met 'n CO2 elektrode (Analitiese sensors E201, Sugarland, TW, VSA) in die lugkamer geplaas, terwyl water PCO2 behels die gebruik van 'n klein peristaltiese pomp om water verby 'n CO te beweeg2 elektrode (Analitiese Sensors E201) gehuisves in 'n termostaat (25°C) kuvette (Radiometer) voordat dit na die respirometer teruggeplaas word. Hierdie respirometers is gebruik in 'n vorige studie (Perry et al., 2005) waartydens die mate van gasoordrag oor die lug-water-koppelvlak gekwantifiseer is en as weglaatbaar gevind is.

Sodra visse met gereelde tussenposes lug ingeasem het en dit vir ten minste 1 uur gedoen het, het basislyn (`voor') metings van O2, CO2, ventilasie frekwensie, netto suur uitskeiding en bloed suur-basis status is uitgevoer oor die verloop van 1 uur. Die water- en lugkamers is verseël nadat die vloei van media gestop is, en die hersirkulasiepomp is begin om vermenging te verskaf. Veranderinge in lug PO2 en PCO2 is vir twee periodes van 30 minute gemonitor, waartussen die lug binne die kamer verfris is. Veranderinge in akwatiese PO2 en PCO2 is vir ongeveer 30 minute gemonitor of tot stabiele CO-koerse2 akkumulasie en O2 uitputting behaal is. Benewens die outomatiese opsporing van lugasemhalings, is die frekwensie van waterasemhaling bepaal deur waterasemhalings met periodieke intervalle visueel te tel. Om netto suuruitskeiding te meet, is 20 ml watermonsters aan die begin en einde van die 1-uur vloedperiode onttrek. 'n Bloedmonster van 0,5 ml is aan die einde van die metingsperiode onttrek. Die bloedmonster is gesentrifugeer en plasma is verwyder vir onmiddellike ontleding van pH en totale CO2 inhoud (CCO2). Die oorblywende rooibloedselle is hersuspendeer in gehepariniseerde (50 i.u. ml –1 ammoniumheparien Sigma, Oakville, ON, Kanada) Cortland soutoplossing en weer in die vis ingespuit. Aan die einde van hierdie metingsperiode is die respirometer na 'n deurvloeitoestand teruggekeer en suur- of basisinfusie is begin.

Longvisse is met suur (0.9 moll –1 NH) toegedien4Kl N=11) of basis (0,9 mol l –1 NaHCO3 N=8) teen 'n dosis van 3 mmol kg –1 h –1 vir 1 uur. 'n Spuitpomp (SAGE instruments 355) is gebruik om suur of basis in te spuit via die dorsale aorta-kanule. Sodra suur- of basisinfusie begin is, is die water- en lugkamers verseël en die reeks metings hierbo beskryf is herhaal, wat uitgeloop het op die onttrekking van 'n bloedmonster onmiddellik na die infusieperiode. Bloedmonsters is ook 3, 6 en 18 uur na infusie onttrek, en is in elke geval voorafgegaan deur dieselfde reeks metings van O2, CO2, ventilasiefrekwensie en netto suuruitskeiding. Na onttrekking van die 18 uur bloedmonster is longvisse verdoof in situ deur intra-arteriële inspuiting van 400 mg kg –1 natriumpentobarbital (Somnotol), en dan opgeoffer deur 'n intra-arteriële inspuiting van versadigde KCl. N finale meting tydperk vir O2, CO2 en netto suuruitskeiding is oor 45 min uitgevoer om agtergrondvlakke van gasoordrag en netto suuruitskeiding te skat. Daar is aanvaar dat hierdie agtergrondwaardes kutane metabolisme (wat hulle kan onderskat) en/of metabolisme wat voortspruit uit mikroörganismes in die water of op die oppervlak van die vis, weerspieël (Perry et al., 2005). Vir elke vis, die waardes vir O2, CO2 en netto suuruitskeiding is gekorrigeer vir agtergrondmetabolisme deur die tempo wat in hierdie finale respirometrie/vloedperiode bepaal is af te trek.

Reeks 2. Verdeling van netto suur uitskeiding tussen kieue/vel en nier in basis-geïnfuseerde vis

Longvis (N=7) is in die pasgemaakte respirometrie-kamers geplaas en eksperimente is nie begin voordat ten minste 1 uur se asemhalingslug met gereelde tussenposes plaasgevind het nie. Visse wat in hierdie eksperimente gebruik is, is toegerus met beide 'n dorsale aorta-kanule (vir basis-infusie is bloedmonsters nie in hierdie eksperimente versamel nie) en 'n eksterne urinêre kateter. Urine is deurlopend deur die eksperimentele periode versamel deur die urinêre kateter te laat dreineer, deur swaartekrag, in 'n flessie wat buite die respirometer geleë is en ongeveer 5 cm onder watervlak gehou word. Die urinêre kateter is nagegaan vir lekkasies deur die kateter 5 cm bo watervlak te lig. Onder hierdie toestande het 'n daling van die urinevlak in die kateter 'n lek aangedui, en die eksperiment is beëindig. Eerstens is 'n vloedperiode uitgevoer om basislyn (`pre') vlakke van netto suuruitskeiding in water en urine te bepaal, sowel as urinevloeitempo (UFR), pH en CCO2. Watervloei na die respirometer is gestop, die kamer is verseël en die hersirkulasiepomp is begin om vermenging te verskaf. Watermonsters (20 ml) is aan die begin en 3 uur van die 4 uur vloedperiode versamel. Om te verseker dat die dooie ruimte volume binne die urinêre kateter skoongemaak is, is urine wat tydens die aanvanklike ~60 min van die vloedperiode versamel is, weggegooi. Aan die einde van die vloedperiode is watervloei na die respirometer hervestig en basisinfusie is begin. Basis (0,9 mol l –1 NaHCO3) is met 'n spuitpomp in die dorsale aorta-kanule toegedien teen 'n dosis van 3 mmol kg –1 uur –1 vir 1 uur. Fluksperiodes is uitgevoer oor die aanvanklike 4 uur na basisinfusie, en vanaf 17-21 uur na basisinfusie.

Reeks 3. Die impak van suur- of basisinfusie op geenuitdrukking

Na herstel van chirurgie, is longvisse toegerus met 'n dorsale aorta-kanule intra-arterieel toegedien met sout (Cortland sout, 0,5 ml h -1) N=3), suur (0,9 mol l –1 NH4Kl N=8) of basis (0,9 mol l –1 NaHCO3 N=7) teen 'n dosis van 3 mmol kg –1 uur –1 vir 1 uur met 'n spuitpomp. Longvisse is 4 uur geoffer (N=8) of 8 uur (N=7) na die suur- of basisinfusieperiode, en kieu- en nierweefselmonsters is versamel, flitsbevries in vloeibare N2 en gestoor by –80°C vir latere ontleding van geenuitdrukking. Sout-geïnfuseerde vis is 8 uur na die infusieperiode gemonster om kontroledata te verskaf.

Analitiese prosedures

Vir respirometrie, PCO2 elektrodes is gekoppel aan 'n bloedgasontleder (Cameron Instruments BGM200, Port Aransas, TX, VSA) wat aangepas is om twee CO te aanvaar2 insette. Uitset van die bloedgas-ontleder en die infrarooi lug-asem-detektor is omgeskakel na digitale data en gestoor deur koppelvlak met 'n data-verkrygingstelsel (Biopac Systems Inc., Harvard Apparatus Canada, Saint-Laurent, QC, Kanada) deur gebruik te maak van Acknowledge™-dataverkryging sagteware (steekproeftempo gestel op 30 Hz) en 'n rekenaar. Uitset vanaf die optiese vesel O2 elektrodes is versamel deur gebruik te maak van Ocean Optics-sagteware wat op dieselfde rekenaar loop. Hierdie data is saamgestel as tekslêers vir latere invoer in sigbladsagteware vir berging en ontleding. Om die optiese vesel O te kalibreer2 elektrode wat vir water gebruik word PO2 metings, is die elektrode in nul-oplossing (2 g l –1 natriumsulfiet) of lugversadigde water gedompel totdat stabiele lesings aangeteken is. Die optiese vesel O2 elektrode wat vir lug gebruik word PO2 metings is gekalibreer in situ in die respirometer deur bevochtigde N te vloei2 gas (nul) of lug voortdurend deur die lugkamer. Beide CO2 elektrodes is gekalibreer in situ met behulp van mengsels van 0,5% en 1,0% CO2 in lug wat voorsien is deur 'n gasmengvloeimeter (Cameron Instruments GF-3/MP). Bevochtigde gasmengsels wat deur die lugkamer van die respirometer vloei, is gebruik om die lug te kalibreer PCO2-elektrode, terwyl water wat met die gasmengsels gebalanseer en deur die kuvet gepomp is, gebruik is om die CO te kalibreer2 elektrode wat vir water gebruik word PCO2 mates.

Tempo's van luggasoordrag is bepaal uit die hellings van die verwantskappe tussen geïnspireerde gasspanning en tyd, oor die tydperk wat die lugkamer verseël is, met inagneming van lugkamervolume, vismassa en die oplosbaarheidskoëffisiënte van O2 en CO2 in lug by 25°C (Boutilier et al., 1984). Net so is watergasoordrag bereken deur gebruik te maak van die hellings van die verwantskappe tussen watergasspanning en tyd oor die interval wat die water in die respirometer hersirkuleer is, met inagneming van waterkamervolume en vismassa. Vir O2, is die oplosbaarheidskoëffisiënt in vars water by 25°C verkry van Boutilier et al. (Boutilier et al., 1984). Vir CO2, is die kapasitansiekoëffisiënt in gedechloramineerde stad Ottawa kraanwater by 25°C eksperimenteel bepaal as 0.041 μmol l –1 mmHg –1 deur die totale CO2 te meet2 konsentrasies (Cameron Instruments Capni-Con 5) van watermonsters wat tot die reeks van PCO2 waardes teëgekom in respirometrie proewe.

Bloedmonsters is gesentrifugeer (~10 000 g vir 1 min) onmiddellik na onttrekking om plasma te lewer. Plasma totale CO2konsentrasie is in duplikaat bepaal op 50 μl monsters (Cameron Instruments Capni-Con 5). Plasma-pH is gemeet met behulp van 'n pH-elektrode en kalomel-verwysing (Analytical Sensors E301 glas pH-elektrode) wat in 'n temperatuurbeheerde, lae-volume pH-kamer (Cameron Instruments) gehuisves is en aan 'n PHM 72 suur-basis ontleder (Radiometer) gekoppel is. . Die arteriële bloed PCO2 (PaCO2) en bikarbonaatkonsentrasie ([HCO – 3]) is dan uit die Henderson-Hasselbalch-vergelyking bereken deur toepaslike waardes vir αCO te gebruik2 en pK'(Boutilier et al., 1984).

Netto suur uitskeiding (JnetH + ) is bepaal uit metings van titreerbare netto suurvloed (JnetTA) en die verandering in ammoniakkonsentrasie in die watermonsters wat aan die begin en einde van 'n vloedperiode versamel is. Water JnetTA- en ammoniakkonsentrasie is binne 24 uur na monsterinsameling beoordeel en die res van die watermonster is gevries vir latere ontleding van ioonkonsentrasies. JnetTA is bepaal deur (met 'n Gilmont-presisiemikroburet) 5 ml watermonsters vanaf die begin en einde van elke vloedperiode tot pH 4.00 te titreer met 0.02 mol l –1 HCl. Monsters is voortdurend belug voor en tydens titrasie om vermenging en verwydering van CO te verseker2. 'n Mikro-modifikasie van die salisilaat-hipochloriet kolorimetriese toets van Verdouw et al. (Verdouw et al., 1978) is gebruik om totale ammoniakvlakke in watermonsters te meet. JnetH + is dan bereken as die som van JnetTA en die ammoniak vloed(JnetNH3), tekens oorweeg, soos beskryf deur McDonald en Wood (McDonald en Wood, 1981).

Netto renale suuruitskeiding is ook bepaal as die som van titreerbare netto suurvloed en ammoniakuitvloeiing (Wood en Caldwell, 1978). Urine JnetTA is gemeet deur die pH van 'n 200 μl portie urine tot onder 5.0 te verlaag deur die byvoeging van 'n bekende volume van 0.02 mol l –1 HCl. Die monster is dan vir 20 minute belug om CO te verwyder2. Terwyl voortgegaan word om te belug, is die pH van die urinemonster teruggetitreer na die pH van bloed wat verteenwoordigend is van die spesifieke monsternemingsperiode deur die byvoeging van 0.02 mol l –1 NaOH met behulp van 'n presisiemikroburet (Gilmont). Die titreerbare komponent van netto renale suuruitskeiding word gegee deur die verskil in die hoeveelhede suur en basis wat by die urine gevoeg word. Urinevloeitempo's is gravimetries bepaal. Soos met watermonsters, urine JnetTA- en ammoniakkonsentrasie is binne 24 uur van monsterinsameling beoordeel saam met urine pH en CCO2. Urine ammoniakkonsentrasie, pH en totale CO2 konsentrasie is geassesseer met behulp van die prosedures wat hierbo beskryf is vir water of bloed. Vir die berekening van urine [HCO – 3], konstantes wat vir varswater afgelei is, is gebruik (Boutilier et al.,1984).

Molekulêre kloning en ontleding van longvis koolzuuranhidrase, Na + /HCO3 – medetransporters en H + V-ATPase

Kloningsprosedures

Weefsels vir die kloning van longvis CA, NBC en H + V-ATPase is versamel van visse wat terminaal verdoof is deur onderdompeling in 'n oplossing van MS-222 (sien hierbo). Totale RNA is geïsoleer uit 'n gegewe weefsel met behulp van Trizol (Invitrogen, Burlington, ON, Kanada) volgens die vervaardiger se instruksies. RNA kwantiteit en kwaliteit is geverifieer deur spektrofotometrie (Eppendorf BioPhotometer) en/of deur inspeksie van 'n RNA gel. Eerste string cDNA is gesintetiseer vanaf RNA met behulp van Superscript omgekeerde transkriptase (Invitrogen) en 'n oligo(dT) primer (Sigma). Geen-spesifieke primers (Tabel 1) is dan gebruik om cDNA-fragmente deur PCR te amplifiseer. PCR is uitgevoer met behulp van 1 μl cDNA-sjabloon in 25 μl reaksiemengsel wat 3.5 mmol l –1 MgCl bevat2, 200 μmol l –1 van elke dNTP, 250 nmol l –1 elk van voorwaartse en terugwaartse primers, en 1 i.u. Taq-polimerase (New England Biolabs, Toronto, ON, Kanada) in PCR-buffer voorsien van die ensiem. Alle PCR-reaksies het 'n aanvanklike denaturering by 94°C vir 3 min behels, gevolg deur 39 siklusse van 94°C vir 30 s, uitgloeitemperatuur vir 30 s, 72°C vir 60 s, en eindig met 'n finale verlenging vir 10 min by 72 °C. PCR-produkte wat op hierdie manier verkry is, is gel-gesuiwer, in pCR2.0-TOPO-vektor (TOPO TA-kloningstel, Invitrogen) gekloneer en in volgorde bepaal. Die gevolglike volgordes is vergelyk met dié in die GenBank-databasis deur BLASTX te gebruik om die geen te identifiseer, en ook om primers (waar nodig) te ontwerp vir 3'- en 5'-vinnige amplifikasie van cDNA-punte (RACE) om die geamplifiseerde volgordelengtes te verleng. Vir 3'-RACE is cDNA gesintetiseer met behulp van 'n 3'-RACE adapter primer (Invitrogen) en Superscript II omgekeerde transkriptase (Invitrogen). Semi-geneste PCR is uitgevoer op die cDNA deur gebruik te maak van verkorte universele amplifikasie primers (AUAP Invitrogen) en geen-spesifieke 3'-RACE primers (Tabel 1). Vir 5'-RACE is cDNA gesintetiseer deur gebruik te maak van 'n geen-spesifieke primer (Tabel 1) en Superscript II omgekeerde transkriptase (Invitrogen), en dan gesuiwer met 'n PCR suiwering kit (Sigma). Die nuut gesuiwerde cDNA is gestert met dCTP deur gebruik te maak van 'n rekombinante terminale transferase TdT (Invitrogen) met finale reaksietoestande 10 mmol l -1 Tris-HCl (pH 8.4), 25 mmol l -1 KCl, 1.5 mmol l -1 MgCl2, 200 μmol l –1 dCTP, 1 μl cDNA en 1 μl rTdT. Die stert-cDNA is dan gebruik vir twee rondtes van PCR met behulp van 'n geen-spesifieke voorwaartse primer (Tabel 1) en 'n 5'-verkorte anker primer (5AP Invitrogen) vir die eerste rondte, en 'n semi-geneste geen-spesifieke vorentoe primer (Tabel) 1) en AUAP (Invitrogen) vir die tweede rondte. PCR produkte is gekloneer in die pCR2.0-TOPO vektor deur gebruik te maak van TOPO TA kloning kits (Invitrogen). Alle RACE-produkvolgordes is bevestig deur oorvleueling met die aanvanklike fragment van cDNA. Na herhaalde tweerigting-volgordebepaling van beide RACE-produkte, is 'n konsensusvolgorde geskep deur veelvuldige volgordebelyning met behulp van DNAMAN (v4.0, Lynnon Biosoft, Vaudreuil, QC, Kanada).

Primer volgordes gebruik vir kloning en amplifikasie van longvis koolsuur anhidrase, Na + /HCO3 - medetransporter en H + V-ATPase

Primer paar. Voorwaartse onderlaag. Omgekeerde onderlaag.
CA MGNCARWSICCIATHGAYAT TTCCARTGNACIARRTGIARYTC
CA3R1 TCCACCTTCCAGACCTGAAC
CA3R2 GAGTGCCCATTGTTGGAAAT
CA3R3 TCAGCAGTGTGGATGTCAATC
QCA TGGACCCCTTGCTGGACACTTCA ACCAATAACAGCCAGCCCGTCAG
NBC CATGCAGGGCGTGTTGGAGAGT AGGGCCAGTGCTGCTAAGAATCG
QNBC TTTCTGGGGCTGTCTTCTGT AATGCTGACCACAAGCCAAT
HV1 TGYGARTTYCANGGNGAYAT TTCATNGCYTGNACRTCRTT
HV2 GARGARATGATHCARCANGG TTCATNGCYTGNACRTCRTT
HV3R1 TCGGACTTTGAGGGAATGG
HV3R2 AAGCACTGCGAGAGGTGTCT
HV5R1 TGACGGTCCACGTAAATTTGT
HV5R2 TGTCATCATTTGGCATGGTC
HV5R3 CCGAGTGCTTCAGCATAAGA
QHV CCATGAAGGCGGTAGTCGGTGAG TTGGGGAAGATTCGCAGCAGC
18S GCCCTATCAACTTTCGATGG GGACATCTAAGGGCATCAC
V18S GGCGCTCCCTCGATGCTCTTAACT GTCCCTCTTAATCATGGCCCCAGTTC
Primer paar. Voorwaartse onderlaag. Omgekeerde onderlaag.
CA MGNCARWSICCIATHGAYAT TTCCARTGNACIARRTGIARYTC
CA3R1 TCCACCTTCCAGACCTGAAC
CA3R2 GAGTGCCCATTGTTGGAAAT
CA3R3 TCAGCAGTGTGGATGTCAATC
QCA TGGACCCCTTGCTGGACACTTCA ACCAATAACAGCCAGCCCGTCAG
NBC CATGCAGGGCGTGTTGGAGAGT AGGGCCAGTGCTGCTAAGAATCG
QNBC TTTCTGGGGCTGTCTTCTGT AATGCTGACCACAAGCCAAT
HV1 TGYGARTTYCANGGNGAYAT TTCATNGCYTGNACRTCRTT
HV2 GARGARATGATHCARCANGG TTCATNGCYTGNACRTCRTT
HV3R1 TCGGACTTTGAGGGAATGG
HV3R2 AAGCACTGCGAGAGGTGTCT
HV5R1 TGACGGTCCACGTAAATTTGT
HV5R2 TGTCATCATTTGGCATGGTC
HV5R3 CCGAGTGCTTCAGCATAAGA
QHV CCATGAAGGCGGTAGTCGGTGAG TTGGGGAAGATTCGCAGCAGC
18S GCCCTATCAACTTTCGATGG GGACATCTAAGGGCATCAC
V18S GGCGCTCCCTCGATGCTCTTAACT GTCCCTCTTAATCATGGCCCCAGTTC

Alle primers word in 'n 5′ tot 3′ oriëntasie aangebied

CA, koolstofanhidrase NBC, Na + /HCO3 - mede-vervoerder

Met behulp van rooibloedsel-cDNA as sjabloon, is 'n 315 basispaar (bp) interne segment van 'n CA-koderende streek (aangedui lfCAb) PCR geamplifiseer by 'n uitgloeitemperatuur van 46°C deur gebruik te maak van die primerpaar CA (Tabel 1). Hierdie gedegenereerde primers is ontwerp gebaseer op belynings van gewerwelde sitoplasmiese CA isovorme wat 'n hoë mate van aminosuurbewaring toon. Die volgorde is toe verleng met drie rondtes van 3'-RACE deur die geen-spesifieke primers CA3R1, CA3R2 en CA3R3 te gebruik.

'n 665 bp interne segment van die koderende gebied van NBC is PCR geamplifiseer teen 'n uitgloeiingstemperatuur van 57°C deur gebruik te maak van cDNA afkomstig van longviskieuwweefsel en die primerpaar NBC. Hierdie primers het ooreengestem met die nukleotiede op posisies 1492–1512 en 2183–2203 van die tiersalamander (Ambystoma tigrinum) nier NBC (GenBank-toetredingsnr. AF001958)(Romero et al., 1997). Die resulterende kloon, lfNBC, is geag van voldoende lengte vir die doeleindes van die huidige studie en daarom is geen poging aangewend om die volgordelengte met behulp van RACE uit te brei nie.

Met behulp van longviskieuwweefsel is 'n interne segment van die koderende gebied van die B subeenheid van V-tipe H + -ATPase (aangedui lfH + V-ATPase) PCR geamplifiseer deur gebruik te maak van die primerpaar HV1 by 'n uitgloeitemperatuur van 50°C. Hierdie primers, wat suksesvol deur Perry et al. (Perry et al., 2000) gebruik is om die reënboogforel V-tipe H + -ATPase B subeenheid te kloneer, stem ooreen met die nukleotiede op posisies 441–461 en 1395–1415 van die beesnier V-tipe H + -ATPase B subeenheid volgorde (GenBank toegangsnr. M88691) (Nelson et al., 1992). 'n Tweede rondte PCR was nodig om 'n 810 bp fragment te verkry. Hierdie PCR-rondte het die primerpaar HV2 by 'n uitgloeitemperatuur van 49°C gebruik. Die nuwe voorwaartse primer het ooreengestem met die nukleotiede by posisies 606-626 van die beesnier H + V-ATPase. Die volgordelengte is dan verder verleng deur twee rondtes van 3'-RACE deur gebruik te maak van geen-spesifieke primers HV3R1 en HV3R2, en deur 5'-RACE. Vir 5'-RACE is die geenspesifieke primer HV5R1 vir cDNA-sintese gebruik. Twee rondtes van 5'-RACE is dan uitgevoer met behulp van geen-spesifieke primers HV5R2 en HV5R3.

Die effek op die bloed suur-basis status van Afrika longvis Protopterus annectens van 1 uur (A–D) suur (3 mmol kg –1 NH4Cl) of (E–H) basis (3 mmol kg –1 NaHCO3) infusie. Suur-basisstatus voor en na die infusieperiode (gemerk deur die grys staaf) is geassesseer deur die pH (A,E), HCO te bepaal3 – ioonkonsentrasie ([HCO3 – ]) (B,F) en CO2spanning (PaCO2) (C,G) van arteriële bloed. (D,H)pH–HCO3 – diagramme word gebruik om die effek van suur- of basisinfusie op suur-basis status op te som. Waardes is middele± s.e.m. N=11 vir suur-geïnfuseerde vis en N=6–8 vir basis-geïnfuseerde vis. 'n Sterretjie ( * ) dui op 'n beduidende verskil van die voor-infusiewaarde (eenrigting herhaalde meet ANOVA P waardes word op die figuur aangedui). Vir pH-HCO3 – diagramme, die PCO2 vir 'n gegewe kombinasie van pH en [HCO – 3] is bereken deur gebruik te maak van die Henderson–Hasselbalch-vergelyking en die toepaslike waardes vir pK′and PaCO2(Boutilier et al., 1984). Die bufferlyn is gekonstrueer met behulp van data vir Protopterus aethiopicus(Lenfant en Johansen, 1968). Voor, periode voor suur- of basisinfusie.

Die effek op die bloed suur-basis status van Afrika longvis Protopterus annectens van 1 uur (A–D) suur (3 mmol kg –1 NH4Cl) of (E–H) basis (3 mmol kg –1 NaHCO3) infusie. Suur-basisstatus voor en na die infusieperiode (gemerk deur die grys staaf) is geassesseer deur die pH (A,E), HCO te bepaal3 – ioonkonsentrasie ([HCO3 – ]) (B,F) en CO2spanning (PaCO2) (C,G) van arteriële bloed. (D,H)pH–HCO3 – diagramme word gebruik om die effek van suur- of basisinfusie op suur-basis status op te som. Waardes is middele± s.e.m. N=11 vir suur-geïnfuseerde vis en N=6–8 vir basis-geïnfuseerde vis. 'n Sterretjie ( * ) dui op 'n beduidende verskil van die voor-infusiewaarde (eenrigting herhaalde meet ANOVA P waardes word op die figuur aangedui). Vir pH-HCO3 – diagramme, die PCO2 vir 'n gegewe kombinasie van pH en [HCO – 3] is bereken deur gebruik te maak van die Henderson–Hasselbalch-vergelyking en die toepaslike waardes vir pK′and PaCO2(Boutilier et al., 1984). Die bufferlyn is gekonstrueer met behulp van data vir Protopterus aethiopicus(Lenfant en Johansen, 1968). Voor, periode voor suur- of basisinfusie.

Filogenetiese en volgorde-ontledings

Longvis-afgeleide aminosuurvolgordes is in lyn gebring met GenBank-volgordes waarmee hoë identiteit getoon is (bepaal deur BLASTX-soektogte van GenBank-databasisse) met behulp van ClustalX weergawe 1.83 (Thompson et al., 1997) met boetes vir gapingsopening en gapingsverlenging gestel op 30 en 0.75 , onderskeidelik, vir paarsgewyse belynings, en 15 en 0.3, onderskeidelik, vir veelvuldige belynings. Let daarop dat vollengte-reekse van ander gewerwelde diere gepas afgekap is om slegs streke te vergelyk wat oorvleuel met die longvis-reekse. Die PHYLIP-pakket is toe gebruik om naaste-aansluitings-filogenetiese analise uit te voer (Saitou en Nei, 1987) op 'n matriks van gemiddelde karakterafstande, met 'n bootstrapping-hermonsteropsie om die ondersteuning vir nodusse (100 pseudoreplikate) te assesseer. Oor die algemeen is verstekparameters gebruik, behalwe dat die uitgroep gespesifiseer is (soos Drosophila) en die invoervolgorde van spesies is ewekansig gemaak waar moontlik. Die toegangsnommers vir rye wat in belynings of filogenetiese analise gebruik word, word in die toepaslike figuurlegendes aangebied.

Die effek op (A,B) die frekwensie van asemhaling van lug(flug A) en water (fwater B), en (C,D) CO2 uitskeiding in lug (lugCO2 C) en water (waterCO2D), van 'n 1 uur suur (3 mmol kg –1 NH4Cl) aftreksel (gemerk deur die grys staaf) in Afrika-longvisse Protopterus annectens. Waardes is gemiddeldes ± s.e.m. vir die tydperk voor suurinfusie (`pre'), en vir meetperiodes 0–1, 2–3, 5–6 en 17–18 uur na infusie N=9–11 vir asemhalingsfrekwensies en waterCO2,en 8 vir lugCO2. 'n Sterretjie ( * ) dui op 'n beduidende toename vanaf die voor-infusiewaarde (eenrigting RM-ANOVA P waardes word op die figuur aangedui) let op dat in A, post hoc veelvuldige vergelykings toetse was nie in staat om die oorsprong van die beduidende verskil aangedui deur die Pwaarde.

Die effek op (A,B) die frekwensie van asemhaling van lug(flug A) en water (fwater B), en (C,D) CO2 uitskeiding in lug (lugCO2 C) en water (waterCO2D), van 'n 1 uur suur (3 mmol kg –1 NH4Cl) aftreksel (gemerk deur die grys staaf) in Afrika-longvisse Protopterus annectens. Waardes is gemiddeldes ± s.e.m. vir die tydperk voor suurinfusie (`pre'), en vir meetperiodes 0–1, 2–3, 5–6 en 17–18 uur na infusie N=9–11 vir asemhalingsfrekwensies en waterCO2,en 8 vir lugCO2. 'n Sterretjie ( * ) dui op 'n beduidende toename vanaf die voor-infusiewaarde (eenrigting RM-ANOVA P waardes word op die figuur aangedui) let op dat in A, post hoc veelvuldige vergelykings toetse was nie in staat om die oorsprong van die beduidende verskil aangedui deur die Pwaarde.

Intydse PCR

Intydse PCR is gebruik om die uitdrukking van die verskillende longvis-mRNA's in kieu- en nierweefsel onder beheertoestande en na suur- of basisinfusie te assesseer. Totale RNA is met Trizol (Invitrogen) onttrek uit weefsels wat gehomogeniseer is tot poeier onder vloeibare N2 met 'n vysel en stamper, en het dan met 'n spuit deur 'n naald gegaan. Die onttrekde totale RNA is behandel met amplifikasiegraad DNase I (RNase vry Invitrogen) volgens die vervaardiger se instruksies vir 15 min by kamertemperatuur, gevolg deur 10 min by 70°C, om enige oorblywende genomiese DNA te verwyder. Die kwaliteit van die RNA is geverifieer deur spektrofotometrie (Molecular Devices, Sunnyvale, CA, VSA) en cDNA is dan gesintetiseer uit 2 μg RNA deur gebruik te maak van ewekansige heksamer primers (IDT DNA) en RevertAid M-MuLV H-minus (Fermentas, Burlington, ON, Kanada) volgens die vervaardiger se instruksies. 'n Briljante SYBR Green QPCR Master Mix-stel (Stratagene, Cedarlane Laboratories, Hornby, ON, Kanada) en Stratagene MX-4000 multipleks kwantitatiewe PCR-stelsel is toe gebruik om intydse PCR uit te voer, met ROX (Stratagene) as die verwysingskleurstof. Die PCR-toestande (finale reaksievolume 25 μl) was soos volg: 1 μl cDNA-sjabloon (let op dat vir 18S, die cDNA 1000-voudig verdun is), 100 nmol l –1 voorwaartse en terugwaartse primers, 12.5 μl 2x Master Mix, 0,375 μl van 1:1500 ROX finale verdunning. Die uitgloei- en verlengingstemperature oor 40 siklusse was onderskeidelik 58°C (30 s) en 72°C (30 s). Primerpare vir elke longvisgeen en longvis 18S is ontwerp met behulp van Primer3-sagteware en word in Tabel 1 gelys (pare aangedui as `Q'is vir intydse PCR gebruik). 'n 1150 bp segment van longvis 18S is uit kieuwweefsel gekloon deur gebruik te maak van die metodes hierbo beskryf en die primerpaar 18S (Tabel 1 uitgloeitemperatuur van 52°C), wat bestaan ​​het uit primers wat ontwerp is teen gebiede van hoë aminosuurbewaring wat geïdentifiseer is deur die ondersoek van 'n belyning van 18S-reekse van 'n reeks vertebrate. Die volgorde is dan gebruik om die intydse PCR 18S primers gelys in Tabel 1 te ontwerp. Die spesifisiteit van elke primer paar is geverifieer deur die kloning (TOPO TA kloning kit Invitrogen) en volgordebepaling van die geamplifiseerde produk. SYBR groen dissosiasie kurwes is gekonstrueer na die voltooiing van 40 PCR siklusse en het die teenwoordigheid van enkel amplikone vir elke primer paar geopenbaar. Die weglating van omgekeerde transkriptase tydens cDNA-sintese is gebruik as 'n kontrole om te verseker dat oorblywende genomiese DNA nie geamplifiseer word nie. Vir vergelykings tussen behandelings (kontrole, suur toegedien, basis toegedien), is mRNA uitdrukking relatief tot die kontrole groep bereken deur die gemodifiseerde delta-delta Ct metode (Pfaffl, 2001) met longvis 18S mRNA uitdrukking as 'n normaliserende faktor.

Die effek op (A,B) die frekwensie van asemhaling van lug(flug A) en water (fwater B), en (C,D) op CO2 uitskeiding in lug (lugCO2 C) en water (waterCO2D), van 'n 1 uur basis (3 mmol kg –1 NaCO3) aftreksel (gemerk deur die grys staaf) in Afrika-longvis Protopterus annectens. Waardes is gemiddeldes ± s.e.m. vir die tydperk voor basisinfusie (`pre'), en vir meetperiodes 0–1, 2–3, 5–6 en 17–18 uur na infusie N=8 deurgaans. 'n Sterretjie( * ) dui op 'n beduidende verskil van die voorinfusiewaarde (eenrigting RM-ANOVA P waardes word op die figuur aangedui).

Die effek op (A,B) die frekwensie van asemhaling van lug(flug A) en water (fwater B), en (C,D) op CO2 uitskeiding in lug (lugCO2 C) en water (waterCO2D), van 'n 1 uur basis (3 mmol kg –1 NaCO3) aftreksel (gemerk deur die grys staaf) in Afrika-longvis Protopterus annectens. Waardes is gemiddeldes ± s.e.m. vir die tydperk voor basisinfusie (`pre'), en vir meetperiodes 0–1, 2–3, 5–6 en 17–18 uur na infusie N=8 deurgaans. 'n Sterretjie( * ) dui op 'n beduidende verskil van die voorinfusiewaarde (eenrigting RM-ANOVA P waardes word op die figuur aangedui).

Statistiese ontledings

Data word gerapporteer as gemiddelde waardes ± 1 s.e.m. Die statistiese betekenisvolheid van behandelingseffekte is beoordeel deur eenrigting-herhaalde-metings-analise van variansie (RM-ANOVA). Waar eenrigting RM-ANOVA aangedui het dat beduidende verskille bestaan, a post hoc veelvuldige vergelykingstoets (Holm–Sidak-metode) is toegepas. Waar aannames van normaliteit of gelyke variansie geskend is, is ekwivalente nie-parametriese toetse gebruik. Statistiese ontledings is uitgevoer met behulp van SPSS SigmaStat v3.0 (Systat Software) sagteware met 'n fidusiële limiet van betekenisvolheid in alle toetse van 0,05.


Minerale vereistes van vis

Minerale is 'n tipe basiese elemente. Minerale elemente is die anorganiese elemente wat benodig word vir die bestuur en instandhouding van belangrike fisiologiese prosesse in die organisme. Sommige belangrike minerale is Kalsium, Fosfor, Natrium, Swael ens.Minerale dien as biologiese katalisators vir ensieme, hormone en proteïene in die liggaam.

Ongeveer 23 soorte anorganiese minerale verrig die nodige funksies in die organisme. Hiervan is 7 die minerale wat die liggaam in voldoende hoeveelheid benodig en na sulke minerale word verwys as makro-elemente. Aan die ander kant word 16 minerale in baie klein hoeveelhede in die liggaam van die organisme benodig, sulke minerale word mikro-elemente of spoorminerale genoem.

Sekondêre elemente speel 'n groot rol in die voeding en produksie van vis saam met ander minerale. Aanvullende kos en water dien as 'n bron van visminerale. Visse kan hierdie elemente as ione absorbeer met behulp van kieue en vel. Rui vis (Labeo rohita) kry noodsaaklike minerale van plankton en dambodemdiere en ontbinde organiese materiaal. In die afwesigheid van sulke elemente word die groei van vis verminder of siektes word deur plae veroorsaak, hul hoë teenwoordigheid belemmer ook die groeitempo van vis. Visse absorbeer nie net sulke anorganiese voedingstowwe deur voedsel nie, maar ook uit die eksterne akwatiese omgewing. Anorganiese elemente is onlosmaaklik verbind met die manier waarop visse leef.


Afsluiting

Onlangse vooruitgang in die hele liggaam suur-basis fisiologie sowel as epidemiologie het gelei tot 'n baie duideliker beeld van metaboliese suur-basis versteurings in die kritiek siek en beseerdes. Dit is nou moontlik om tradisionele beskrywende benaderings tot suur-basis-balans met moderne kwantitatiewe tegnieke te 'herenig'. Hierdie verenigde benadering is eenvoudig en deursigtig en kan maklik by die bed gebruik word. Dit behoort ook te help met toegang tot en interpretasie van die grootste deel van die kliniese literatuur. Soos reeds die neiging was, sal nuwer studies van suur-basis fisiologie ongetwyfeld voordeel trek uit kwantitatiewe tegnieke terwyl hulle voortgaan om meer tradisionele veranderlikes te rapporteer.


Kyk die video: Типы хозяйственных операций и их влияние на бухгалтерский баланс на примерах! (Oktober 2022).