Inligting

Hoe belangrik is die GC-klem wanneer primers ontwerp word?

Hoe belangrik is die GC-klem wanneer primers ontwerp word?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ek ontwerp 'n stel onderlaag en lees oor die beginsels van onderlaagontwerp, waarvan een is:

GC-klem: Die teenwoordigheid van G- of C-basisse binne die laaste vyf basisse vanaf die 3'-kant van primers (GC-klem) help om spesifieke binding aan die 3'-kant te bevorder as gevolg van die sterker binding van G- en C-basisse. Meer as 3 G'e of C'e moet vermy word in die laaste 5 basisse aan die 3' einde van die onderlaag.

Van hier af.

My vraag is hoe noodsaaklik is dit om 'n GC-klem te hê?


Dit is moeilik om 'n objektiewe antwoord te gee. As jy 'n ordentlike lengte en goeie kompleksiteit het, selfs 'n enkele terminale 3'GofCsal doen. Natuurlik moet 'n mens die onderlaag se geheel in ag neemGC:ATverhouding en dinge soos uitgloeitemperatuur.

Hier is 'n skakel na uiteenlopende menings oor die onderwerp en dit het hierdie nugget (waarop ek inteken wanneer moontlik):

FWIW, my voorkeuraanbiedinge aan die PCR-gode is primers met 'n enkele G of C 3', FWIW. Dit lyk of hulle hulle gelukkig hou in die meeste fases van die maan.


Ek sal my eie (empiriese) weergawe van onderlaagontwerp aanbied. 'n GC-klem help met spesifisiteit van die priming en dra dus by tot die algehele doeltreffendheid van die PCR-reaksie. In die verlede het ek (uit nood) primers ontwerp wat beide te veel GC-klemming aan die 3'-kant gehad het, en primers sonder enige GC-klem gebruik het. Hierdie PKR-reaksies is suksesvol uitgevoer, met verskillende vlakke van primer-dimeer vorming en algehele doeltreffendheid.

In my ervaring is GC-klem lekker, maar nie streng nodig vir goeie PCR nie. My algemene reël is om my primers waar moontlik met 2 G/C te beëindig. As iets gaan misluk, is dit gewoonlik nie die PCR nie.


GC-klem op 3', dit is om 'n enkele te hêGofCaan die 3' einde of 'n paar vanG/Cbinne die laaste 6bp by 3' einde van onderlaag, kan help om die onderlaag op die sjabloon te behou tydens verlenging, as gevolg van sterker binding in vergelyking metA=T. Dit is nie verpligtend nie; dit is een van die karakters van die primer wat jou PCR-reaksie kan verbeter.

Terselfdertyd, vermy 'n opeenvolgende kombinasie vanGCin die laaste 6bp wat tot selfdimere kan lei.

Voorbeeld:
5'-… GCGC-3'het 'n groter kans op dimeer vorming as5'-… GCCG-3'; in sulke gevalle kan jy steeds laasgenoemde primer-volgorde gebruik.


Tensy jy iets PCRing wat jy weet uitdagend is, gebruik net primer3 en moenie daaroor bekommer nie.

http://bioinfo.ut.ee/primer3-0.4.0/


Hoe om primers vir QPCR te ontwerp

Kwantitatiewe of intydse PCR word gebruik as 'n roetine-toets vir die monitering van die relatiewe veranderinge in geenuitdrukking onder verskillende eksperimentele toestande. Ontwerp van primers sowel as probes tydens QPCR is een van die mees deurslaggewende faktore wat die kwaliteit en sukses van die toets beïnvloed. Verskeie riglyne is van toepassing vir die ontwerp van primers vir QPCR: GC-inhoud van primers moet 35-65% wees. langer as 3 basisse, en die vorming van primer-dimere.

Sleutelareas gedek

1. Wat is QPCR
– Definisie, Proses, Gebruike
2. Hoe om primers vir QPCR te ontwerp
& # 8211 Riglyne vir die Primer Ontwerp vir QPCR

Sleutelterme: Fluorescerende kleurstowwe, GC-inhoud, Smelttemperatuur, Primers, Kwantitatiewe PCR (QPCR)


Onderlaag ontwerp - GC klem

Omdat G's en C's sterker bind as A en T, kan te veel van hulle aan die einde van ʼn primer veroorsaak dat die Tm verhoog en dit so maak dat die GC-klem van die primer te sterk is, wat dit nie toelaat nie van denaturering by die toepaslike temperatuur. Om 1 of 2 G's of C's aan die einde van die primer te hê, is ideaal, want dit maak voorsiening vir sterk binding van die primer aan die cDNA, wat dit meer spesifiek maak, sonder om te sterk te bind.

#3 Kuifie

#4 altobarn

#5 wilson_trace

Ek gebruik 'n Internet vrylik beskikbare sagteware om primers te ontwerp. Die instrument sal dan vir my sê of die onderlaag mooi ontwerp is of nie. In sommige gevalle kry ek die waarskuwing wat sê ''Daar is meer as 3 G's of C's in die laaste 5 basisse''. Wat sal gebeur as ek wel die onderlaag het in daardie geval?

Hi,
Sover ek weet, vergemaklik 'n hoë GC-inhoud die stywe binding van die oligo aan die sjabloon, maar verhoog ook die moontlikheid van mispriming.
Mag ek weet watter sagteware gebruik jy om jou primers na te gaan? Ek gebruik NetPrimer van Primer Biosoft: http://www.premierbi. imer/index.html

#6 fage434

#7 Bassaml7

#8 LaLeLi

Hierdie vraag oor die GC-klem op 3' ente van primers interesseer my baie.
Op die oomblik gebruik ek Primer 3 om primers uit 'n volgorde te kies en in die GC clamp parameter veld het ek GC clamp gelyk aan 0, 1 of 2 gekies en primers gekies vir elke situasie (alles anders gelyk). Die gevolglike omgekeerde primers was verskillend vir elkeen en slegs die voorwaartse primer wat voortspruit uit 'n situasie van 'n GC klamp = 0 was anders as die ander.

Ek het 'n paar probleme gehad om hierdie lokus te probeer versterk met die oorspronklike primers wat daarvoor ontwerp is. Hulle is veronderstel om in 'n bewaarde streek ('n ekson) te werk, maar die versterkings wat ek gekry het, was nooit konsekwent wanneer dit kom by die versterkte bandintensiteit nie. Ek het dus besluit om ander primers te probeer kies meer binne die eksons wat my teikenvolgorde flankeer, in die hoop om werkende primers te hê wat dalk nie aan enige vermoedelike mutasie onderwerp word nie.

So, ek wonder of die primers gekies met GC clamp = 0 'n minder spesifieke versterking sal dwing, maar aan die ander kant sal die veranderinge verhoog om enige produk te lewer, veral om daarna voort te gaan met volgordebepaling?


Resultate en bespreking

Om te bepaal of die GC-klem aan die 5'- of 3'-kant van elke PCR-fragment geheg moet word, moet die onderskeie smeltkaarte vergelyk word. As voorbeeld wys ons die teoretiese smeltkrommes van ekson 8 van die RET geen (Fig. 1A). Wanneer die GC-klem aan die voorste primer geheg is, is verskeie smeltdomeine voorspel (Fig. 1B). Wanneer 'n GC-klem egter aan die omgekeerde primer geheg word, word 'n ideale twee-domein smeltprofiel wat bestaan ​​uit 'n enkele plat onderste smeltdomein geskep. So 'n optimale twee-domein smeltprofiel word egter nie in alle situasies gevind nie. Dit laat die vraag ontstaan ​​of PCR-fragmente met onvolmaakte smeltdiagramme gebruik kan word vir die toepaslike opsporing van basispaarvariasies en of eenvoudige modifikasies van die PCR-fragmente/primervolgorde ongeskikte (DGGE) fragmente kan verander om geskik te word vir DGGE-analise terwyl dit steeds optimale handhaaf. mutasie opsporing. In die volgende bied ons voorbeelde van 'n aantal sulke situasies aan.

Veelvuldige smeltdomeine

Wanneer 'n DNS-fragment met twee of meer verskillende smeltdomeine geskei word deur elektroforese in 'n DGGE-gel, sal die fragment vasgekeer word op die posisie in die gel waar die denaturantkonsentrasie die fragment by sy laagste smeltdomein dissosieer. Soos wat mobiliteit afneem, sal die fragment moontlik nie die posisie in die jel bereik waar die tweede smeltdomein sal smelt nie. Die meeste van hierdie gedeeltelik gesmelte fragmente verskyn as skerp en gefokusde bande, wat die idee gee dat die fragment geskik is vir mutasie-opsporing deur DGGE. Wanneer fragmente twee smeltdomeine bevat (wat nie die GC-klem in ag neem nie), is die mees voor die hand liggende oplossing vir hierdie probleem om hierdie fragment in twee amplikone te verdeel. Dit is egter nie altyd nodig nie. Om te illustreer dat fragmente met onvolmaakte smeltkrommes vir DGGE gebruik kan word, bied ons ekson 13 van die MSH2 geen (Fig. 2A). Wanneer die fragment met 'n GC-klem ontleed is, kon ons slegs die 'ideale' smeltgrafiek kry wanneer die primer in die ekson geleë was. By die keuse van die GC-geklemde primer 99 bp stroomop van die intron-ekson-grens, het 'n (4°C) laer smeltdomein tussen die GC-klamp en 3'-end hoër smeltdomein van die fragment verskyn (Fig. 2B). Hierdie fragment het uitgesmelt as 'n smeer (Fig. 2C) en 'n bekende raamverskuiwingmutasie (del693T 9) kon nie opgespoor word nie (Fig. 2B). Wanneer 'n GC-geklemde primer 29 bp stroomop van die intron-ekson-grens gekies is, het die binneste laagste smeltdomein aan die 5'-end van die fragment 'n Tm waarde 1.0°C laer as die tweede domein (Fig. 2E). Die del693T mutasie kon maklik opgespoor word (Fig. 2F).

Uit hierdie voorbeeld en verskeie vergelykbare gevalle wat getoets is, kom ons tot die gevolgtrekking dat 'n fragment met 'n binneste laagsmeltende domein vir DGGE gebruik kan word, mits die Tm waarde van hierdie laagsmeltende domein verskil met nie meer as 1°C van die aangrensende domeine nie en is nie groter as 50–100 bp in lengte nie.

Veelvuldige smeltdomeine: teoretiese smeltkaarte en eksperimentele DGGE-analise vir MSH2 ekson 13 en sy flankerende introniese rye. (A) Smeltkaart van 'n 328 bp-fragment sonder GC-klem toon twee stabiele temperatuurdomeine. (B) Smeltkaart van die fragment met GC-klem toon 'n binnesmeltdomein met 'n Tm waarde wat met 4°C verskil van die tweede domein (soliede lyn). (C) Tydreis-DGGE-analise van die 328 bp-fragment met die GC-klem aan die 5'-kant. Die mutasie (del693T) kon nie opgespoor word nie. (D) Smeltkaart van 'n 258 bp-fragment sonder 'n GC-klem. 'n 70 bp introniese volgorde is verwyder van die 5'-punt van die oorspronklike 328 bp fragment. (E) Smeltkaart van die 258 bp-fragment met 'n GC-klem toon 'n binne-smeltdomein met 'n Tm waarde 0.5°C laer as die tweede domein (soliede lyn). (F) Tydreis-DGGE-analise van die 258 bp-fragment met die GC-klem aan die 5'-kant. Die mutasie (del693T) kon nou opgespoor word.

Veelvuldige smeltdomeine: teoretiese smeltkaarte en eksperimentele DGGE-analise vir MSH2 ekson 13 en sy flankerende introniese rye. (A) Smeltkaart van 'n 328 bp-fragment sonder GC-klem toon twee stabiele temperatuurdomeine. (B) Smeltkaart van die fragment met GC-klem toon 'n binne-smeltdomein met 'n Tm waarde wat met 4°C verskil van die tweede domein (soliede lyn). (C) Tydreis-DGGE-analise van die 328 bp-fragment met die GC-klem aan die 5'-kant. Die mutasie (del693T) kon nie opgespoor word nie. (D) Smeltkaart van 'n 258 bp-fragment sonder 'n GC-klem. 'n 70 bp introniese volgorde is verwyder van die 5'-punt van die oorspronklike 328 bp fragment. (E) Smeltkaart van die 258 bp-fragment met 'n GC-klem toon 'n binne-smeltdomein met 'n Tm waarde 0.5°C laer as die tweede domein (soliede lyn). (F) Tydreis-DGGE-analise van die 258 bp-fragment met die GC-klem aan die 5'-kant. Die mutasie (del693T) kon nou opgespoor word.

Aanhegting van G/C-nukleotiede

Wanneer 'n DNA-fragment uit drie smeltdomeine bestaan ​​(soos uitgebeeld in Fig. 3A) is mutasie-opsporing slegs moontlik in die laagste smeltende domein en is dit nie moontlik in die hoër (nie-gesmelte) domein nie. Wanneer hierdie laagste smeltende domein kort is, <50 bp, en op een van die punte van die fragment is (Fig. 3A), is 'n oplossing vir hierdie toestand die byvoeging van 'n stuk G/C-nukleotiede (drie tot sewe) tot hierdie doel. van die fragment deur die kort onderlaag. Hierdie gewysigde onderlaag sal die verhoog Tm waarde van die klein laagste smeltende domein en daardeur die vestiging van die gewenste twee-domein profiel bevorder. Om die resultate van die byvoeging van G- en/of C-reste by die kort onderlaag te illustreer, het ons ekson 7 van die BRCA2 geen (Fig. 3A). Om die smeltgedrag van die fragment te bepaal, het ons 'n mutasie in die voorwaartse primer bekendgestel (10). Die fragmente sonder 'n bykomende stuk GC-nukleotiede het 'n vermindering in mobiliteit getoon en verskyn as 'n enkele skerp gefokusde band na 5 uur elektroforese by 150 V (Fig. 3B). Die resultate kan slegs geïnterpreteer word as die afwesigheid van mutasies in hierdie fragment. Toe drie basisse (CGC) aan die 3'-kant van die fragment geheg is, deur die omgekeerde kort onderlaag, het die berekende smeltkaart van hierdie fragment voorspel dat die Tm van die laagste smeltende domein sal met ~1°C verskil van die ander domein (Fig. 3C). Alhoewel die smeltkurwe nie optimaal is nie, kon die mutasie opgespoor word na 7-8 uur elektroforese by 150 V (Fig. 3D). Wanneer vyf of sewe basisse by die 3'-kant van die fragment gevoeg is, is die teoretiese gewenste twee-domein profiel geskep en die mutasie is opgelos na 6-7 uur elektroforese by 150 V (data nie getoon nie).

Aanhegting van G/C-nukleotiede: teoretiese smeltkaarte en eksperimentele DGGE-analise vir BRCA2 ekson 7 en sy flankerende introniese rye. (A) Smeltkaart van 'n 203 bp-fragment sonder (soliede lyn) en met GC-klem (gestreepte lyn) toon veelvuldige smeltdomeine. (B) Tydreis-DGGE-ontleding van die 203 bp-fragment. Die fragment verskyn as 'n enkele gefokusde band en die mutasie kon nie opgespoor word nie. (C) Smeltkaart van die fragment sonder (soliede lyn) en met 'n GC-klem (gestreepte lyn) wys dat die Tm waarde van die laagste smeltende domein verskil slegs met ~1°C van die ander domein wanneer drie basisse (GCG) by die 3'-end gevoeg word. (D) Tydreis-DGGE-analise van die fragment met drie basisse (GCG) bygevoeg by die omgekeerde kort primer. Die mutasie word maklik opgespoor.

Aanhegting van G/C-nukleotiede: teoretiese smeltkaarte en eksperimentele DGGE-analise vir BRCA2 ekson 7 en sy flankerende introniese rye. (A) Smeltkaart van 'n 203 bp-fragment sonder (soliede lyn) en met GC-klem (gestreepte lyn) toon veelvuldige smeltdomeine. (B) Tydreis-DGGE-ontleding van die 203 bp-fragment. Die fragment verskyn as 'n enkele gefokusde band en die mutasie kon nie opgespoor word nie. (C) Smeltkaart van die fragment sonder (soliede lyn) en met 'n GC-klem (gestreepte lyn) wys dat die Tm waarde van die laagste smeltende domein verskil slegs met ~1°C van die ander domein wanneer drie basisse (GCG) by die 3'-end gevoeg word. (D) Tydreis-DGGE-analise van die fragment met drie basisse (GCG) bygevoeg by die omgekeerde kort primer. Die mutasie word maklik opgespoor.

Dus, gebaseer op rekenaarberekeninge en praktiese eksperimentering, stel ons voor dat die aanhegting van 'n klein stuk G/C-nukleotiede aan die kort primer mutasie-opsporing onder hierdie toestande kan verbeter. Daar moet egter op gelet word dat die rek van G/C-nukleotiede nie 10 basisse moet oorskry nie, aangesien dit 'n klein hoogs GC-ryke gedeelte in die fragment sal inbring, wat sal lei tot smere of diffuse bande in 'n DGGE-gel (data nie getoon nie) ).

Aanhegting van A/T-nukleotiede

Wanneer volgorde-inligting beperk is, kan dit onmoontlik wees om primers te kies sonder om 'n GC-ryke domein naby die GC-klem-aanhegtingsplek van die fragment te hê (Fig. 4A). As gevolg hiervan sal mutasies in hierdie hoër smeltdomeine gemis word. Ons het veronderstel dat die invoeging van 'n stuk van 15–20 T-nukleotiede tussen die GC-klem en die spesifieke primer die Tm waarde van die GC-ryke volgorde en maak daardeur mutasie-opsporing moontlik in die hoër smeltdomein. Om dit te toets het ons ekson 9 van die MSH2 geen (Fig. 4A). Om die (teoreties) gewenste twee-domein-smeltprofiel te verkry, moes 20 T-nukleotiede by die 3'-kant of 15 T-nukleotiede by die 5'-punt tussen die GC-klem en spesifieke primer ingevoeg word (Fig. 4C). Om dit te toets, het ons 'n g→t-vervanging ondersoek wat geleë is by die splitsingsaannemerplek in intron 8 (9) teenwoordig in 'n hoogsmeltende domein. Soos verwag, gegewe sy ligging binne die hoogs GC-ryke gedeelte by nukleotiedposisie -1 (Fig. 4A), kon die mutasie nie opgespoor word wanneer die GC-klem direk aan die voorwaartse primer geheg is nie (Fig. 4B). Die mutasie is egter opgespoor toe 15 T-nukleotiede tussen die GC-klem en die voorwaartse primer ingevoeg is (Fig. 4D).

Aanhegting van A/T-nukleotiede: teoretiese smeltkaarte en eksperimentele DGGE-analise vir MSH2 ekson 9 en sy flankerende introniese rye. (A) Smeltkaart van 'n 208 bp-fragment met 'n GC-klem aan beide kante toon hoogsmeltende domeine aan weerskante. (B) Tydreis-DGGE-analise van die 208 bp-fragment met die GC-klem aan die 5'-punt. 'n Splitsingsplekmutasie geleë binne die hoogsmeltende domein kon nie opgespoor word nie. (C) Smeltkaart van die fragment toon 'n optimale twee-domein smeltprofiel wanneer 20 T nukleotiede tussen die omgekeerde primer en die GC-klem (gestreepte lyn) of 15 T nukleotiede tussen die voorwaartse primer en die GC-klem (soliede lyn) ingevoeg word. . (D) Tydreis DGGE analise van die 208 bp fragment met 15 T nukleotiede tussen die voorwaartse primer en die GC-klem. Die mutasie is duidelik sigbaar.

Aanhegting van A/T-nukleotiede: teoretiese smeltkaarte en eksperimentele DGGE-analise vir MSH2 ekson 9 en sy flankerende introniese rye. (A) Smeltkaart van 'n 208 bp-fragment met 'n GC-klem aan beide kante toon hoogsmeltende domeine aan weerskante. (B) Tydreis-DGGE-analise van die 208 bp-fragment met die GC-klem aan die 5'-punt. 'n Splitsingsplekmutasie geleë binne die hoogsmeltende domein kon nie opgespoor word nie. (C) Smeltkaart van die fragment toon 'n optimale twee-domein smeltprofiel wanneer 20 T nukleotiede tussen die omgekeerde primer en die GC-klem (gestreepte lyn) of 15 T nukleotiede tussen die voorwaartse primer en die GC-klem (soliede lyn) ingevoeg word. . (D) Tydreis DGGE analise van die 208 bp fragment met 15 T nukleotiede tussen die voorwaartse primer en die GC-klem. Die mutasie is duidelik sigbaar.

Die invoeging van T-nukleotiede tussen die GC-klamp en spesifieke primer maak mutasie-opsporing moontlik in klein hoogs GC-ryke streke naby die GC-geklemde primer.

Hoogsmeltende domein aan die einde van 'n DNS-fragment: teoretiese smeltkaarte en eksperimentele DGGE-analise vir RET ekson 13 en sy flankerende introniese rye. (A) Die smeltkaart van 'n 278 bp-fragment sonder GC-klem (soliede lyn) toon 'n hoogsmeltende domein aan die 3'-punt. 'n Ideale twee-domein profiel word verkry deur 'n GC-klem aan die 5'-kant (gestreepte lyn) te heg. (B) Tydreis-DGGE-analise van die 278 bp-fragment met 'n hoogsmeltende domein aan die 3'-kant. Die fragment het onduidelike bande gegee en die mutasie (S767R) kon nie opgespoor word nie. (C) Smeltkaart van 'n 234 bp-fragment sonder GC-klem (soliede lyn) toon 'n enkele smeltdomein. 'n 44 bp introniese volgorde is verwyder van die 3'-punt van die 278 bp fragment. Smeltkaart van die 234 bp-fragment met GC-klem (gestreepte lyn) toon twee domeine met effens verskillende Tm. (D) Tydreis-DGGE-analise van die 234 bp-fragment sonder 'n hoë smeltdomein aan die 3'-kant.Die mutasie (S767R) is duidelik sigbaar.

Hoogsmeltende domein aan die einde van 'n DNS-fragment: teoretiese smeltkaarte en eksperimentele DGGE-analise vir RET ekson 13 en sy flankerende introniese rye. (A) Die smeltkaart van 'n 278 bp-fragment sonder GC-klem (soliede lyn) toon 'n hoogsmeltende domein aan die 3'-punt. 'n Ideale twee-domein profiel word verkry deur 'n GC-klem aan die 5'-kant (gestreepte lyn) te heg. (B) Tydreis-DGGE-analise van die 278 bp-fragment met 'n hoogsmeltende domein aan die 3'-kant. Die fragment het onduidelike bande gegee en die mutasie (S767R) kon nie opgespoor word nie. (C) Smeltkaart van 'n 234 bp-fragment sonder GC-klem (soliede lyn) toon 'n enkele smeltdomein. 'n 44 bp introniese volgorde is verwyder van die 3'-punt van die 278 bp fragment. Smeltkaart van die 234 bp-fragment met GC-klem (gestreepte lyn) toon twee domeine met effens verskillende Tm. (D) Tydreis-DGGE-analise van die 234 bp-fragment sonder 'n hoë smeltdomein aan die 3'-kant. Die mutasie (S767R) is duidelik sigbaar.

Hoogsmeltende domein aan die einde van 'n DNA-fragment

Ons het verskeie amplikone teëgekom met perfekte smeltkurwes (fragmente met GC-klem) wat egter, wanneer dit in 'n DGGE-gel geëlektroforeer is, tot smere of diffuse bande gelei het. Met ontleding van die smeltkurwe van die inheemse volgordes (fragmente sonder GC-klem), het ons waargeneem dat 'n hoogsmeltende domein aan die een kant van die fragment teenwoordig was. Die effek van hierdie hoogsmeltende domein op mutasie-opsporing deur DGGE kan geïllustreer word deur 'n ontleding van ekson 13 van die RET geen (Fig. 5A). Die DGGE-analise van 'n T→G-vervanging (S767R) in ekson 13 van die RET geen wat by nukleotiedposisie 18 van die fragment geleë is, toon dat slegs onduidelike bande waargeneem kan word (Fig. 5B). Dit demonstreer 'n verskil tussen die teoretiese smeltplot bereken deur MELT87 en die praktiese 'regte' smeltgedrag van die PCR-fragment. Die maklikste manier om hierdie probleem op te los, is om die GC-ryke volgorde te verwyder. In hierdie geval kan ons 44 bp van die 3′-end van die fragment verwyder sonder om enige van die koderingsvolgorde te verwyder. Alhoewel die teoretiese smeltkurwe nie perfek is nie (Figuur 5C), toon Figuur 5D vier afsonderlike bande. Soortgelyke teoretiese data en praktiese waarnemings is verkry vir eksons 14 en 15 van die RET geen (data nie gewys nie). Aangesien dit gerapporteer is dat 'n kort stuk AT-ryke volgorde die Tm waarde van 'n klein GC-ryke streek (11), het ons probeer om die bogenoemde probleem op te los deur 'n stuk van sewe AT-nukleotiede by die 3'-end van die omgekeerde kort primer in te voer. Dit was egter onsuksesvol (data nie getoon nie). Gebruik van 'n langer stuk AT-nukleotiede (>20 nt) sal 'n lae smeltende domein bekendstel wat lei tot 'n nie-optimale drie-domein struktuur.

Hoogsmeltende domein in die middel van 'n fragment: teoretiese smeltkaart en eksperimentele DGGE-analise vir CFTR ekson 2 en sy flankerende introniese rye. (A) Smeltkaart van 'n 217 bp-fragment sonder GC-klem (soliede lyn) toon 'n hoogsmeltende domein in die middelste deel van hierdie fragment. 'n Ideale twee-domein profiel word verkry deur 'n GC-klem aan die 3'-kant (gestreepte lyn) te heg. (B) DGGE-analise van die 217 bp-fragment toon die opsporing van al drie mutasies deur die teenwoordigheid van drie of vier bande. Lane 1–4 toon 'n kontrolemonster, onderskeidelik 186-13c→g, 241delAT en 296+2t→c.

Hoogsmeltende domein in die middel van 'n fragment: teoretiese smeltkaart en eksperimentele DGGE-analise vir CFTR ekson 2 en sy flankerende introniese rye. (A) Smeltkaart van 'n 217 bp-fragment sonder GC-klem (soliede lyn) toon 'n hoogsmeltende domein in die middelste deel van hierdie fragment. 'n Ideale twee-domein profiel word verkry deur 'n GC-klem aan die 3'-kant (gestreepte lyn) te heg. (B) DGGE-analise van die 217 bp-fragment toon die opsporing van al drie mutasies deur die teenwoordigheid van drie of vier bande. Lane 1–4 toon 'n kontrolemonster, onderskeidelik 186-13c→g, 241delAT en 296+2t→c.

Lengte van GC-klem: teoretiese smeltkaart en eksperimentele DGGE-analise vir RET ekson 5 en sy flankerende introniese rye. (A) Smeltkaarte van 'n fragment van 295 bp met 'n GC-klem van 40 (soliede lyn) en van 60 bp (gestreepte lyn) toon soortgelyke smeltprofiele. (B) Tydreis-DGGE-analise van die 295 bp-fragment met 'n 40 bp GC-klem. Die fragment verskyn as diffuse bande na 8 uur elektroforese by 150 V. (C) Tydreis-DGGE-analise van die 295 bp-fragment met 'n 60 bp GC-klem. Die fragment gee 'n skerp gefokusde band.

Lengte van GC-klem: teoretiese smeltkaart en eksperimentele DGGE-analise vir RET ekson 5 en sy flankerende introniese rye. (A) Smeltkaarte van 'n fragment van 295 bp met 'n GC-klem van 40 (soliede lyn) en van 60 bp (gestreepte lyn) toon soortgelyke smeltprofiele. (B) Tydreis-DGGE-analise van die 295 bp-fragment met 'n 40 bp GC-klem. Die fragment verskyn as diffuse bande na 8 uur elektroforese by 150 V. (C) Tydreis-DGGE-analise van die 295 bp-fragment met 'n 60 bp GC-klem. Die fragment gee 'n skerp gefokusde band.

As die smeltontleding van 'n kort fragment (<200 bp) 'n hoësmeltende domein <40 bp in grootte voorspel wat aan die einde van die fragment geleë is en met nie meer as 5°C verskil in Tm waarde, hierdie fragment is heel waarskynlik geskik vir DGGE-analise. Wanneer egter 'n hoësmeltende domein (>50 bp in grootte en verskil van die res met ~5°C in Tm waarde) aan die een kant van 'n DNA-fragment geleë is, kan dit die smeltgedrag van die fragment aansienlik beïnvloed, selfs na aanhegting van 'n GC-klem.

Natuurlik voorkomende klem: teoretiese smeltkaarte en eksperimentele DGGE-analise vir MSH2 ekson 1 en sy flankerende introniese rye. (A) Smeltkaart van 'n 271 bp fragment met 'n 40 bp GC-klem aan die 5'-punt (gestreepte lyn) toon 'n ideale twee-domein profiel. (B) Tydreis-DGGE-analise van die 271 bp-fragment met die 40 bp GC-klem. Die fragment het heeltemal enkelstrengig geword en het na 7 uur elektroforese by 150 V van die gel afgeloop. (C) Smeltkaart van 'n 299 bp fragment sonder GC-klem (soliede lyn) toon 'n natuurlik voorkomende hoogsmeltende domein van ~60 bp aan die 3'-punt. Smeltkaart van die 299 bp fragment met 'n 55 bp GC-klem wat 'n hoogsmeltende domein van ~100 bp aan die 3'-kant toon. (D) Tydreis-DGGE-ontleding van die 299 bp-fragment met die 55 bp GC-klem. Die fragment gee 'n enkele skerp band na 9 uur elektroforese by 150 V.

Natuurlik voorkomende klem: teoretiese smeltkaarte en eksperimentele DGGE-analise vir MSH2 ekson 1 en sy flankerende introniese rye. (A) Smeltkaart van 'n 271 bp fragment met 'n 40 bp GC-klem aan die 5'-punt (gestreepte lyn) toon 'n ideale twee-domein profiel. (B) Tydreis-DGGE-analise van die 271 bp-fragment met die 40 bp GC-klem. Die fragment het heeltemal enkelstrengig geword en het na 7 uur elektroforese by 150 V van die gel afgeloop. (C) Smeltkaart van 'n 299 bp fragment sonder GC-klem (soliede lyn) toon 'n natuurlik voorkomende hoogsmeltende domein van ~60 bp aan die 3'-punt. Smeltkaart van die 299 bp fragment met 'n 55 bp GC-klem wat 'n hoogsmeltende domein van ~100 bp aan die 3'-kant toon. (D) Tydreis-DGGE-analise van die 299 bp-fragment met die 55 bp GC-klem. Die fragment gee 'n enkele skerp band na 9 uur elektroforese by 150 V.

Hoogsmeltende domein in die middel van 'n fragment

Uit die voorafgaande is dit duidelik dat in die ontwerp van 'n DGGE mutasie opsporingstelsel, smeltkurwes van beide die vasgeklemde en die ongeklemde fragmente ondersoek moet word. In verskeie gevalle het ons 'n GC-ryke domein in die middel van 'n fragment gevind, sigbaar as 'n piek in die smeltprofiel van die inheemse volgorde, maar nie gesien na toevoeging van 'n GC-klem nie (Fig. 6A). Om te bepaal of so 'n hoogsmeltende domein 'n invloed het op die opsporing van mutasies in die domein, het ons ondersoek CFTR ekson 2, waarvan die smeltkaart met en sonder 'n 3'-GC-klem in Figuur 6A getoon word. Ons het drie bekende mutasies ondersoek wat in die middel van hierdie fragment geleë is: 186-13c→g by nukleotiedposisie −13 241delAT by nukleotiedposisie 39 van die fragment, geleë in die piek van die smeltdomein (79°C) 296+2t→c by nukleotiedposisie +2 (Fig. 6A). Figuur 6B toon 'n DGGE-analise van die drie mutasies in ekson 2 van die CFTR geen. Al drie mutasies is maklik opgespoor. Soortgelyke teoretiese data en praktiese waarnemings is verkry vir ekson 5 van die TP53 geen, wat 'n ietwat breër piek in die middel van die fragment het (data nie gewys nie). Mutasies wat in sulke hoogsmeltende domeine geleë is, vorm dus nie 'n probleem vir opsporing nie.

Vir DGGE moet verkieslik kort PCR-fragmente (<300 bp) gekies word, want 'n GC-klem het 'n sterker effek op die smelteienskappe van kort fragmente. Fragmente wat geskik is vir DGGE kan dus makliker gegenereer word. In lang fragmente (>400 bp), kan 'n groot interne hoogsmeltende domein (100 bp) 'n wesenlike impak hê, aangesien die GC-klem relatief min effek het op die smeltgedrag van die sentrale gedeelte, byvoorbeeld, ekson 4 van die TP53 geen (11). Mutasies geleë in die hoogsmeltende domein (100 bp lank, verskil met 6°C in Tm waarde) en in die domein tussen hierdie hoogsmeltende domein en GC-klem kon nie opgespoor word met behulp van 'n enkele PCR-fragment in DGGE (data nie getoon nie).

Ons kom tot die gevolgtrekking dat terwyl die teenwoordigheid van 'n hoogsmeltende domein in die middel van 'n klein fragment (<300 bp) steeds 'n goeie mutasie-analise moontlik maak, maak die teenwoordigheid daarvan in die middel van 'n groot PCR-fragment (>400 bp) die fragment ongeskik vir DGGE-analise .

Lengte van GC-klem

Verskeie studies (3, 5) het aangedui dat 'n GC-klem so kort as 30 bp voldoende sal wees in DGGE. Dit kan waar wees vir AT-ryke fragmente, maar vir 'n GC-ryke volgorde is die verskil in Tm met 'n GC-klem kan dalk te klein word. Selfs die standaard 40 bp GC-klem is dalk nie voldoende om totale string dissosiasie te voorkom nie. Hier demonstreer ons die effek van die lengte van die GC-klem op GC-ryke fragmente met ekson 5 van die RET geen as voorbeeld. Die smeltontleding van die fragment het 'n aan die lig gebring Tm waarde van 80°C. Aanhegting van 40 en 60 bp GC-klemme aan die 3'-kant van die fragment het soortgelyke teoretiese smeltprofiele gegee (Fig. 7A). Die fragment met die 40 bp GC-klamp word heeltemal enkelstrengig en loop van die jel af (Fig. 7B en ook Fig. 8A en B), terwyl die 60 bp GC-geklemde fragment as 'n enkele skerp band gesmelt het (Fig. 7C ).

Vir uiters GC-ryke reekse (Tm > 80°C), soos gewoonlik die geval is vir die eerste ekson van die meeste gene, die verskil in Tm waardes tussen GC-klem en teikenvolgorde kan so klein wees dat selfs 'n 60 bp GC-klem dalk nie voldoende is om totale string dissosiasie te voorkom nie, alhoewel die smeltkurwe perfek kan wees. Indien moontlik, kan 'n natuurlik voorkomende, hoogsmeltende domein in kombinasie met 'n langer GC-klem gebruik word (Fig. 8C). As voorbeeld wys ons ekson 1 van die MSH2 geen (Fig. 8A-D). Wanneer die smeltgedrag van 'n 299 bp fragment ontleed word, word 'n natuurlik voorkomende, hoogsmeltende domein van ~60 bp aan die 3'-punt van die fragment sigbaar (Fig. 8C). Deur 'n 55 bp GC-klem by die 3'-kant van hierdie molekule te voeg, is 'n hoogsmeltende domein van ~100 bp geskep (Fig. 8C). Wanneer hierdie PCR-fragment in 'n DGGE-gel uitgevoer word, het dit gelei tot 'n enkele skerp band wat by 'n toepaslike UF-konsentrasie smelt (Fig. 8D).

Ons kom tot die gevolgtrekking dat vir fragmente met 'n Tm waarde naby aan 80°C sal 'n GC-klem met 'n lengte van 60 bp mutasie-opsporing verbeter. DGGE vir fragmente met 'n Tm waarde >80°C is dalk net moontlik wanneer gebruik gemaak word van 'n lang GC-klem in kombinasie met 'n 'natuurlik' voorkomende GC-ryke domein.


ONTWERP PCR PRIMERS

AGTERGROND INLIGTING: Vir webwerwe wat PCR-teorie beskryf, sowel as maatskappye wat PCR-produkte bemark, wil jy dalk begin deur Highveld te besoek. Vir PCR-tegnieke sien PCRlink.com.

Daar is verskeie uitstekende webwerwe vir die ontwerp van PCR-primers:

Primer3: WWW primer instrument (Universiteit van Massachusetts Mediese Skool, V.S.A.) &ndash Hierdie webwerf het 'n baie kragtige PCR primer ontwerp program wat 'n mens aansienlike beheer oor die aard van die primers toelaat, insluitend die grootte van die produk wat verlang word, primer grootte en Tm reeks, en die teenwoordigheid/afwesigheid van 'n 3&rsquo-GC klamp.
GeneFisher - Interaktiewe PCR Primer Ontwerp (Universitat Bielefeld, Duitsland) - 'n baie goeie webwerf wat groot beheer oor onderlaagontwerp moontlik maak.

Primer3Plus - 'n nuwe verbeterde webkoppelvlak na die gewilde Primer3 primer ontwerpprogram (Verwysing: A. Untergasser et al. 2007. Nucl. Acids Res. 35(Webbediener-kwessie):W71-W74)
BiSearch Primer Design and Search Tool - dit is 'n nuttige hulpmiddel vir primer-ontwerp vir enige DNA-sjabloon en veral vir bisulfiet-behandelde genome. Die ePCR-instrument bied vinnige opsporing van mispriming-terreine en alternatiewe PCR-produkte in cDNA-biblioteke en inheemse of bisulfiet-behandelde genome. (Verwysing: Arányi T et al. 2006. BMC Bioinformatics 7: 431).

Primer-BLAST is by NCBI ontwikkel om gebruikers te help om primers te maak wat spesifiek is vir die invoer-PCR-sjabloon. Dit gebruik Primer3 om PCR-inleiders te ontwerp en stuur dit dan na BLAST-soektog teen gebruiker-geselekteerde databasis voor. Die ontploffingsresultate word dan outomaties ontleed om primerpare te vermy wat versterking van ander teikens as die insetsjabloon kan veroorsaak.

MFEprimer stel gebruikers in staat om primer spesifisiteit teen genomiese DNA en boodskapper RNA/komplementêre DNA volgorde databasisse vinnig en maklik na te gaan. Hierdie bediener gebruik 'n k-mer-indeksalgoritme om die soekproses vir primerbindingsplekke te versnel en gebruik termodinamika om bindingstabiliteit tussen elke primer en sy DNA-sjabloon te evalueer. Verskeie belangrike eienskappe, soos die volgorde, smelttemperatuur en grootte van elke amplikon, hetsy spesifiek of nie-spesifiek, word gerapporteer. (Verwysing: Qu W et al. 2012. Nucl. Acids Res. 40 (Webbediener-kwessie): W205-W208)

Primer Ontwerp en Soek Gereedskap

PrimerDesign-M - sluit verskeie opsies vir meervoudige primer-ontwerp in, wat navorsers in staat stel om doeltreffend loop-primers te ontwerp wat lang DNA-teikens dek, soos hele MIV-1-genome, en wat primers gelyktydig deur genetiese diversiteit in veelvuldige belynings en eksperimentele ontwerpbeperkings optimeer deur die gebruiker gegee. PrimerDesign-M kan ook primers ontwerp wat DNA-strepieskodes insluit en primer dimerization minimaliseer. PrimerDesign-M vind optimale primers vir hoogs veranderlike DNA-teikens en fasiliteer ontwerp buigsaamheid deur alternatiewe ontwerpe voor te stel om aan te pas by eksperimentele toestande. (Verwysing: Yoon H & Leitner T. 2015. Bioinformatika 31:1472-1474).

RF-kloning (Beperkingsvrye kloning) - is 'n PCR-gebaseerde tegnologie wat uitbrei op die QuikChange&trade mutagenese proses wat oorspronklik deur Stratagene in die middel 1990's gewild is, en laat die invoeging van in wese enige volgorde in enige plasmied op enige plek toe. (Verwysing: Bond SR & Naus BK. 2012. Nucl. Acids Res 40(Webbediener-kwessie): W209-W213)

primers4clades - is 'n pyplyn vir die ontwerp van PCR-inleiders vir kruis-spesie amplifikasie van nuwe volgordes vanaf metagenomiese DNA of van ongekarakteriseerde organismes wat aan gebruiker-gespesifiseerde filogenetiese afstammelinge behoort. Dit implementeer 'n uitgebreide CODEHOP-strategie gebaseer op beide DNA en proteïen veelvuldige belynings van koderende gene en evalueer termodinamiese eienskappe van die oligonukleotiedpare, sowel as die filogenetiese inligtinginhoud van voorspelde amplikone, bereken uit die takondersteuningswaardes van maksimum-waarskynlikheidsfilogenieë. Bome wat op die skerm vertoon word, maak dit maklik om primers op interaktief geselekteerde klades te rig. (Verwysing: Contreras-Moreira B et al. 2009. Nucleic Acids Res. 37(Webbediener-kwessie):W95-W100).

TaxMan: Inspekteer jou rRNA-amplikone en taksa-toewysings - In mikrobioomontledings word rRNA-geendatabasisse dikwels gebruik om taksonomiese name aan volgordelees toe te ken. Die TaxMan-bediener vergemaklik die ontleding van die taksonomiese verspreiding van jou leeswerk op twee maniere. Eerstens kan jy kyk watter taksonomiese name toegeken word aan die rye wat deur jou primers geproduseer word en watter taksa jy sal verloor. Tweedens kan die geproduseerde amplikonreekse met afstammelinge in die FASTA-kopskrif afgelaai word. Dit kan lei tot 'n baie meer doeltreffende analise met betrekking tot hardlooptyd en geheuegebruik, aangesien die amplikonvolgordes aansienlik korter is as die vollengte rRNA geenvolgorde. Daarbenewens kan jy 'n afstammingslêer aflaai wat die tellings van alle taksa vir jou primers en vir die gebruikte verwysing insluit. (Verwysing: Brandt, B.W. et al. 2012. Nucleic Acids Research 40:W82-W87).

Oligonukleotied fisies-chemiese parameters:

NetPrimer (Premier Biosoft International, V.S.A.) - Na my mening die beste webwerf aangesien dit een bied met Tm, termodinamiese eienskappe en mees stabiele haarnaald en dimers. MAAR dit neem 'n rukkie vir die program om te laai.

dnaMATE - bereken 'n konsensus Tm vir kort DNS-volgorde (16-30 nts) deur 'n saamgevoegde metode te gebruik wat op drie verskillende termodinamiese tabelle gebaseer is. Die konsensus Tm-waarde is 'n robuuste en akkurate skatting van smelttemperatuur vir kort DNS-reekse van praktiese toepassing in molekulêre biologie. Akkuraatheid maatstawwe wat alle eksperimentele data beskikbaar gebruik, dui aan dat die konsensus Tm voorspellingsfoute binne 5 ºC vanaf die eksperimentele waarde in 89% van die gevalle sal wees. (Verwysing: A. Panjkovich et al. 2005. Nucl. Sure Res. 33: W570-W572.).

OligoCalc - 'n aanlyn oligonukleotied eienskappe sakrekenaar - ( Verwysing: W.A. Kibbe. 2007. Nucl. Acids Res. 35 (Web Server uitgawe): W43-W46)
Oligo-analiseerder 3.1 (Integrated DNA Technologies, Inc.)
Mongo Oligo Massasakrekenaar v2.06
Oligo-evalueerder (Sigma -Aldrich)
Oligo-berekeningsinstrument (Genescript, V.S.A.) - laat wysiging toe

PCR-primers gebaseer op proteïenvolgorde:

As jy die proteïenvolgorde het en die DNA-volgorde wil hê, is die beste plekke Proteïen-na-DNS-omgekeerde vertaling of Omgekeerde Vertaling deel van die Sequence Manipulation Suite. As jy belangstel om 'n spesifieke aminosuur in 'n ander te verander, moet jy Primaclade raadpleeg (Verwysing: Gadberry MD et al. 2005. Bioinformatics 21:1263-1264).

PCR en kloning:

AMUSER (Ageoutomatiseerde DNA M.odifikasies met GEBRUIKER kloning) bied 'n vinnige en maklike ontwerp van PCR-primers wat geoptimaliseer is vir verskeie GEBRUIKER-kloninggebaseerde DNA-ingenieurswese. GEBRUIKER kloning is 'n vinnige en veelsydige metode vir die ingenieurswese van plasmied DNA. Hierdie webbediener-instrument outomatiseer die ontwerp van optimale PCR-primers vir verskeie afsonderlike GEBRUIKER-kloning-gebaseerde toepassings.Dit vergemaklik DNS-samestelling en bekendstelling van feitlik enige tipe plekgerigte mutagenese deur optimale PCR-inleiders vir die verlangde genetiese veranderinge te ontwerp. (Verwysing: Genee HJ et al. 2015. ACS Synth Biol. 4:342-349).

Genomiese skaal primers: (N.B. sien ook die JAVA-bladsy vir bykomende aflaaibare programme)

Die PCR Suite (Klinische Genetica, Erasmus MC Rotterdam, Nederland) - dit is 'n reeks van vier programme gebaseer op Primer3 vir genomiese primer ontwerp. Almal bied aansienlike beheer oor onderlaag eienskappe:

Overlapping_Primers - skep verskeie oorvleuelende PCR-produkte in een volgorde.
Genomic_Primers - ontwerp primers rondom eksons in genomiese volgorde. Al wat jy nodig het, is 'n GenBank-lêer wat jou geen bevat.
SNP_Primers - ontwerp primers rondom elke SNP in 'n GenBank-lêer.
cDNA_Primers - ontwerp primers rondom oop leesrame. Laai eenvoudig 'n GenBank-lêer op wat jou gene bevat.

Oorvleuelende onderlaagstelle:

Twee webwerwe bied sagteware is gebaseer op die Primer3-program vir die ontwerp van oorvleuelende PCR-primer-paarstelle - Veelvuldige Primer-ontwerp met Primer 3 en oorvleuelende Primersets

PHUSER (Primer H.elp vir GEBRUIKER ) - Uracil-Specific Exision Reagent (USER) samesmelting is 'n onlangs ontwikkelde tegniek wat die samestelling van veelvuldige DNA-fragmente in 'n paar eenvoudige stappe moontlik maak. PHUSER bied vinnige en maklike ontwerp van PCR-geoptimaliseerde primers wat die rigting-korrekte samesmelting van fragmente in 'n plasmied verseker wat 'n aanpasbare GEBRUIKER-kasset bevat. Die primers het soortgelyke uitgloeiingstemperatuur (Tm). PHUSER vermy ook identiese oorhange, waardeur die korrekte volgorde van samestelling van DNA-fragmente verseker word. Alle moontlike primers word individueel ontleed in terme van GC inhoud, teenwoordigheid van GC klamp aan 3'-end, die risiko van primer dimeer vorming, die risiko van intra-primer sekondêre strukture en die teenwoordigheid van polyN strek. (Verwysing: Olsen LR et al. 2011. Nucl. Acids Res. 39 (Webbediener-kwessie): W61-W70)

Primerize is 'n webbediener vir primerontwerpe van DNA-volgorde PCR-samestelling. Primerize is geoptimaliseer om primer-grense mispriming te verminder, is ontwerp vir vaste volgordes van RNA-probleme, en het wye en streng toetse geslaag. Hierdie doeltreffende algoritme is geskik vir uitgebreide gebruik soos massiewe parallelle mutagenese-biblioteek. (Verwysing: Tian, ​​S., & Das, R. (2016) Quarterly Review of Biophysics 49(e7): 1-30).

Kort interfererende RNA (siRNA) ontwerp:

Klein interfererende RNA (siRNA) lei volgorde-spesifieke degradasie van die homoloë mRNA, en produseer dus "knock-down" selle. siRNA-ontwerpinstrument skandeer 'n teikengeen vir kandidaat-siRNA-volgordes wat aan die gebruiker-verstelbare reëls voldoen. 'n Verskeidenheid bedieners bestaan:

siRNA-ontwerpsagteware - vergelyk bestaande ontwerpinstrumente, insluitend dié wat hierbo gelys is. Hulle poog ook om die MPI-beginsels en bestaande gereedskap te verbeter deur 'n algoritme wat oneffektiewe siRNA's kan filter. Die algoritme is gebaseer op 'n paar nuwe waarnemings oor die sekondêre struktuur. (Verwysing: S.M. Yiu et al. (2004) Bioinformatika 21: 144-151).

OligoWalk is 'n aanlyn bediener wat termodinamiese kenmerke van sin-antisense hibidisering bereken. Dit voorspel die vrye energieveranderinge van oligonukleotiede wat aan 'n teiken-RNA bind. Dit kan gebruik word om doeltreffende siRNA te ontwerp wat 'n gegewe mRNA-volgorde teiken. (Verwysing: Lu ZJ & Mathews DH. 2008. Nucl. Acids Res. 36: 640-647).

VIRsiRNApred - 'n menslike virale siRNA doeltreffendheid voorspelling bediener (Verwysing: Qureshi A et al. 2013. J Transl Med. 11:305).

Dicer-substraat siRNA's (DsiRNA's) is chemies gesintetiseerde 27-meer dupleks RNA's wat 'n verhoogde sterkte in RNA interferensie het in vergelyking met tradisionele siRNA's.RNAi DESIGN (IDT Integrated DNA Technologies)

pssRNAit - Ontwerp effektiewe en spesifieke plant RNAi siRNA's met genoomwye buite-teiken geen-assessering.

DSIR is 'n instrument vir siRNA (19 of 21 nt) en shRNA teikenontwerp. (Verwysing: Vert JP et al. 2006. BMC Bioinformatics 7:520).

Imgenex siRNA retriever-program is ontwerp om siRNA-koderende DNA-oligonukleotiede te kies wat in een van die pSuppressor-vektore gekloneer kan word. Die invoervolgorde kan direk verkry word vanaf 'n Genbank-toetreding of volgorde wat deur die navorser verskaf word.

siDRM is 'n implementering van die DRM-reëlstelle vir die selektering van effektiewe siRNA's. Die skrywers het 'n opgedateerde analise uitgevoer met behulp van die disjunktiewe reël samesmelting (DRM) benadering op 'n groot en diverse datastel wat saamgestel is uit siRecords, en die gevolglike reëlstelle geïmplementeer in siDRM, 'n nuwe aanlyn siRNA ontwerp hulpmiddel. siDRM implementeer ook 'n paar hoë-sensitiwiteit reël stelle en vinnige reël stelle, skakels na siRecords, en gebruik verskeie filters om ongewenste nadelige effekte te kontroleer, insluitend aangebore immuunresponse, sel toksiese effekte en buite-teiken aktiwiteite in die seleksie van siRNAs. (Verwysing: Gong W et al. 2008. Bioinformatika 24:2405-2406).

siMAX siRNA Ontwerp Gereedskap (Eurofins Genomic, Duitsland) - is 'n eie ontwikkelde sagteware wat ontwerp is om jou te help om die mees geskikte siRNA te kies wat jou geen(e) van belang teiken.

shRNA Ontwerper (Biosettia Inc., VSA) - Gebruik hierdie program om shRNA-oligo's te ontwerp wat versoenbaar is met ons SORT-A/B/C vektore. Die ontwerpinstrument verskaf teikens met die grootste kans om jou geen af ​​te slaan. Neem asseblief kennis dat slegs een oligo ontwerp is aangesien dit palindromies is.

syDESIGN Sentrum (Horizon Discovery Ltd., VK) - is 'n gevorderde, gebruikersvriendelike siRNA-ontwerpinstrument, wat die waarskynlikheid om funksionele siRNA te identifiseer aansienlik verbeter. Een-van-'n-soort opsies is beskikbaar om teikenspesifisiteit te verbeter en siRNA-ontwerpe aan te pas vir meer gesofistikeerde eksperimentele ontwerp.

Realtime PCR primer ontwerp:

RealTimeDesign (Biosoektegnologieë) - gratis maar vereis registrasie.

GenScript Real-time PCR (TaqMan) Primer Design - mens kan die potensiële PCR amplikon se grootte reeks, Tm (smelttemperatuur) vir die primers en probes, sowel as die organisme, aanpas. Jy kan ook besluit hoeveel Primer/Probe-stelle jy wil hê die instrument moet aan jou terugbesorg. Dit is moontlik om 'n GenBank-toetredingsnommer as die sjabloon te gebruik.

QuantPrime - is 'n buigsame program vir betroubare primer ontwerp vir gebruik in groter qPCR eksperimente. Die buigsame raamwerk is ook oop vir eenvoudige gebruik in ander kwantifiseringstoepassings, soos hidrolisasie-probe-ontwerp vir qPCR en oligonukleotied-probe-ontwerp vir kwantitatiewe in situ verbastering. (Verwysing: S. Arvidsson et al. 2008. BMC Bioinformatics 9:465)

PrimerQuest - (IDT, VSA)

Bekendstelling van mutasies:

WatCut (Michael Palmer, Universiteit van Waterloo, Kanada) - neem 'n oligonukleotied en stel stille mutasies in potensiële beperkingsplekke in sodat die aminosuurvolgorde van die proteïen onveranderd is.

PrimerX - kan gebruik word om die ontwerp van mutageniese primers vir plekgerigte mutagenese te outomatiseer. Dit is beskikbaar in twee geure (a) Primer-ontwerp gebaseer op DNA-volgorde en (b) Primer-ontwerp gebaseer op proteïenvolgorde

Primerize-2D - is ontwerp om sintese van groot biblioteke van gewenste mutante te versnel deur ontwerp en doeltreffende organisasie van primers. Die onderliggende program en grafiese koppelvlak is eksperimenteel in ons laboratorium getoets vir RNA-domeine met lengtes tot 300 nukleotiede en biblioteke wat tot 960 variante insluit. (Verwysing: Tian, ​​S., & Das, R. (2017) Bioinformatika 33(9): 1405-1406).

Wanneer jy gereed is om jou PCR-reaksie op te stel, sien:

PCR Box Titrasie Sakrekenaar (Allotron Biosensor Corporation) - om die hoeveelhede van elke reagens uit te vind om in 'n tweedimensionele bokstitrasie vir PCR te gebruik. Vir standaard PCR-reaksies pas volume aan, en verander "ry" en "kolom" nommer na "1", klik op al die "bo" of "onder" en "done". PCR Titrasie Sakrekenaar (Angel Herráez Cybertory: virtuele molekulêre biologie laboratorium Universidad de Alcalá, Spanje) is 'n soortgelyke webwerf.

PCR-reaksiemengsel-opstelling (R. Kalendar, Universiteit van Helsinki, Finland) - Baie mooi webwerf (vereis Java).

PCR-optimalisering (Bioline, Verenigde Koninkryk) - baie toestande

Primer-aanbieding oor die DNA-volgorde:

Sequence Extractor (Paul Stothard) - genereer 'n klikbare beperkingskaart en PCR-primerkaart van 'n DNA-volgorde (aanvaarde formate is: rou, GenBank, EMBL en FASTA) wat 'n groot mate van beheer oor uitset bied. Proteïenvertalings en intron/ekson-grense word ook getoon. Gebruik Sequence Extractor om DNA-konstrukte te bou in siliko.


LABORATORIUM-EKSPERIMENT: SYBR® GROEN-GEBASEERDE PRIMER ONTWERP MET DIE GEBRUIK VAN PRIMER3 SAGTEWARE

Agtergrond

Fluorescerende Chemie van qPCR

Om die hoeveelheid mRNA, DNA of cDNA in 'n monster te kwantifiseer, kan die gebruik van nie-spesifieke of volgorde-spesifieke fluoresserende seine saam met RT-PCR gebruik word. Volgorde-spesifieke opsporing (bv. TaqMan®, Moeg, Molecular Beacon en Scorpion) gebruik spesiaal ontwerpte probes wat fluorofore het wat aan hul 5'-punt gebind is en uitblusmiddels wat aan hul 3'-kant gebind is (Fig. 1). Fluorofore is molekules (of deel van 'n molekule) wat in die teenwoordigheid van lig opgewonde raak en fluoressensie vrystel. Die blusmiddel is 'n molekule wat die fluoressensie uitdoof. Wanneer 'n qPCR-reaksie uitgevoer word met behulp van 'n gespesialiseerde thermocycler (bv. BioRad iCycler), kies die optiese module van die thermocycler die korrekte golflengte van lig en reflekteer dit in die put waar die PCR-reaksiemengsel geleë is. Die fluorofoor-molekules word opgewonde en fluoressieer, en dan meet en kwantifiseer die termosykler se optiese opsporingstelsel die hoeveelheid fluoresserende emissie wat in elke buis teenwoordig is. Byvoorbeeld: 'n TaqMan®-gebaseerde eksperiment sal vereis dat 'n fluorogeniese sonde saam met die volgorde-spesifieke primers by die PCR-reaksiemengsel gevoeg moet word. Die sonde is 'n oligonukleotiedvolgorde, wat ontwerp is om te hibridiseer met 'n interne streek van die PKR-produk. Dit bevat die fluoresserende verslaggewerkleurstof (fluorofoor) wat aan sy 5'-punt geheg is en 'n blusdeel wat aan die 3'-punt geheg is (Fig. 1). Die fluorofoor en blusmiddel word geskei deur die lengte van die sonde. Die afstand is naby genoeg om toe te laat dat die fluoressensie vanaf die uitdoof die fluoresserende sein van die fluorofoor blokkeer. Dit verhoed die opsporing van die fluoresserende sein vanaf die sonde. Tydens die uitgloeisiklus sal die sonde tot sy teikenvolgorde uitgloei tussen die voorwaartse en omgekeerde primer. Solank as wat die sonde ongeskonde is, word die fluoressensie van die verslaggewerkleurstof egter geblus, wanneer DNA-polimerase die primer verleng en die sjabloon waarop die TaqMan®-probe gebind is herhaal, klief die eksonuklease-aktiwiteit van die polimerase die sonde, wat die verslaggewer vrystel molekule en toelaat dat die fluoressensie daarvan opgespoor word. Die proses word gedurende elke siklus van die PCR herhaal, wat die vlak van fluoressensie verhoog namate bykomende probes geklief word. Hierdie tipe opsporing is ideaal vir die opsporing van enkelnukleotied polimorfismes of opsporing van spesifieke volgordes. Die probes kan gemerk word met verskillende verslaggewer kleurstowwe wat die gebruiker toelaat om meer as een spesifieke volgorde in 'n monster op te spoor (dit word 'n multipleks qPCR genoem).

TaqMan® en SYBR® Green Fluorescent Chemistries. TaqMan® (1) gebruik 'n sonde wat bestaan ​​uit 'n oligonukleotiedvolgorde met 'n 5'-fluoresserende verslaggewermolekule (F) en 'n 3'-bluskleurstof (Q). Solank as wat die sonde geheg is, ontwrig die sein van die bluskleurstof (dikwels 'n lang golflengte gekleurde kleurstof) die sein van die fluorofoor (gewoonlik 'n kort golflengte gekleurde kleurstof). Taq polimerase verleng die primer (2) en herhaal die sjabloon waarop die TaqMan®-probe gebind is. Die eksonuklease aktiwiteit van Taq polimerase (3) klief die sonde, wat die 5'-fluorofoor (verslaggewerkleurstof) vrystel wat fluoressensie toelaat om te voorkom. SYBR® Green interkaleer dsDNA. Wanneer dit vry is in die reaksiemengsel (1), gee dit slegs klein hoeveelhede fluoressensie uit. As primers word verleng deur Taq, polimerase, en replikasie van die sjabloon plaasvind, word meer SYBR® Green geïntegreer in die gerepliseerde string (2). Fluoresentasie neem toe soos stringe gerepliseer word (3).

Nie-spesifieke opsporing gebruik fluoresserende kleurstowwe soos SYBR® Green I. Wanneer SYBR® Green kleurstof by 'n PCR-reaksiemengsel gevoeg word, sal dit onmiddellik aan enige teenwoordige dsDNA bind en 'n fluoresserende sein uitstuur wat 1 000 keer groter is as ongebonde SYBR® Green [5] . Soos die termosikleerder deur sy siklusse roteer (denaturering → uitgloei → verleng), word nuwe amplikone gesintetiseer deur Taq polimerase en word onmiddellik gebind deur die SYBR® Green kleurstof wat in die mengsel teenwoordig is. Die resultaat is 'n toename in fluoresserende intensiteit wat direk eweredig is aan die toename in dsDNA. Hierdie tipe opsporingstelsel is die eenvoudigste en mees ekonomiese keuse vir qPCR, maar het sy nadele deurdat dit nie selektief is nie. Vals positiewe kan ontstaan ​​as gevolg van primer dimere en niespesifieke amplifikasie. Dit is dus van kritieke belang om primers te ontwerp wat die kans op dimerisasie en niespesifieke amplifikasie verminder.

Basiese beginsels van Primer Design

Die sukses van 'n konvensionele PCR om maksimum te presteer is afhanklik van 'n goeie beginsjabloon, a Taq polimerase en bufferoplossing wat van goeie gehalte is en die ontwerp van primers wat goed gebalanseer is tussen twee parameters: spesifisiteit en doeltreffendheid. Spesifisiteit is belangrik omdat mispriming sal plaasvind wanneer primers swak ontwerp is. Dit lei tot nie-spesifieke amplifikasie van volgordes wat in die sjabloonpoel gevind word. Doeltreffendheid is ook belangrik in onderlaagontwerp. 'n Doeltreffende primerpaar sal 'n tweevoudige toename in amplikon vir elke siklus van die PCR produseer. Die meeste primer ontwerp sagteware programme is vooraf ingestel met verstek parameters vir konvensionele PCR. Dit maak voorsiening vir die seleksie van primer-pare wat 'n respekvolle balans tussen spesifisiteit tot die teikenvolgorde en maksimum doeltreffendheid produseer wanneer dit met 'n konvensionele PCR-toets gebruik word, maar is nie noodwendig die beste primers vir 'n qPCR nie.

In 'n SYBR® Green-gebaseerde qPCR-toepassing is spesifisiteit baie belangrik. Om dit te verstaan, is dit belangrik om te onthou hoe SYBR® Green werk. SYBR® Green kleurstof sal bind aan enige dsDNA teenwoordig in die reaksiemengsel, so amplifikasie van nie-spesifieke produkte produseer data wat ongeldig is. Ander faktore om in ag te neem is die vorming van primer dimere en doeltreffendheid. Primer dimere kan fluoressensie verhoog, wat lei tot onakkurate kwantifisering van die amplikon. Doeltreffendheid (hoe goed die primers presteer) van 'n qPCR-reaksie moet so hoog as 90–100% wees. Doeltreffende primers verhoog sensitiwiteit van kwantifisering en maak voorsiening vir toetsreproduseerbaarheid. Faktore wat die doeltreffendheid van 'n qPCR beïnvloed, sluit die amplikonlengte en primerkwaliteit in. Kortom, die sleutel tot die ontwikkeling van goeie SYBR® Green-gebaseerde primers is om 'n paar primers te vind wat baie spesifiek is, nie primer dimers produseer nie, produseer kort amplicons, en doeltreffend genoeg is om resultate te lewer wat konsekwent en reproduseerbaar is. Om die algemene parameters te ken, wat in die meeste primer-ontwerpsagteware aangepas kan word, kan help om dit te bereik.

Algemene parameters van onderlaagontwerp

Primer Lengte

Die optimale lengte van primers word algemeen aanvaar as 18–24 bp lank. Langer primers sal langer neem om te hibridiseer, langer om uit te brei en langer om te verwyder produseer dus minder amplikon.

Primer Smelttemperatuur (Tm)

Dit is die temperatuur waarteen 50% van die onderlaag en sy komplement gehibridiseer word. Om vir qPCR te optimaliseer, vind primers van minimale lengte wat smelttemperature het (Tm) wat tussen 59 en 68 °C is, met 'n optimale Tm van 63–64 °C. Ook die Tm van die onderlaagpaar moet binne 1 °C van mekaar wees. Die onderlaag moet ook 'n hê Tm wat hoër is as die Tm van enige sjabloon sekondêre strukture (gevind met behulp van mFOLD-sagteware, later bespreek).

Uitgloei temperatuur

Optimale intydse PCR-gloeitemperature is 59 °C of 60 °C.

Produk Grootte

'n Ideale amplikon moet tussen 80 en 150 bp wees. As veelvuldige gene gebruik word, (d.w.s. vergelyking van die relatiewe uitdrukking van verskeie gene), dan moet die grootte van alle amplikone naby in lengte wees. SYBR® Green-opsporing sal 'n meer intense fluoressensie in groter produkte as kleiner produseer (hou dus verskeie produkte naby in lengte).

Mg++ Konsentrasie

Die verstek is op nul gestel op die meeste primer ontwerp sagteware. SYBR® Groen buffermengsels bevat 3 tot 6 mM MgCl2.

Herhaal

'n Herhaling is 'n nukleotiedvolgorde ('n dinukleotied) wat herhaal word (bv. TTCTCTCTCTC). Dit moet vermy word, want dit bevorder mispriming. Indien onvermydelik, moet die maksimum aantal 4 di-nukleotiede wees.

Lopies is herhaalde nukleotiede (bv. TAAAAAGC het 'n 5 bp-lopie van Adenine). Lopies moet ook vermy word, want hulle is geneig tot mispriming. Die maksimum lopie moet nie meer as 3–4 bp wees nie.

3′ Stabiliteit

Dit verwys na die maksimum ΔG van die 5 basisse vanaf die 3′-punt van die primers. (ΔG is die Gibbs Free Energy, die energie wat benodig word om die bindings aan die 3'-kant te breek) 'n Hoër 3'-stabiliteit sal die doeltreffendheid van die onderlaag verbeter.

GC klem

Dit verwys na die maksimum ΔG van die 5 basisse vanaf die 5′ einde van die primers. Dikwels 'n GC-klem genoem, verwys die 5'-stabiliteit na hoe stabiel die 5'-kant is as gevolg van die hoeveelheid Gs of Cs wat aan die 5'-kant van die primer teenwoordig is. Om 1 tot 2 GC-klemme te hê is ideaal, aangesien dit die onderlaag sterk aan die sjabloonstring laat bind, wat dit meer spesifiek maak, vermy egter meer as 2 GC-klemme.

Stap-vir-stap voorbeeld van Primer-ontwerp met behulp van Primer3-sagteware

Een van die mees gebruikte primer ontwerp sagteware programme is Primer3 [7]. Dit kan gebruik word om PCR-inleiders, volgordebepaling-inleiders en hibridisasieprobes te ontwerp. Primer3 het baie verskillende invoerparameters wat beheer kan word om eienskappe te definieer wat die sagteware toelaat om primers te ontwerp wat geskik is vir elke doelwit. Hierdie afdeling gee 'n stap-vir-stap voorbeeld van hoe om primers te ontwerp met Primer3 en verduidelik die funksies van die mees algemeen gebruikte parameters. (Let wel: Die volgende beskrywings van Primer3-parameters is gebaseer op Primer3-webwerf en kan in sommige gevalle woordeliks wees.)

Stap 1: Kry volgorde in FASTA-formaat

Primer3 sal rye in FASTA, EMBL en ander formate aanvaar. Om die gebruik van Primer3 te verduidelik, word 'n FASTA-formaatvolgorde van die Nasionale Sentrum vir Biotegnologie-inligting (NCBI) gebruik. NCBI is 'n staatsbefondsde, publieke databasis van genomiese en ander inligting wat relevant is tot biotegnologie. (Let wel: Die Populus trichocarpa (Poplar) dehidrokinaat dehidrase/shikimaat dehidrogenase (DHQD4) geen wat in hierdie voorbeeld gebruik word, is NCBI toegangsnommer XM_002314438.1.)

Kies "Nukleotied" in die aftreklys (bo die soekkassie).

Tik in die soekkassie: XM_002314438.1. Klik op "Soek."

Wanneer die resultate verskyn, klik op "Vertooninstellings" bo-aan die bladsy (onder die soekbalk, aan die linkerkant, bo-aan die bladsy), kies FASTA en klik dan "toepas."

Opsioneel: Maak 'n Word-dokument oop en kopieer die FASTA-formaatvolgorde op 'n leë vel. Dit maak dit makliker om later in die eksperiment die sjabloon vir sekondêre strukture na te gaan.

Stap 2: Gebruik Primer3

Dit lyk intimiderend, maar is maklik om te gebruik sodra jy vertroud raak met die soekparameters. Primer3-sagteware kan gebruik word om primers vir alle soorte PCR te ontwerp, so dit het 'n menigte opsies. Nadat hulle gelees het wat die opsies doen, word studente opdrag gegee hoe om opsies te verander om primers vir die DHQD4-geen te ontwerp.

Instruksie: Gaan na die Primer3-webwerf by: http://frodo. wi.mit.edu/primer3/

Kopieer en plak die DHQD4 FASTA-formaatvolgorde van die Word-dokument in die blokkie wat op die Primer3-onderlaagontwerpbladsy voorsien is (Fig. 2).

Primer3 aanlyn sagteware vir primer seleksie. Voer DNA-volgorde in FASTA-formaat in die nukleotiedboks in. Hierbo is Populus tricocarpa DHQD4-volgorde ingevoer. NCBI-identifiseerders (hierbo gewys as >gi|224107416|ref…mRNA) kan voor die volgorde ingevoer word, maar is nie nodig nie.

Kies die linkeronderlaag, of gebruik die linkeronderlaag hieronder: As hierdie opsie leeg gelaat word, sal die Primer3-program die linkeronderlaag kies. As 'n linker- (of voorwaartse) primer-volgorde egter reeds bekend is, en die gebruiker hoef slegs 'n regter (of omgekeerde) primer te skep, sal die bekende volgorde in hierdie blokkie ingevoer word.

Instruksie: Vir die Poplar-voorbeeld, laat dit leeg.

Kies hibridiseringsondersoek: 'n Sonde (bv. TaqMan®) word nie in SYBR® Green-opsporing vereis nie, so laat dit leeg. Wanneer sonde-gebaseerde fluoresserende opsporing gebruik word, sal 'n sonde saam met die primer stel ontwerp word. Deur hierdie opsie te merk, laat Primer3 toe om 'n lys van voorgestelde probes te verskaf wat met die primerstel sal werk.

Instruksie: Vir die Poplar-voorbeeld, laat dit leeg.

Kies die regte primer, of gebruik die regte primer hieronder: As hierdie opsie leeg gelaat word, sal die Primer3-program die regte primer kies. As 'n regter (of omgekeerde) primer-volgorde egter reeds bekend is, en die gebruiker hoef slegs 'n links (of vorentoe) primer te skep, sal die bekende volgorde in hierdie blokkie ingevoer word.

Instruksie: Vir die Poplar-voorbeeld, laat dit leeg.

Volgorde-ID: 'n Naam vir die onderlaagstel.

Instruksie: Vir die Poplar-voorbeeld, voer die volgende naam in: Populus trichocarpa DHQD4.

Teikens: As primers ontwerp moet word vir 'n "spesifieke" plek in die volgorde, kan die gebruiker hakies gebruik om Primer3 te vertel waar om primers te ontwerp (bv. AA[TAGC]ACC) sou vir Primer3 sê om onderlaag rondom die TAGC-basispare te ontwerp). Hierdie keuse is nuttig as jy primers vir 'n spesifieke volgorde area wil ontwerp.

Instruksie: Slaan hierdie opsie oor vir die Poplar-voorbeeld.

Uitgesluit streke: Hierdie opsie is baie nuttig as 'n sekere deel van die volgorde vermy moet word. Byvoorbeeld, as oligodT-inleiders gebruik word om omgekeerde transkripsie uit te voer om cDNA te skep, kan die 5'-kant van die mRNA (as dit 'n baie lang volgorde is) nie in die cDNA voorgestel word nie, aangesien die oligodT-inleier kan afval voordat dit dit bereik. In hierdie geval is dit nodig om die ontwerp van primers langs die 5′-kant te vermy en eerder die 3′-kant van die volgorde te rig. Hierdie opsie is ook baie nuttig as Primer3-sagteware verskeie primers vanaf dieselfde plek gee (wat nie bevredigend is nie), of primers gee wat 'n amplikon skep wat baie sekondêre strukture het (meer daaroor later, wanneer ons mFold-waardes bespreek ). Om 'n area te vermy, voer die waardes in as 'n kommageskeide lys (bv: 81,6 waar 81 die bp-posisie is wat jy wil hê dat Primer3 hierdie opdrag moet begin en 6 is hoeveel bp na die nukleotied by posisie 81 dit moet vermy).

Instruksie: Vir die Poplar-voorbeeld, laat leeg.

Produk Grootte Reeks: Dit is die grootte van jou amplicon. 'n Optimale amplikon sal ~120 bp lank wees. Oor die algemeen is amplikone van 80–200 bp aanvaarbaar, maar langer amplikone gee minder doeltreffende qPCR-resultate omdat meer SYBR® Green geïnkorporeer word.

Instruksie: Vir die Poplar-voorbeeld:

Voer in: 80–150 100–200 (dit sê vir Primer3 om eers te soek vir primers wat amplikone tussen 80 en 150 bp sal produseer, en dan vir primers te soek wat amplicons tussen 100 en 200 bp sal produseer.

Nommer om terug te stuur: Dit is hoeveel primer stelle Primer3 sal terugkeer. Hierdie nommer is volgens die gebruiker se diskresie.

Instruksie: Vir die Poplar-voorbeeld, voer 10 in.

Maksimum 3Stabiliteit: Dit verwys na die maksimum ΔG van die 5 basisse vanaf die 3′-punt van die primers. (ΔG is die Gibbs Free Energy G—die energie wat benodig word om die bindings aan die 3'-kant te breek) Hoër 3'-stabiliteit sal die doeltreffendheid van die onderlaag verbeter. Hoe hoër hierdie getal is, hoe meer stabiel is jou 3′ einde. (Let wel: die gebruiker sal dalk hierdie nommer moet verander om geskikte primers te verkry.) Dikwels word die balans tussen doeltreffendheid en spesifisiteit moeiliker gemaak as gevolg van sekondêre struktuurvorming.

Instruksie: Vir die Poplar-voorbeeld, laat waarde by 9 (om meer doeltreffende primers terug te gee).

Maksimum Herhaal Mispriming: Herhaal (bv. ATATATATA) kan mispriming veroorsaak (die gevolg van 'n primerbinding aan 'n onbedoelde sjabloon). Sommige eukariote (byvoorbeeld die mens, drosophila en muis) het herhaalde segmente wat berug is vir verkeerde aanplanting. Omdat dit algemeen is, is databasisse (genoem biblioteke) van reekse wat bekend is dat hulle mispriming veroorsaak, geskep. Hierdie opsie laat Primer3 toe om areas van bekende mispriming te vermy wanneer primers ontwerp word. As qPCR-inleiders vir menslike, muis- of vrugtevliegreekse ontwerp word, moet 'n biblioteek eers gekies word. Om 'n biblioteek te kies, kyk watter spesie gebruik word vanaf die aftrekvenster (bo die volgorde-invoerkassie bo-aan die bladsy). Tik dan die maksimum waarde in die "Max repeat mispriming" boks. Hierdie waarde is die maksimum toegelate geweegde ooreenkoms van die individuele (vorentoe of omgekeerde) primer met alle bekende herhaalde nukleotiede wat mispriming veroorsaak. Om die waarskynlikheid van mispriming te verminder, laat die getal by 12 of verhoog die getal. Aangesien hierdie eksperiment 'n Populierboom-volgorde gebruik, sal Primer3 nie 'n mispriming-biblioteek hê om toegang te verkry nie, so laat die waarde by 12. Sommige rekenaarvaardige gebruikers skep hul eie kode om Primer3 toe te laat om toegang te verkry tot mispriming-databasisse wat hulle geskep het, maar hierdie tegnologie is bo die bestek van hierdie eksperiment en sal nie bespreek word nie.

Instruksie: Vir die Poplar-voorbeeld, laat die waarde by 12.

Paar maksimum herhalende mispriming: Hierdie waarde is die maksimum toegelate geweegde ooreenkoms van die primerpaar (beide vorentoe en agtertoe) met alle bekende herhaalde nukleotiede wat mispriming veroorsaak. Om die waarskynlikheid van mispriming te verminder, laat dit by 24 of verhoog die getal.

Instruksie: Vir die Poplar-voorbeeld, laat die waarde by 24.

Maksimum sjabloon mispriming: Mispriming is die resultaat van 'n primer wat aan 'n onbedoelde sjabloon bind wat amplifikasie tot gevolg het. Hierdie opsie kontroleer individuele primers vir die waarskynlikheid dat hulle misprimeer na 'n ander area op die volgorde wat verskaf word. Sjabloon mispriming moet vermy word in qPCR, anders sal 'n amplikonmengsel van die beoogde produk en 'n niespesifieke produk tydens amplifikasie geproduseer word. Laat die waarde by 12 of verhoog die getal om die waarskynlikheid van mispriming te verminder. (Let wel: wanneer 'n SYBR® Green-gebaseerde qPCR gebruik word, moet 'n geen sjabloonbeheer (NTC) gebruik word, en die termosikluseerder moet geprogrammeer word om 'n smeltkromme te genereer om sekondêre produkte op te spoor. As bykomende pieke in die smeltkromme teenwoordig is. , maar geen amplikon word in die NTC opgespoor nie, moet primers herontwerp word aangesien hierdie pieke aandui dat niespesifieke produkte geamplifiseer word).

Instruksie: Vir die Poplar-voorbeeld, laat die waarde by 12.

Pair Max Template Mispriming: Hierdie opsie kontroleer primer pare vir die waarskynlikheid dat hulle misprimeer op die sjabloon wat verskaf word. Laat dit by 24 of verhoog die getal om die waarskynlikheid van mispriming te verminder.

Instruksie: Vir die Poplar-voorbeeld, laat die waarde by 24.

Algemene primer pluk voorwaardes: Dit is algemene opsies wat die gebruiker kan stel om primers te kies.

Onderlaag grootte: Spesifisiteit kan beheer word deur 'n balans te vind tussen die lengte van die onderlaag en die uitgloeitemperatuur van die PKR. Die optimale lengte van primers word algemeen aanvaar as 18–28 bp lank. As u sondes gebruik (bv. TaqMan®) in 'n multipleks PCR, verhoog hierdie lengte tot 35 bp. Om vir SYBR® Green qPCR te optimeer, vind primers van minimale lengte wat smelttemperature het (Tm) wat tussen 62 en 67 °C is, met 'n optimale Tm van 63 °C.

Instruksie: Vir minimum waarde, voer 20 in vir Optimum, voer 25 in, Vir Maksimum, voer 28 in

Primer Tm: Dit is die temperatuur waarteen 50% van die onderlaag en sy sjabloonkomplement gehibridiseer word. Probeer om onderlaag te ontwerp met smelttemperature tussen 62 en 67 °C, met 'n optimale Tm van 62 °C tot 64 °C. Die Tm verskil tussen die voorwaartse en terugwaartse primers moet nie meer as 1–2 °C wees nie.

Instruksie: Minimum, voer 60 in, Optimum, voer 64 in, Maksimum, voer 70 in

Maksimum Tm Verskil, voer 2 in

Tabel van termodinamiese parameters: Primer3 gebruik hierdie formules om die smelttemperatuur te bereken. Die aanbevole waarde is SantaLucia1998.

Instruksie: Vir die Poplar-voorbeeld, stel na SantaLucia1998.

Produk Tm: Dit is die temperatuur waarby 50% van die amplikon ssDNA is. Die temperatuur wissel na gelang van die GC-inhoud van die sjabloon. Ideaal gesproke sou 'n geteikende area op die sjabloon 'n GC-inhoud van 50% hê.

Instruksie: Vir die Poplar-voorbeeld, stel optimaal op 50.

Primer GC: Dit is die minimum en maksimum persentasie guanien en sitosien (GC) wat toegelaat word. Die GC-inhoud van primers word gebruik om die smelttemperatuur van die primer te bepaal, wat gebruik kan word om die uitgloeitemperatuur te voorspel. Die smelttemperatuur van primers is oor die algemeen 3 tot 5° onder die uitgloeitemperatuur. Ideaal gesproke moet qPCR-primers by 59–60 °C uitgloei. (Let wel: Die meeste SYBR® Green meestermengsel oplossings bevat spesifieke hoeveelhede buffer (sout) en MgCl2, wat die smelttemperatuur van die onderlaag verander.)

Instruksie: Vir die Poplar-voorbeeld: Minimum 35, Optimum 65, Maksimum = 80.

Max Self Komplimentêr: Primers moet nie self-aanvullend of aanvullend tot mekaar wees nie. Primers wat self komplementêr is, vorm selfdimere of haarnaaldstrukture. Aangesien SYBR® Green kleurstof met enige dubbelstring DNA-struktuur sal inwerk, moet hierdie waarde so laag as moontlik gestel word. Stel aanvanklik die waarde op 2. As Primer3 nie primer-stelle gee nie, verhoog die waarde in inkremente van 1 en dien weer in—herhaal soos nodig.

Instruksie: Vir die Poplar-voorbeeld, stel die waarde op 4.

Maksimum 3Self-komplimentêr: As polimerases voeg basisse by die 3 einde van die oligonukleotied, die 3-punte van primers moet nie komplimentêr tot mekaar wees nie, aangesien primer dimers sal voorkom. Soms kan dit nie vermy word nie. Gee egter veral aandag aan komplementering tussen primers by 2 of meer basisse by die 3 punte van die primers aangesien dit geneig is om primers makliker te vorm (Sien Fig. 3). Stel die waarde laag (bv. 2 of 3) en verhoog met inkremente van 1 as Primer3 nie 'n lys van primers verskaf nie.

Instruksie: Vir die Poplar-voorbeeld, stel die waarde op 3.

Maksimum #N: Dit is die maksimum aantal onbekende basisse wat Primer3 kan oorweeg om primers te maak. Baie gene, EST's (Expressed Sequenced Tags) en cDNA's in NCBI se GeneBank bevat onbekende basisse (N). Die simbool N word as 'n "plekhouer" gegee wanneer volgordebepaling nie die nukleotied (G,C,T of A) teenwoordig op 'n sekere plek in die geen (of cDNA)-volgorde kan bepaal nie. Om nie-spesifieke versterking te vermy, stel hierdie waarde op nul.

Instruksie: Vir die Poplar-voorbeeld, stel op 0

Maksimum Poly-X: Die maksimum aantal mononukleotiedherhalings om in die primer toe te laat. Lang mononukleotied herhalings (bv. AAAAAAA) kan mispriming bevorder en moet vermy word. As 'n algemene reël, lopies van 3 of meer C's of G's by die 3 ente van primers moet vermy word, aangesien hul teenwoordigheid mispriming by C- of C-ryke volgordes kan bevorder.

Instruksie: Vir die Poplar-voorbeeld, stel hierdie waarde op 3.

Binne-teiken-straf en Buite-teiken-straf: Word gebruik as die onderlaag ontwerp moet word om 'n streek te oorvleuel (bv. gapingsaansluitings). "As die primer deel is van 'n paar wat oor 'n teiken strek en die teiken oorvleuel, vermenigvuldig dan hierdie waarde keer die aantal nukleotiedposisies waarmee die primer die (unieke) teiken oorvleuel om die 'posisie straf' te kry (van die Primer3 webwerf ). Hierdie parameter laat Primer3 toe om die oorvleueling van die primer met die geteikende area van die volgorde as 'n term in die objektiewe funksie in te sluit.

Instruksie: Verstek is ok.

Eerste basisindeks: Hierdie parameter vertel Primer3 watter programmeringsindekstipe die eerste basis in die invoervolgorde is. GenBank (NCBI) gebruik een-gebaseerde indeksering.

Instruksie: Verstek is goed.

GC klem: Definieer die spesifieke getalle Gs en Cs by die 3 einde van beide die linker en regter primers. Alhoewel jy Gs of Cs op die 3 wil plaas punte van jou primer, nie meer as 2–3 G'e en C'e moet in die laaste 5 basisse by die 3 wees nie einde van die primer.

Instruksie: Verstek van 0 is goed.

Kons. van eenwaardige katione: Dit is die millimolêre konsentrasie van KCl-sout (meeste van die tyd) in die PKR. Laat staan ​​by 50 μM, tensy daar 'n rede is waarom jy meer sout bygevoeg het.

Instruksie: Verstek is ok.

Soutkorreksieformule. Faktore soos ΔG en Tm PKR-werkverrigting beïnvloed en die doeltreffendheid van primerpare verander. Soos die Tm van 'n DNA-volgorde afhanklik is van lengte, volgorde, omringende ioniese omgewing en pH van die omgewing, is dit belangrik om die termodinamika van dissosiasie en assosiasie van die nukleotiedstringe tydens die PKR te evalueer. Primer3 gebruik formules wat gebaseer is op die naaste buurmodel met soutkorreksie. Die SantaLucia 1998-soutformule word deur Primer3 verkies. Hierdie formule is ontwerp om die soutkorreksie onafhanklik van volgorde maar afhanklik van oligonukleotiedlengte te akkommodeer.

Instruksie: Vir die Poplar-monster, kies SantaLucia 1998.

Kons. van tweewaardige katione: Dit is die konsentrasie van tweewaardige soute (gewoonlik MgCl 2+ ) teenwoordig in die PCR-mengsel. SYBR® Groen mengsels bevat gewoonlik ~3 mM.

Instruksie: Verander na 3,5 mM (om aan te pas vir MgCl in SYBR Green Supermix)

Kons. van dNTP's: 'n dNTP-konsentrasie van 200 μM word gewoonlik aanbeveel vir Taq-polimerase om doeltreffend te funksioneer in 'n konvensionele PCR, waar MgCl2 konsentrasies is 1,5 mM. Toenames in dNTP-konsentrasies kan PCR-reaksies inhibeer deur vrye Mg vas te vang. Sommige SYBR® Green-meestermengsels word voorberei met taq, KCL, MgCl2, en dNTP reeds in die mengsel. Hierdie mengsels is laboratorium getoets om maksimum werkverrigting te lewer.

Instruksie: Vir die Poplar-voorbeeld, gebruik 0,20 mM

Uitgloeiende oligo-konsentrasie: Gebruik om die oligo-smelttemperatuur te bereken, dit is die nanomolêre konsentrasie van uitgloei-oligo's in die PCR. Aangesien die waarde afhang van die hoeveelheid oligo's en die hoeveelheid sjabloon, is dit moeilik om hierdie waarde te bereken (gegewe cDNA word as 'n sjabloon gebruik). Primer3 beweer dat die verstek (50 nM) goed werk vir die meeste toepassings.

Instruksie: Vir die Poplar-voorbeeld is verstek in orde.

Doelwitfunksie Strafgewigte vir Primers: Die strafgewigte-afdeling laat Primer3-gebruikers toe om die kriteria wat Primer3 gebruik om die beste stelle primers te kies, te wysig. Indien geen strafgewigte toegeken word nie, sal die program die inligting gebruik wat die gebruiker verskaf het aan die "General Primer Picking" spesifikasies en elke stel primers gradeer op grond van daardie toestande. Deur strafgewigte te gebruik, sê die gebruiker aan Primer3, "hierdie kriteria is belangriker as 'n ander." Gebruikers voer strafgewigte in waardes van 0, 1, 2, 3, ens. in met 0 wat minder belangrik is. Byvoorbeeld, 'n mens kan besluit dat primer dimere 'n groter bekommernis is as sekondêre amplikone. Dan kan die Self Komplementêre opsie gestel word op 3 en Template Mispriming op 2. Sommige parameters het twee blokkies (Lt en Gt). Hierdie minder as (Lt)/groter as (Gt) opsie maak voorsiening vir meer buigsaamheid in die pluk van primers. Byvoorbeeld, as die gebruiker onder "Algemene Primer Picking Conditions" gespesifiseer het dat die onderlaaggrootte (Grootte) tussen 18 bp en 27 bp moet wees, sal enige primers wat oorweeg word gepenaliseer word as hulle minder as 18 bp is, of groter as 27 bp. 'n Gebruiker kan 'n straf van 2 gee vir primers korter as 18 bp en 'n straf van 0 vir primers groter as 27 (indien langer primers aanvaarbaar sal wees).

Instruksie: Vir die Poplar-voorbeeld, verander die volgende strafgewigte:


Hoe belangrik is die GC-klem wanneer primers ontwerp word? - Biologie

Ontwerp primers vir PCR

Die Primer Designer beskik oor 'n kragtige, dog uiters eenvoudige, intydse koppelvlak om die vinnige identifikasie van teoretiese ideale primers vir jou PCR-reaksies moontlik te maak. Primerpare word bereken vanaf die gestelde teikenstreke, dan gekeur teen 'n reeks parameters om die primerdoeltreffendheid te maksimeer vir probleemvrye PCR.

Die hoof Primer Ontwerper vorm bestaan ​​in wese uit twee roosters en 'n paar parameterkontroles. Die roosters wys al die moontlike voor- (linkerkant) en omgekeerde (regterkant) primers wat aan die gestelde parameters voldoen, en val binne die gespesifiseerde teikenstreke vir elke primer. Jy sal dadelik agterkom dat deur die seleksievoorwaardes vir die primers strenger te maak, die lys van moontlike primers sal verminder. Hierdie intydse siftingsproses maak dit moontlik om die lys van potensiële primers baie vinnig te verklein, en die een(s) te kies wat die beste by die behoeftes vir jou eksperiment pas.

Die streke waaruit die primers gekies word, kan gevisualiseer en aangepas word op die Interaktiewe volgordekaart. Die streke word voorgestel deur omlynde bokse, groen gekleur vir die voorste onderlaag en pers vir die omgekeerde onderlaag. Die streke kan verskuif word deur hulle met die muis te sleep, en hul grootte kan aangepas word deur op hul rande te klik en hulle na die verlangde grootte te strek.Vir fyn aanpassing van die streek se posisie of grootte, kies eenvoudig die hele blokkie of die toepaslike rand, gebruik dan die linker- en regspyltjies om jou keuse na die presiese verlangde posisie te verskuif. Die primer seleksie streke word ook in die Volgorde-redakteur as liggroen en pers geskakeerde streke.

Die posisies van die tans geselekteerde voor- en omgekeerde primers in die tabelle op die Primer Designer-vorm word op die Interaktiewe Volgordekaart as soliede groen en pers stawe getoon, en op die Sequence Editor as donker geskakeerde groen en pers streke.

Pas die Primer-seleksie-parameters aan

Verskeie parameters kan op die Primer Designer-vorm aangepas word, sodat jy kan spesifiseer hoe die primers gekeur sal word. Alhoewel die verstekinstellings van die parameters voldoende is vir 'n tipiese PKR-reaksie, sal jy dit waarskynlik tot 'n mate moet aanpas, afhangende van die aard van jou eksperiment. Die parameters en hul funksies word in die tabel hieronder uiteengesit:

ParameterFunksie
Lengte ReeksSpesifiseer die minimum en maksimum lengtes van die primers.
%GC-reeksSpesifiseer die minimum en maksimum persentasie GC-inhoud in die onderlaag. Doeltreffende primers het oor die algemeen %GC's van ongeveer 50.
Tm ReeksSpesifiseer die minimum en maksimum smelttemperatuur (in grade Celcius) van die onderlaag, soos bereken deur die Nearest Neighbor-metode (sien hieronder).
3' EindstabiliteitBepaal die D G van die laaste 5 basisse aan 3' einde. 'n Onstabiele 3'-uiteinde (minder negatiewe D G) sal minder vals priming tot gevolg hê.
5' Eindstabiliteit (GC-klem)Bepaal die D G van die laaste 5 basisse aan 5' einde. 'n Stabiele 5'-kant (meer negatiewe D G) sal meer doeltreffende en spesifieke binding aan die sjabloon tot gevolg hê.
D G DimerSpesifiseer die minimum verdraagbare D G vir primer dimeer vorming.
D G HaarnaaldSpesifiseer die minimum verdraagbare D G vir onderlaag haarnaaldvorming.

In die funksies hierbo word al die D G-waardes volgens naaste-buurt-metode bereken (Breslaur et al., 1986).

Daar is drie algemeen gebruikte metodes vir die berekening van die Tm. Uitdrukking gebruik die mees akkurate metode, naaste-buurman. Die formules en verwysings vir die verskillende metodes word in die tabel hieronder opgesom:


PCR Primer Ontwerp

Primer ontwerp vir PCR
Algemene Ontwerpoorwegings. Maak seker dat:

  • Die primerlengte is tussen 15-30 bp homoloog aan die teiken-DNS-volgorde. Ek stel voor om met 20-25 bp primers te begin.
  • Die Tm van elke onderlaag is tussen 55-65 °C
  • Die GC-inhoud van elke onderlaag is tussen 40-60%
  • Die Tm van beide primers is baie soortgelyk, dit wil sê binne

Spesifieke oorwegings vir Golden Gate-onderdele

Spesifieke oorwegings vir BioBrick Parts

    • Maak seker dat die genomiese DNA wat geamplifiseer moet word, geen EcoRI-, PstI-, Spel- of XbaI-plekke bevat nie.
    • Ek skep tipies 'n PCR-produk wat 'n XbaI-werf stroomop van die deel het, en SpeI-, NotI- en PstI-werwe stroomaf van die deel.
    • Die Biobrick-deel begin met 'n beginkodon (ATG) en eindig met twee opeenvolgende stopkodons (TAATAA).
    • Dan moet die voorste onderlaag die vorm hê:

    5′ CCTTTCTAGAG (15-20 bp van die koderingstreng, begin ATG) 3′

    en die omgekeerde onderlaag moet van die vorm wees:

    5′ AAGG’CTGCAGCGGCCGCTACTAGT’A (15-20 bp omgekeerde komplement, begin TTATTA) 3′

    Hier is daar 'n vier nukleotiede (in kursief) wat die beperkingsplekke flankeer (in vetdruk) sulke spasieerders word benodig om die beperkingsensieme behoorlik te laat sny.

    Spesifieke oorwegings vir BioFusion Parts

    • Maak seker dat die genomiese DNA wat geamplifiseer moet word, geen EcoRI-, PstI-, Spel- of XbaI-plekke bevat nie.
    • Ek skep tipies 'n PCR-produk wat 'n XbaI-werf stroomop van die deel het, en SpeI-, NotI- en PstI-werwe stroomaf van die deel.
    • Die insetsel vir die voorwaartse primer begin nie met TC nie (of anders word 'n DAM I-plek (GATC) gevorm, en XbaI kan nie sny nie).
    • Die Biofusie-konstruksie begin nie met 'n beginkodon nie, en eindig ook nie met 'n stopkodon nie.
    • Dan moet die voorste onderlaag in die vorm wees:

    5′ ”CCTT””’TCTAGA”’ (15-20 bp van die koderingstreng) 3′
    en die omgekeerde onderlaag moet van die vorm wees:
    5′ ”AAGG””’CTGCAGCGGCCGCTACTAGT”’ (15-20 bp omgekeerde komplement) 3′
    Hier is daar 'n vier nukleotiede (in kursief) wat die beperkingsplekke flankeer (in vetdruk) sulke spasieerders word benodig om die beperkingsensieme behoorlik te laat sny.

    • Let wel: as dit nie moontlik is om 'n goeie stel primers te maak met die flankerende streke wat hierbo beskryf is nie, probeer om die eerste 4 basisse – wat buite die beperkingsplek is – van elke primer te verander, bv. <br>5′ ”AAGG””’TCTAGA”’ (15-20 bp van die koderingstreng) 3′ <br>
    • Let wel: as jy steeds nie 'n goeie stel primers kan kry nie, probeer om 'n heeltemal ander stel flankerende streke te gebruik om die primers te verbeter. Byvoorbeeld, jy kan ook 'n PCR-produk gebruik wat die EcoRI-, NotI- en XbaI-werwe stroomop van jou deel het, terwyl die Spel-webwerf stroomaf van jou deel is.

    In hierdie geval sal die voorwaartse primer van die vorm wees: 5′ ”CCTT””’GAATTCGCGGCCGCATCTAGA”’ (15-20 bp komplement tot koderingstreng)3′ en die omgekeerde primer moet van die omgekeerde primer wees vorm: <br> 5′ ”AAGG””’ACTAGT”’ (15-20 bp komplement tot kodering strand) 3′.

    Ontwerp primers met behulp van Vector NTI
    'n Maklike manier om onderlaag te ontwerp, is om Vector NTI te gebruik.


    Hoe belangrik is die GC-klem wanneer primers ontwerp word? - Biologie

    Vir groot sjablone soos BAC's, PAC's en kosmiede wat hoër vlakke van onsuiwerhede kan hê, beveel ons die gebruik van die SP6long primer aan in plaas van die standaard SP6 primer, wat 'n marginaal lae Tm het. Die SP6long primer is vier basisse langer (so kyk vir versoenbaarheid met jou vektore), maar werk goed vir groot templates wanneer die korter SP6 primer misluk.

    Primer-ontwerpoorwegings

    • ’n Smelttemperatuur (Tm) in die reeks van 50 C tot 65 C
    • Afwesigheid van dimeriseringsvermoë
    • Afwesigheid van beduidende haarnaaldvorming (>3 bp)
    • Gebrek aan sekondêre priming terreine
    • Lae tot matige spesifieke binding aan die 3'-kant (vermy hoë GC-inhoud om mispriming te voorkom)

    Ten slotte, wees bewus daarvan dat geen stel riglyne altyd die sukses van 'n onderlaag akkuraat sal voorspel nie. Sommige primers kan misluk vir geen duidelike rede nie, en primers wat swak kandidate blyk te wees, kan goed werk.


    BatchPrimer3 is nog 'n Primer3-gebaseerde primer ontwerp sagteware gratis aanlyn beskikbaar. Daar is 'n groot hoeveelheid primer subtipes om te ontwerp, insluitend generiese PCR primers. BatchPrimer3 vereis dat 'n FASTA-volgorde ingevoer of opgelaai moet word. 'n Tussentydse keuse van primerparameters is ook daar om aan te pas.

    Die Eurofins Genomics se Primer Design Tools gebruik die Prime+-program van die GCG Wisconsin-pakket, oorspronklik geskryf deur Irv Edelman. Al wat nodig is, is 'n teikenvolgorde, wat gekopieer en in die program geplak word, dan het jy die opsie om die ontwerpparameters aan te pas. Die uitset bevat ook 'n voorgestelde uitgloeitemperatuur om vir elke onderlaagpaar te gebruik.

    Het jy enige gratis PCR primer ontwerp sagteware voorstelle om by die lys te voeg? Laat 'n opmerking hieronder met jou voorkeurkeuse en ek sal seker wees om die lys op te dateer.