Inligting

Wat is die verskil tussen mutasie per basispaar en mutasie per genoom?

Wat is die verskil tussen mutasie per basispaar en mutasie per genoom?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Word genoomgrootte nie beskou as die aantal basispare wat in DNA teenwoordig is nie? So wat is die verskil tussen die mutasie per basispaar en mutasie per genoom? Is hulle soortgelyk of verskillend?


Hulle is verskillende normalisasies van dieselfde getal. Dit is die vraag of jy wil weet hoeveel mutasies op 'n enkele posisie in 'n genoom verwag kan word, en of jy wil weet hoeveel mutasies oor die hele genoom voorkom.

Sien byvoorbeeld wikipedia:

Daar is verskeie natuurlike eenhede van tyd vir elk van hierdie koerse, met koerse wat óf gekarakteriseer word as mutasies per basispaar per seldeling, per geen per generasie, óf per genoom per generasie.

Mutasies per genoom is die aantal mutasies per basispaar keer die aantal basispare in die genoom (plus mutasies wat nie ooreenstem met basispaarsubstitusies nie, alhoewel hulle gewoonlik in hierdie metings geïgnoreer word).

Byvoorbeeld, $10^{-9}$ mutasies per basispaar in 'n genoom van 3 biljoen basispare stem ooreen met $3$ mutasies per genoom.


Mutasietempo

In genetika is die mutasie tempo is 'n maatstaf van die tempo waarteen verskeie tipes mutasies gedurende een of ander tydseenheid plaasvind. Mutasietempo's word tipies gegee vir 'n spesifieke klas mutasie, byvoorbeeld puntmutasies, klein- of grootskaalse invoegings of delesies. Die tempo van substitusies kan verder onderverdeel word in 'n mutasiespektrum wat die invloed van genetiese konteks op die mutasietempo beskryf.

Daar is verskeie natuurlike eenhede van tyd vir elk van hierdie koerse, met koerse wat óf gekarakteriseer word as mutasies per basispaar per seldeling, per geen per generasie, óf per genoom per generasie. Die mutasietempo van 'n organisme is 'n ontwikkelde eienskap en word sterk beïnvloed deur die genetika van elke organisme, benewens sterk invloed van die omgewing. Die boonste en onderste grense waartoe mutasietempo's kan ontwikkel, is die onderwerp van voortdurende ondersoek.


Beraming van die per-basis-paar mutasietempo in die gis Saccharomyces cerevisiae

Alhoewel mutasietempo's 'n sleutelbepaler van die evolusietempo is, is dit moeilik om presies te meet en globale mutasietempo's (mutasies per genoom per generasie) word dikwels geëkstrapoleer vanaf die per-basis-paar mutasietempo met die veronderstelling dat mutasietempo uniform is oor die genoom. . Deur gebruik te maak van ontluikende gis, beskryf ons 'n verbeterde metode vir die akkurate berekening van mutasietempo's gebaseer op die fluktuasietoets. Ons ontleding dui daarop dat die per-basis-paar mutasietempo's by twee gene aansienlik verskil (3.8031010)byURA3en 6,4431010byKAN1) en ons stel 'n definisie vir die effektiewe teikengrootte voor van gene (die waarskynlikheid dat 'n mutasie die geen inaktiveer) wat erken dat die mutasietempo nie eenvormig oor die genoom heen is nie.

evolusie. Dit beperk die spoed van aanpassing in populasies met voordelige mutasies in die afwesigheid van voordelige mutasies dit bepaal die ewewigsfiksheid van die populasie. Ten spyte van die belangrikheid daarvan, is daar groot onsekerhede in skattings van die genoom per-generasie mutasietempo. Om hierdie parameter te skat is tipies 'n drie-stap proses: die bepaling van die mutasietempo na 'n spesifieke fenotipe, die omskakeling van hierdie fenotipiese tempo in 'n per-basis-paar mutasietempo in 'n spesifieke geen, en ekstrapolering van hierdie plaaslike tempo na die hele genoom. In hierdie artikel fokus ons op die tegniese uitdaging om fenotipiese mutasietempo akkuraat te bepaal en die analitiese taak om die effektiewe teikengrootte van 'n geen te bepaal, die waarskynlikheid dat 'n mutasie iewers in 'n gedefinieerde segment van die genoom 'n mutasie met 'n bepaalde fenotipiese effek.

Drie metodes word algemeen gebruik om fenotipiese mutasietempo's te meet: mutasie-akkumulasie soos-sê, mutant accumulation assas-sês, en fluktuasietoetse. Die mutasie-akkumulasie-toets behels dat 'n kultuur deur herhalende knelpunte, ideaal van 'n enkele sel/individu, deurgevoer word, sodat alle mutasies byna neutraal is. Dit is nuttig vir die bepaling van die tempo van mutasies wat fiksheid beïnvloed aangesien herhaalde knelpunte die effek van seleksie sal verminder (Kibotaand Lynch 1996 Zeyl en Devisser 2001). Hierdie metode werk goed in multi-sellulêre organismes, waar die bevolkingsgrootte by die bottelnek gehandhaaf kan word, maar in mikro-organismes, waar 'n sigbare kolonie toegelaat moet word om te vorm, sal seleksie steeds tussen die bottelnekke plaasvind. Verskeie

metodes is beskikbaar vir die skatting van fenotipiese mutasietempo's van mutamutasie-akkumulamutasie-toetse (Garcia -Dorado en Gallego 2003) alternatiewelik kan direkte volgordebepaling gebruik word aangesien alle mutasies in dieselfde genoom voorkom (Denveret al.2004 Haag) -Liautardet al. 2007).

In die mutant-akkumulasie-toets word die frekwensie van 'n fenotipe wat neutraal is in die omgewing van die eksperiment, maar waarvoor in 'n alternatiewe omgewing geselekteer kan word, in 'n eksponensieel groeiende kultuur gemonitor deur periodiek 'n aliquot van die kultuur op selektiewe medium te plaas. . Sodra die populasie so 'n grootte bereik dat die waarskynlikheid dat 'n nuwe mutasie in die volgende generasie plaasvind, ongeveer een is, sal die frekwensie van mutante lineêr toeneem met verloop van tyd. Dus vereis 'n akkurate skatting van fenotipiese mutasietempo 'n lang intervalle tussen frekwensiemetings en hierdie eksperimentele metings duur tipies vir honderde generasies. Omdat die meeste van die bevolking nie die neutrale mutasie opgehoop het nie, sal voordelige mutasies hoofsaaklik voorkom in selle wat nie die neutrale mutasie het nie, en sodoende die ophoping van mutante vertraag.

In die fluktuasietoets word baie parallelle kulture met 'n klein aantal selle geënt, onder nie-selektiewe toestande gekweek en uitgeplaat om vir mutante te selekteer (Luriaand Delbru¨ ck1943). Die aantal mutasies wat in elke kultuur ontstaan, sal die Poisson-verspreiding volg, maar die aantal mutante selle per kultuur sal baie verskil aangesien vroeë mutasies sal lei tot ''jackpots'' kulture wat 'n groot aantal mutante individue bevat.

Die eenvoudigste manier om die verwagte aantal mutasies wat in elke kultuur voorkom (m) te skat, is uit die fraksie van kulture met geen mutante, wat em behoort te wees. Hierdie metode (

P0) is deur Luriaand Delbru¨ ck (1943) gebruik in hul oorspronklike artikel wat die fluktua-1 beskryfOoreenstemmende skrywer:Departement Molekulêre en Sellulêre Biologie,

Harvard Universiteit, 16 Divinity Ave., Kamer 3000, Cambridge, MA 02138. E-pos: [email protected]

sie-toets. Die volle verspreiding van mutante per kultuur (die Luria–Delbru¨ ck verspreiding) kan beskryf word deur 'n stel rekursiewe vergelykings (Maet al. 1992). Die mees akkurate metode vir skatting (Ma–Sandri–Sarkar maksimum waarskynlikheid) vind hulle wat die beste passing van die Luria–Delbru¨ck verspreiding by die data gee (Sarkar et al. 1992 Roscheand Foster 2000). Deur simulasie, bereken Stewart (1994) 95% vertrouensintervalle wat met hierdie metode gebruik word, maar vir die vertrouensintervalle om betekenisvol te wees, moet die data die Luria–Delbru¨ ck verspreiding volg.

Een manier om die kwaliteit van data te skat is om die kumulatiewe verspreiding van mutantfrekwensies op 'n log-log plot te teken. Luria-Delbruck-verspreide data wat op hierdie manier aangebied word, sal 'n reguit lyn met helling 1 produseer (Roscheand Foster 2000). Afwykings van lineariteit toon dat die data nie 'n Luria–Delbru¨ck verspreiding benader nie. Hierdie grafiese benadering ignoreer boerpotte (aangesien hulle ver van die lyn af lê) en kulture met geen mutante (as gevolg van die log-transformasie). In hierdie artikel stel ons 'n simulasie-gebaseerde benadering bekend om die kwaliteit van data van fluktuasietoetse te bepaal en wys hoe hierdie metode afwykings van die Luria–Delbru¨ ck verspreiding kan opspoor.

Om fenotipiese mutasietempo's om te skakel na 'n per-basis-paar mutasietempo, moet ons die effektiewe teikengrootte vir fenotipiese mutasie skat. Alhoewel die konsep van effektiewe teikengrootte belangrik is in evolusieteorie - dit koppel die mutasietempo aan 'n bepaalde fenotipe aan die mutasietempo per genoom per generasie - is dit nie eksplisiet gedefinieer nie. Vorige werk het ''teikengrootte'' gebruik om te verwys na die grootte van die geen waarin mutasies geselekteer word (Drake1991), maar kan ook die aantal mutasies binne 'n verslaggewer beskryf wat opspoorbaar is. Ons stel 'n meer algemene en waarskynlike definisie van effektiewe teikengrootte voor wat die verband tussen fenotipiese en genomiese mutasietempo's insluit. Ons definisie illustreer waar onsekerhede in skattings van genomiese mutasietempo ontstaan ​​en wys hoe hierdie parameter uit eksperimentele data bereken kan word. In die besonder onderskei ons tussen die effektiewe teikengrootte gebaseer op die gemiddelde per-genoom mutasietempo en die lokusspesifieke effektiewe teikengrootte gekondisioneer op 'n mutasiegebeurtenis wat in 'n spesifieke streek van die genoom plaasvind.

Ons het mutasietempo's gemeet teen weerstand teen 5-fluoroorotiese suur (5-FOA), kanavanien en a-faktor. 5-FOA is nie-toksies, maar kan omgeskakel word in toksiese 5-fluoro-uracil deur die uracil biosintese pad. Die produk van dieURA3gene kataliseer 'n sleutelstap in hierdie proses, daarom selekteer 5-FOA hoofsaaklik forura3 verlies-van-funksie mutante. Kanavanien is 'n toksiese arginienanaloog, waarvan die opname die arginienvervoerder benodig. Canavanine selekteer vir verlies-van-funksie mutante van hierdie vervoerder, wat deur die CAN1gene gekodeer word.a-Factor is 'n peptiedferomoon wat deur paring-tipea (MATa) selle afgeskei word. Binding van die feromoon aan die Ste2-reseptor op

aMATacell seine deur 'n MAP-kinase-kaskade om die paringsreaksie-gene en 'n G1arrest te inisieer (Dohlman

2002). Wild-tipe MATa-selle skei 'n protease, Bar1, af wat die verwydering van 'n faktor afbreek. Daar is ten minste 10 gene wie se verlies-van-funksie ina-faktor weerstand tot gevolg het, daarom verwag ons dat die mutasietempo tot a-faktor weerstand 'n orde van grootte hoër sal wees as die mutasietempo na 5-FOA en canavanine weerstand. Ons vind die fenotipiese mutasietempo's na 5-FOA, kanavanien, ena-faktor weerstand as 5.43 3 108, 1.52 3 107, en 3.07 3 106/ genoom/generasie, onderskeidelik. Deur ons skattings van fenotipiese mutasietempo's en lokusspesifieke effektiewe teikengroottes te kombineer, kom ons tot die gevolgtrekking dat die per-basis-paar mutasietempo's byURA3enCAN1 3,8031010 isen 6.4431010/bp/generation, onderskeidelik, wat daarop dui die mutasietempo wissel oor die gisgenoom.

Stamme en media:GIL104 is 'n haploïede gisstam afkomstig van die W303 agtergrond met genotipeURA3,leu2,trp1, CAN1, ade2, his3, bar1DTADE2, MATa. Gis is ingegroei

sintetiese volledige (SC) medium (Shermanet al.1974), SC

medium sonder uracil (SCUra), of SC medium met slegs 1% glukose (SCLG). Die kulture wat die fluktuasie-toetse saamgestel het, is op vier tipes selektiewe media uitgeplaat: 13

canavanine½SC medium sonder arginien (SCArg), 60 mg/liter-kanavanien (Sigma-Aldrich, St. Louis) 103kanavanien

(SCArg, 0,6 g/liter-kanavanien) 5-FOA½SCUra, 1 g/liter

5-FOA (Sigma-Aldrich) anda-faktor ½ gisekstrak, peptoon, dekstrose (YPD), 10mg/mla-faktor (Bio-Sintese, Lewisville, TX). Ter voorbereiding vir die platering van verskeie kolle mutantkulture op elke plaat, is die plate oordroog deur 'n Whatman-filtreerpapier (graad 3, 90 mm) op die plate te druk, 'n replika-plateerblok te gebruik en die filter in plek te laat bly vir by ten minste 30 min. Die filters verwyder 1 ml vloeistof en plate kan vir 'n paar dae gebruik word nadat filters verwyder is.

Fluktuasietoetse: Fluktuasietoetse is op 10 klone van GIL104 uitgevoer om die tempo waarteen selle gemuteer het om weerstandig te word teen 5-FOA, 103 kanavanien, ora-faktor te bepaal. Media- en kultuurvolumes is so gekies dat 'n soortgelyke aantal mutante vir elke fenotipe getel sou word: 200ml SC, 100ml SC, en 10ml SCLG vir weerstand teen 5-FOA, 103canavanine, anda-faktor, onderskeidelik.

(ses kolle per bord) 100-ml-kulture is op agt 103-kanavanien-plate (nege kolle per bord) gevlek en 10-ml-kulture is met steriele water tot 100 ml gebring en op agt a-faktor plate (nege kolle per bord) gevlek ). ’n Tecan Genesis-vloeistofhanteerder (Tecan U.S., Durham, NC) is gebruik om kolplatering semi-outomatiseer. Ons neem aan dat die verlies van mutante selle as gevolg van verdamping, vloeistofhantering en onvolledige plateringsdoeltreffendheid weglaatbaar is. Onder die toestande wat gebruik is, was die gemiddelde aantal selle per kultuur 2,13107, 1.33107, en 3,8 3 105, vir 5-FOA, 103 canavanine, en a-faktor, onderskeidelik.

Plate is toegelaat om oornag te droog teen kamertemperatuur en dan geïnkubeer by 30° vir 1, 2 of 5 dae fora-faktor, 103

canavanine, en 5-FOA, onderskeidelik, waarna die aantal mutante per kol met behulp van 'n disseksiemikroskoop getel is. Vir 103canavanine anda-faktor plate het ons 'n grootte drempel gebruik: kolonies, 1 mm by 103 vergroting vir canavanine of 3 mm by 63 vergroting fora-faktor is vermoedelik voortspruit uit mutasies wat plaasgevind het nadat die selle geplaat is en is nie getel nie. Die keuse van die grootte-afsnypunt was gebaseer op die soeke na 'n natuurlike onderbreking in die kolonie-grootte verspreiding. Die kolonie-grootte verspreiding was egter nie bimodaal nie, daarom is dit redelik om te aanvaar dat sommige lekkende mutante uitgesluit is. Dit is duidelik wanneer ons boerpotte waarneem van mu-tante kleiner as ons grootte drempel, wat uitgesluit is van die ontleding. Om hierdie rede is dit belangrik dat die stamme wat ons gevolgorde het om teikengrootte te bepaal uit die plate van die fluktuasietoetse gekies is sodat enige lekkende mutante, wat by die bepaling van mutasietempo uitgesluit is, ook uitgesluit is van die berekening van teiken grootte. Fluktuasietoetse vir weerstand teen 13kanavanien is soortgelyk aan dié vir 103kanavanien uitgevoer, behalwe 13

canavanine plate is 3 dae na-platering getel.

Ontleding van skommelingsdata: Skommelingsdata is ontleed deur die Ma-Sandri-Sarkar maksimum-waarskynlikheid-metode waarin die data op 'n model van die Luria-Delbru¨ ck-verspreiding gepas word op grond van 'n enkele parameterm, die verwagte aantal mutasies gebeure per kultuur (Sarkaret al.1992).

Mutasietempo word bereken uit die vergelyking m¼m/N, waar Ni die gemiddelde aantal selle per kultuur is (ongeveer gelyk aan die aantal seldelings per kultuur aangesien die aanvanklike inokulum baie kleiner as N is). Vyf-en-negentig persent vertrouensintervalle onmandm is toegeken deur gebruik te maak van vergelykings 29 en 30 van Foster(2006).

Die data is ook aangepas by 'n twee-parameter model wat rekening hou met postplating groei. Hierdie model is 'n Luria-

Delbru¨ ck-verspreiding oorgetrek met 'n Poisson-verspreiding met 'n tempoNmd¼md, waarby die gemiddelde aantal seldelings (waarin mutante kan voorkom en opgespoor word) in die lyn van selle wat op die selektiewe plate uitgeplaat is, in verband gebring kan word met die aantal generasies van groei naplatering (g) byd¼ 2g 1. Die waarskynlikheidsverdeling vir die aantal mutante

per kultuur in die twee-parameter-model is dus die gesamentlike verspreiding van die Luria–Delbru¨ck (parameter m) en die Poisson (parametern¼md) hulle s’n is dieselfde, met die veronderstelling dat die mutasietempo dieselfde is vir die postplating selafdelings.

Ons het twee toetse gebruik om te bepaal of die een- of die twee-parameter modelle die beste by die data pas. Beide het staatgemaak op die berekening van die waarskynlikheid van die herwinning van die waargenome data gegewe die model. Hierdie waarskynlikheid, Pj, waar die aantal parameters in die model is, is bereken as Pj ¼Pmax

N i waar pi die waarskynlikheid is om imutante waar te neem en Ni is die aantal onafhanklike kulture wat imutante kolonies produseer. Die log-waarskynlikheid-verhouding-toets bereken L¼2(log(P2)log(P1)),

wat as 'n x2 versprei word-verspreiding met 1 d.f. van Akaike inligtingskriterium (AIC) bereken die parameter AIC¼ 2j2(log(Pj)) en beweer dat die beste passing die een met die laagste AIC-waarde is. TheFtest is nie geskik vir hierdie vergelykings nie aangesien dit 'n lineêre model aanneem met foute wat uit dieselfde normaalverspreiding by elke datapunt getrek word, beide aannames wat geskend word deur die data wat uit fluktuasietoetse gegenereer word.

Volgordebepaling van ura3 en can1 mutante: Tabel 1 lys die primers wat gebruik is om theura3 en can1 allele van onderskeidelik 5-FOA en 103 kanavanien-weerstandige kolonies te amplifiseer en te volg. Voor die isolasie van genomiese DNA, is 5-FOA en 103canavanine-weerstandige kolonies herstrep op selektiewe medium.

Rekenkundige analise: Die Ma-Sandri-Sarkar maksimum-waarskynlikheid-analise en die twee-parameter-passing is in Matlab (MathWorks, Natick, MA) uitgevoer. Pas by die twee-parameter model is bereik deur die optimalisering van m(withd fixed), optimizingd(withmfixed), en hierdie proses te herhaal totdat konvergensie. AIC is gebruik om te bepaal watter model die beste by die data pas (Akaike1974). Matlab was ook gewoond aan

simuleer laat fluktuasie data, bereken die som-van-kwadrate verskille tussen Luria–Delbru¨ ck verspreidings en data, en selflaai-strap skattings van effektiewe teikengroottes om 95% vertrouensintervalle te genereer. Matlab-lêers vir die meeste van hierdie bewerkings is beskikbaar by http://murraylab.mcb.harvard.edu/fluctuation/programs.htm.

Primers wat in hierdie studie gebruik is

Primer naam Volgorde Doel

URA3extF 59ATCAAAGAAGGTTAATGTGG 39 PCR

URA3extR 59TCATTATAGAAATCATTACG 39 PCR/volgorde

URA3extF3 59TTGATTCGGTAATCTCCGAG 39 Volgorde

URA3intF2 59TGGGCAGACATTACGAATGC 39 volgordebepaling

URA3intR2 59CAAACCGCTAACAATACCTG 39 Opeenvolging

CAN1extF2 59TCTTCAGACTTCTTAACTCC 39 PCR

CAN1extR2 59ATAGTAAGCTCATTGATCCC 39 PCR/volgorde

CAN1ext/intF1 59AAAAAAGGCATAGCAATGAC 39 Opeenvolging

CAN1intF2 59GACGTACAAAGTTCCACTGG 39 Opeenvolging

CAN1intF3 59TCAAAGAACAAGTTGGCTCC 39 Opeenvolging

CAN1intR2 59TAGATGTCTCCATGTAAGCC 39 Opeenvolging

Fluktuasietoetse en fenotipiese mutasietempo's:

Die akkuraatheid van mutasietempo skattings van fluktuasie-toetse hang af van hoe die eksperiment uitgevoer word en hoe die data ontleed word. Ons het verbeterings aan albei aangebring en oorweeg elkeen om die beurt.

Uitvoering van fluktuasietoetse: Een manier om die akkuraatheid van mutasietemposkattings van fluktuasietoetse te verhoog, is om die aantal kulture te verhoog (Stewart 1994). Tipies word fluktuasietoetse in proefbuise uitgevoer, maar om die deurset te verhoog, doen ons die toetse in 96-put plate. Ons plaas 72 van die kulture in selektiewe medium om die aantal mutante per kultuur te bepaal, die oorblywende 24 word gebruik om die gemiddelde aantal selle per kultuur te bepaal (sien materiale en metodes). Deur die 96-put-formaat te gebruik, kan ons verskil

die kweekvolume van 10 tot 200ml en kan mutasietempo's oor twee ordes van grootte meet (Tabel 2). Eerder as om kulture op selektiewe medium te versprei, sien ons kulture op oorgedroogde plate waar hulle eenvormig oor 'n area van 1,3–3 cm2 versprei, afhangende op die volume raakgesien. Dit verhoog doeltreffendheid en verminder die aantal plate aangesien tot nege kulture op een bord opgemerk kan word.

Die kombinasie van kolplating en die 96-put-formaat maak voorsiening vir outomatisering van die fluktuasietoets. Om dit te demonstreer, het ons die proses semi-outomatiseer met behulp van 'n vloeistofhanteerder, dit het ons in staat gestel om alle fluktuasietoetse wat hier beskryf word—die ekwivalent van drie 720-buis fluktuasietoetse— parallel uit te voer.

Ontleed fluktuasiedata en plaas groei op 13

canavanine: Daar is baie metodes vir die berekening van mutasietempo's uit fluktuasiedata (Foster 2006), waarvan die Ma-Sandri-Sarkar maksimum-waarskynlikheid-metode verkies word omdat dit die akkuraatste is, dit is

geldig vir enige reeks van die verwagte aantal mutasiegebeurtenisse per kultuur (m), en 95% vertrouensintervalle kan deur 'n empiries-bepaalde stel vergelykings bereken word (Stewart1994 Roscheand Foster2000). Vir ramings van mutasietempo's en 95% vertrouensintervalle wat deur hierdie metode gegenereer word om akkuraat te wees, moet die data die Luria–Delbru¨ck verspreiding benader. Ons het hierdie benadering getoets deur die Ma-Sandri-Sarkar maksimum-waarskynlikheid-metode te gebruik om te skat en dan die voorspelde kumulatiewe frekwensieverspreiding van mutante teen die eksperimentele data uit te stip. Fluktuasietoetse op 5-FOA het noue ooreenstemming tussen voorspelde en waargenome verspreidings geproduseer (Figuur 1). In teenstelling hiermee het toetse op 13 kanavanien en a-faktor data opgelewer wat aansienlik afwyk van die Luria–Delbru¨ ck verspreiding. In vergelyking met die verwagte verspreiding, is kulture met 'n klein aantal mutante onderverteenwoordig en kulture met baie mutante is oorverteenwoordig in die 13canavanine eksperiment (Figuur 1, een-parameter model). Hierdie afwyking kan verklaar word as die kombinasie van 'n Luria–Delbru¨ ck-verspreiding en 'n Poisson-verspreiding.

Een moontlike verklaring is dat kanavanien-sensitiewe selle kan verdeel en kan aanleiding gee tot kanavanien-weerstandige mutasies nadat hulle uitgeplaat is, sal die aantal addisionele mutantkolonies die Poisson-verspreiding volg. Ons het die verspreiding van mutantfrekwensies by 'n twee-parameter model aangepas wat postplating groei en mutasie insluit. Hierdie model is die gesamentlike verspreiding van 'n Luria–Delbru¨ ck-verspreiding (met parameterm) en 'n Poisson-verspreiding (met param-etern¼md). Die data van 13canavanine het beter gepas by die twee-parameter model (Figuur 1).

Ons het die verbetering van die pas gekwantifiseer deur twee metodes. Die eerste is om die beste log waarskynlikheid te vergelyk

Fenotipiese mutasietempo's

Mutasietempo (mutasies/genoom/generasie)

A 5.51 (4.31–6.82) 2.08 (1.67–2.51) 6.49 (4.89–8.24)

B 5,51 (4,31–6,81) 1,81 (1,44–2,20) 4,77 (3,53–6,15)

C 6,28 (4,96–7,70) 2,21 (1,77–2,69) 7,19 (5,49–9,07)

D 6,58 (5,23–8,04) 1,88 (1,51–2,29) 5,08 (3,73–6,58)

E 5,60 (4,40–6,90) 2,06 (1,66–2,50) 4,48 (3,25–5,85)

F 6,07 (4,81–7,44) 1,87 (1,49–2,28) 6,70 (5,10–8,45)

G 5,35 (4,21–6,59) 1,76 (1,41–2,14) 4,74 (3,50–6,12)

H 6,05 (4,79–7,42) 2,05 (1,65–2,49) 5,01 (3,69–6,47)

I 6,00 (4,76–7,36) 1,79 (1,43–2,17) 7,03 (5,33–8,90)

J 5,50 (4,35–6,76) 2,09 (1,67–2,55) 3,05 (2,11–4,11)

Gemiddeld6SD 5,8560,41 1,9660,16 5,4561,34

Gekombineer 5.86 (5.46–6.28) 1.95 (1.83–2.08) 5.43 (4.97–5.91)

Mutasiekoerse toa-faktor weerstand, kanavanien weerstand (CanR), en 5-fluoroorotiese suur weerstand (5-FOAR) vir 10 klone van GIL104. Hakies dui die 95% vertrouensintervalle aan wat bereken is deur gebruik te maak van vergelykings 29 en 30 van Foster(2006). Die gekombineerde datastel hanteer die 10 72-buis fluktuasietoetse as een 720-buis

bereken onder een- en twee-parameter modelle. Solank as wat 'n groot aantal kulture gebruik word, word twee keer die verskil tussen die beste een- en tweeparametertellings½L¼2(log(P2 Param)log(P1 Param) versprei

asx2met 1 d.f. Dit beteken dat as die beste twee-parameter telling is .1.92 log-eenhede beter as die beste een-parameter telling die waarskynlikheid is.0.95 dat die twee-parameter model beter by die data pas. Die tweede metode was om die AIC te gebruik, wat beide die log waarskynlikheid en die aantal parameters gebruik in die berekening van 'n telling om die model te vind wat die beste by die data pas. Beide word in meer besonderhede beskryf in materiale en metodes.

Vir fluktuasietoetse op 13canavanine, dui beide die log-waarskynlikheid-verhouding-toets en die AIC aan dat die data die beste deur die twee-parameter-model pas. Vir fluktuasie-toetse op 5-FOA is daar geen verbetering van passing deur die twee-parameter model te gebruik nie. Om postplating mutasie te minimaliseer, het ons die kanavanienkonsentrasie 10-voudig verhoog en die plate 1 dag vroeër getel. Die data van 103 canavanine benader die Luria–Delbru¨ck verspreiding nader (Figuur 1). Alhoewel die twee-parameter-model steeds 'n effens beter passing gee, word die data volgens beide die log-waarskynlikheid-verhouding-toets en die AIC die beste gepas deur die een-parameter-model. Vir die fluktuasie-toets ona-faktor word die data die beste gepas deur die twee-parameter model, maar albei modelle slaag nie daarin om al die kenmerke van hierdie verspreiding vas te lê nie (Figuur 1). Fenotipiese mutasietempo's: Fluktuasietoetse is uitgevoer om mutasietempo's na a-faktor, 103 te bepaal

canavanine, en 5-FOA weerstand vir 10 isogeniese klone van 'n stam van die W303 agtergrond (GIL104) die data is ontleed met behulp van die een-parameter en twee-parameter modelle (Tabelle 2 en 3, onderskeidelik). Vir elke toets is die log-waarskynlikheid-verhouding-toets en die AIC toegepas om te bepaal watter model die beste by die data pas

(Tabel 3). Alle fluktuasietoetse op a-faktor word die beste beskryf deur die twee-parameter model terwyl alle fluktuasietoetse op 5-FOA die beste beskryf word deur die Luria–Delbru¨ck verspreiding (die een-parameter model). Vir 103 canavanine is vyf fluktuasietoetse volgens die log-waarskynlikheid-verhouding-toets, of ses volgens die AIC, die beste gepas deur die twee-parameter model.

Deur gebruik te maak van die gekombineerde data van die 10 klone (effektief 'n fluktuasietoets met 720 parallelle kulture) en die twee-parameter model bepaal ons fenotipiese mutasietempo's toa-faktor, 103canavanine en 5-FOA weerstand as 3.073 106, 1.52 3 107, en 5,43 3 108, onderskeidelik. Vir 5-FOA-weerstand is die data die beste beskryf deur die een-parameter model (d¼0 vir die twee-parameter model, wat beteken dat postplating groei en mutasie nie plaasvind nie), daarom kan ons vergelykings 29 en 30 van Foster(2006) gebruik om 'n 95% vertrouensinterval toe te ken aan ons skatting van mutasietempo. Dit lewer 'n vertrouensinterval van 4,97–5,913108per generasie (Tabel 2). Vir die twee-parameter model het ons vertrouensintervalle deur simulasie bepaal. Vir elke gekombineerde 720-kultuasie-skommelingstoets het ons die mees waarskynlike waardes bepaal, gegewe die data. Om die verwagte variasie in hierdie parameters te bepaal, het ons 1000 fluktuasietoetse gesimuleer deur die gekombineerde Luria-Delbru¨ck/Poisson-verspreiding te steekproef deur parameters wat uit die data bepaal is, te gebruik. Ons neem die 95% vertrouensintervalle vir ons skatting ofm om die waardes ofm te wees wat 95% van die gesimuleerde eksperimente insluit. Hieruit bereken ons die 95% vertrouensintervalle op die twee-parameter model as 2,65–3,623 106, 1.34– 1.71 3 107, en 4,78–5,87 3 108 vir a-faktor, 103 canavanine, en 5-FOA weerstand, onderskeidelik.

Mutasiespektra en teikengrootte: Mutasiespektra: Ons wou ons fenotipiese mutasietempo's omskakel na Figuur1.—Resultate van drie 72-buise

fluktuasietoetse met behulp van GIL104 kloon A uitgeplaat op 13canavanine, 5-FOA, 103

canavanine, en a-faktor. Soliede sirkels wys die kumulatiewe verspreiding van die data. Soliede krommes dui die kumulatiewe Luria–Delbru¨ck (een-parameter model) verspreidings aan wat by die data pas met parameter m¼4.80, 1.31, 2.82 en 1.97 vir 13 blik-avanien, 5-FOA, 103 kanavanien en a-faktor , onderskeidelik. Die dik geskakeerde kurwe is die twee-parameter model van na-platering groeipas by die data met m¼ 2.31,d¼ 2.62m¼ 2.39,d¼0.37 en m¼1.10 end¼1.42 vir 13canavanine en 103canavanine, onderskeidelik. Die een-parameter en twee-een-parameter modelle is dieselfde vir 5-FOA. Met behulp van Akaike se inligtingmaatstaf (Akaike 1974), het die

per-basis-paar mutasietempo's. Die materiaal vir hierdie omskakeling is die mutasiespektra van die fluktuasietoetse wat ons onderskeidelik 237ura3allele en 227can1allele van 5-FOA- en 103 kanavanien-weerstandige stamme gevolgorde het (die identiteit van al 464 mutante allele is beskikbaar in die aanvullende inligting by http://www.genetics.org/supplemental/). Dertig 5-FOA-weerstandige mutante bevat wilde-tipe URA3 allele 29 van hierdie mutante is uracil prototrofe. Daar is gerapporteer dat mutasies inFUR1 hierdie fenotipe kan verleen, maar ons het egter nie daarin geslaag om enige mutasies binne die koderingsvolgorde van hierdie geen vir enige van die 29 5-FOA-weerstandige uracil prototrofe te vind nie (data nie getoon nie). Nie een van die 207 ura3-mutante is prototrofies nie, en elkeen bevat 'n enkele mutasie of twee mutasies binne 'n paar nukleo-getye. Daar is 167 bp vervangings (64 nonsens en 103 missense), 22 enkel-bp delesies, 3 2-bp delesies, 3 enkel-bp invoegings, een 3-bp invoeging, twee groot tan-dem dupliserings, en nege dubbele mutasies (Figuur 2). Al 227 103 kanavanien-weerstandige mutante bevat 'n enkele mutasie of nabygeleë mutasies by die CAN1lokus. Ons vind 150 bp substitusies (70 nonsens en 80 missense), 55 enkelbp delesies, 8 enkelbp invoegings, een 2-bp invoeging, 10 dubbele mutasies en 3 komplekse mutasies insluitend acan1allel wat 'n 27 bp delesie bevat en 'n 30-bp tandem duplisering (Figuur 3).

Per-basis-paar-tempo van nonsensmutasies: Uit die resultate tot dusver kan ons die per-basis-paar-mutasietempo tot nonsensmutasies by die CAN1- enURA3-gene bereken. Eerstens moet ons die fenotipiese mutasietempo na 5-FOA-weerstand regstel om in ag te neem dat slegs 207 van

237 5-FOA-mutante isURA3-mutante. Dit lei tot 'n mutasietempo vir funksieverlies van 4,753108vir URA3 en 1,523 107virKAN1. As ons hierdie vermenigvuldig koerse volgens die fraksie van nonsensmutasies in die mutasiespektra vind ons dat die koerse van nonsensmutasies byURA3enCAN1 1,473108 isen 4,693 108, onderskeidelik. VirURA3enKAN1, ons het die getel aantal moontlike nonsensvervangings van die bekende volgordes van hierdie gene. URA3 is 804 bp, daarom is daar 2412 moontlike substitusies (804 bp33 moontlike substitusies per basispaar). Hiervan lei 123 tot nonsensmutasies. Deur hierdie tempo's te deel deur die aantal moontlike nonsenssubstitusies en te vermenigvuldig met 3, aangesien daar 3 moontlike mutasies by elke basis is, vind ons dat die nonsensmutasietempo genormaliseer per basispaar 3,5831010 is.virURA3en 6.213 1010virKAN1. Herhaal bogenoemde analise vir al 10 fluktuasietoetse by CAN1 enURA3 uit tabel 3 vind ons dat die per-basis-paar onsin mutasietempo's aansienlik verskil by hierdie twee lokusse (Wilcoxon rangsom, P , 1,833 104). Hierdie berekeninge is uitgevoer met mutasietempo's van die twee-parameter model, wat korrigeer vir postplating groei en mutasie op kana-vanien plate. As ons die eenparametermodel gebruik het, sou die verskil in mutasietempo's tussen URA3 en CAN1 groter gewees het, aangesien die eenparametermodel die fenotipiese mutasietempo's tot kanavanienweerstand oorskat.

Definisie van effektiewe teikengrootte: Ons definieer 'n teikengrootte om twee berekeninge uit te voer: die bepaling van die genomiese mutasietempo gegewe eksperimente wat die mutasietempo by 'n spesifieke lokus meet en die voorspelling van die tempo


1. INLEIDING

Om die genetiese onderbou van prosesse soos aanpassing en spesiasie te verstaan, is 'n groot doel in evolusionêre biologie. Dit vereis die kwantifisering van die aantal betrokke lokusse en hul verspreiding in die genoom (bv. genomiese argitektuur) sowel as die tipe mutasie en hul geassosieerde statistiese eienskappe. Daar is onlangs gefokus op tipes mutasies (bv. SNP's, translokasies, inversies) en gedetailleerde besprekings van die evolusionêre betekenis van verskillende mutasietipes is volop in die literatuur (bv. Choi & Lee, 2020 Faria et al., 2019 Katju & Bergthorsson, 2013). Die meeste van hierdie resensies, sowel as die meeste teoretiese en empiriese studies, ondersoek egter nie die volle reeks mutasietipes nie. Om die relatiewe evolusionêre betekenis van verskillende mutasietipes te verstaan, moet ons hulle gelyktydig in 'n geïntegreerde raamwerk oorweeg.

Vanuit 'n evolusionêre oogpunt is die belangrikste kenmerke van 'n mutasie sy voorkomssyfer, sy populasie genetiese effekte en hoe dit stroomaf evolusionêre uitkomste kan beïnvloed. Hier stel ons 'n navorsingsraamwerk voor wat voordeel trek uit dekades se bevolkingsgenetiese navorsing (Charlesworth & Charlesworth, 2010 Futuyma, 1986) om die bevolkingsgenetiese effekte van verskillende mutasietipes direk te benut om hul relatiewe evolusionêre betekenis te bepaal (Figuur 1a). Ons beskou bevolkingsgenetiese effekte as die impak van 'n mutasie op die bevolkingsgenetiese parameters: rekombinasietempo, effektiewe bevolkingsgrootte, seleksie en dominansiekoëffisiënte (sien Figuur 1c vir 'n oorsig van die bevolkingsgenetiese effekte van elke mutasietipe). Alhoewel ander kenmerke, soos of 'n mutasie regulatoriese of koderende streke affekteer, ook belangrik is vir evolusie (Hoekstra & Coyne, 2007), konsentreer ons hier op eienskappe wat direk aan mutasietipe gekoppel kan word.

Ons raamwerk kombineer wat ons die "vorentoe" en die "omgekeerde" benadering noem. Vanaf mutasie kenmerk die voorwaartse benadering hoe dikwels verskillende tipes mutasies voorkom (Figuur 1b) en hul populasie genetiese effekte (Figuur 1c), om hul rol in verskillende evolusionêre uitkomste te voorspel. Die omgekeerde benadering begin met die evolusionêre uitkoms en, met behulp van empiriese data, bepaal die relatiewe bydraes van veelvuldige mutasietipes op 'n sistematiese wyse. Daar is reeds 'n magdom kennis oor die bevolkingsgenetiese effekte van verskillende mutasies (d.w.s. die vorentoe benadering Dobigny et al., 2017 Elena et al., 1998 Korunes & Noor, 2019 Malik, 2009). Daarteenoor ondersoek min studies verskeie tipes mutasies gelyktydig deur die omgekeerde benadering te gebruik. Dus, hier konsentreer ons op die vorentoe benadering.

Om die vorentoe-benadering uiteen te sit, gee ons 'n nie-uitputtende opsomming van wat bekend is oor mutasietempo's en die bevolkingsgenetiese effekte van die verskillende mutasies, met voordeel van die uitgebreide bestaande werksgroep (Choi & Lee, 2020 Faria et al., 2019 Katju. & Bergthorsson, 2013). Ons beklemtoon dat die kwantifisering van hierdie effekte, die evaluering van verskille tussen mutasietipes en die bepaling van die verspreiding van effekgroottes 'n kritieke stap vorentoe sal wees en verskillende maniere voorstel waarop dit bewerkstellig kan word. Ons bespreek areas waar meer empiriese data, teorie en sintese nodig is vir die vorentoe benadering, en beklemtoon die belangrikheid van die toepassing van die omgekeerde benadering.

1.1 Mutasietempo

Mutasietempo is 'n kritieke parameter wanneer die evolusionêre impak van verskillende tipes mutasies ondersoek word. Dit kan direk gemeet word, deur die aantal mutasies in gamete, sigote of nageslag te vergelyk (Fu & Huai, 2003). Vir SNP's kan dit ook indirek gemeet word deur sinonieme (gewoonlik veronderstelde neutrale) polimorfismedata binne en tussen naverwante spesies te vergelyk. Beramings van die mutasietempo verskil baie oor taksa en mutasietipes (Figuur 1b). Verskillende mutasies verskil egter met betrekking tot hul waarneembaarheid (byvoorbeeld, SNP's is baie meer geneig om opgespoor te word met kortlees-volgordedata as groter invoegings of skrappings [Ho et al., 2020]), wat kan lei tot 'n onderskatting van die mutasietempo van verskillende mutasies. Nuwe metodologieë kan help om hierdie probleem te verbeter. Spesifiek, langleesdata in kombinasie met ander metodologieë soos gekoppelde leesvolgordebepaling (Seo et al., 2016) en chromatienvang- en volgordebepalingstegnieke soos Hi-C (Wang et al., 2020) kan die identifisering van groot strukturele variante vergemaklik. (Christmas et al., 2019). Dus, twee sleutelstappe wat deur ons raamwerk geïdentifiseer word, is om (i) verdere nuwe metodes te ontwikkel wat gelyktydige opsporing van die verskillende mutasietipes moontlik maak, en (ii) beide die aantal sowel as die taksonomiese breedte van studies wat mutasietempo's en direk skat, te vergroot. ontleed verskeie verskillende mutasietipes binne dieselfde takson.


Wat is die verskil tussen mutasie per basispaar en mutasie per genoom? - Biologie

Om die ooreenkomste en verskille tussen mense te verstaan, beset sielkundiges, antropoloë, kunstenaars, dokters en natuurlik baie bioloë. Selfs wanneer daar net op die genetiese verskille tussen mense ingezoem word, is daar 'n skitterende reeks kwessies om te bespreek. Die dag wat DNS wat op 'n misdaadtoneel onttrek is, kan lei tot 'n mokskoot-portret, blyk reeds aangebreek te wees, ten minste volgens 'n onlangse publikasie oor modellering van 3D-gesigsvorm vanaf DNS (P. Claes et al, PLOS Genetics, 10:e1004224, 2014). In die gees van selbiologie deur die getalle, kan ons 'n bietjie basiese intuïsie kry uit die logiese ontleding van die implikasies van 'n paar sleutelgetalle wat betrekking het op die vraag van genetiese diversiteit by mense.

Ons begin deur te fokus op enkelbasispaarverskille, of polimorfismes (SNPs). Ander komponente van variasie soos invoegings en delesies, wisselende aantal geenherhalings (deel van wat bekend staan ​​as kopiegetalvariasies, of CNV's) en transponeerbare elemente sal hieronder aangeraak word. Hoeveel enkele basispaar variasies sou jy tussen jouself en 'n ewekansige geselekteerde persoon van 'n straathoek verwag? Opeenvolgingspogings soos die 1000 genome-projek gee ons 'n reël. Hulle vind ongeveer een SNP per 1000 basisse. Dit wil sê, ander komponente opsy gesit, die basis vir die bewering dat mense 99,9% geneties soortgelyk is. Maar hierdie genetiese ooreenkoms laat die vraag ontstaan: hoekom voel ons so anders as daardie persoon wat ons op straat raakloop? Wel, hou aan lees om van ander genetiese verskille te leer, maar 'n mens moet ook waardeer hoe ons brein ingestel is om verskille op te let en te versterk en die verenigende eienskappe uit te deel, soos dat ons almal twee hande, een neus, 'n groot brein ensovoorts het. . Vir 'n vreemdeling sal ons waarskynlik almal identies lyk, net soos jy twee muise kan sien en as hul pelsjas dieselfde is, sal hulle soos klone lyk, selfs al is die een die Richard Feynman van sy stam en die ander die Winston Churchill.

Terug na die getalle. Kom ons kyk na die akkuraatheid en implikasies van die reël van een SNP per 1000 basisse. Die menslike genoom is ongeveer 3 Gbp lank. Dit dui op ongeveer 3 miljoen SNP's onder twee ewekansige mense. Dit is inderdaad die gerapporteerde waarde tot binne 10% wat geen verrassing is nie aangesien dit die oorsprong van die duimreël is (BNID 110117).Wat kan ons nog oor hierdie getal sê? Met ongeveer 20 000 gene wat elk 'n koderende volgorde (eksone) het van ongeveer 1,5 kb lank (d.i. ongeveer 500 aminosure lank proteïen gemiddeld), dek die menslike koderingsvolgorde 30 Mbp of ongeveer 1 persent van die genoom. As SNP's ewekansig langs die genoom versprei is, sal dit ongeveer 30 000 SNPs oor die genoomkoderende volgorde voorstel, of net meer as 1 per geenkoderende volgorde. Die gemete waarde is ongeveer 20 000 SNP's wat 'n gevoel gee van hoe verkeerd ons was in ons aanname dat die SNP's ewekansig versprei word. Ons is dus statisties verkeerd, aangesien enige statistiese toets 'n indrukwekkende lae waarskynlikheid sal gee dat hierdie laer waarde toevallig sal verskyn. Dit is waarskynlik 'n aanduiding van sterker suiwerende seleksie op koderende streke. Terselfdertyd, vir ons praktiese terme, dui hierdie minder as 2-voudige variasie daarop dat hierdie vooroordeel nie baie sterk is nie en dat die 1 SNP per geen 'n redelike reël is.

Hoe vertaal hierdie verspreiding van SNP's in veranderinge in aminosuur in proteïene? Kom ons aanvaar weer homogene verspreiding onder aminosuurveranderende mutasies (nie-sinoniem) en dié wat nie die aminosuur-identiteit beïnvloed nie (sinoniem). Uit die genetiese kode behoort die aantal nie-sinonieme veranderinge wanneer daar geen seleksie of vooroordeel van enige aard is nie, ongeveer vier keer dié van sinonieme mutasies te wees (d.w.s. sinonieme mutasies is ongeveer 20% van die moontlike mutasies, BNID 111167). Dit is omdat daar meer basissubstitusies is wat 'n aminosuur verander as dié wat die aminosuuridentiteit dieselfde hou. Wat vind 'n mens in die werklikheid? Ongeveer 10 000 mutasies van elke tipe word eintlik gevind (BNID 110117) wat wys dat daar inderdaad 'n vooroordeel is ten opsigte van ondervoorstelling van nie-sinonieme mutasies, maar in ons orde van grootte wêreldbeskouing is dit nie 'n groot een nie.

Een tipe mutasie wat egter veral belangrik kan wees, is die nonsensmutasie wat 'n stopkodon skep wat vertaling vroeg sal beëindig. Hoe dikwels kan ons naïef verwag om sulke mutasies te vind gegewe die algehele vrag van SNP's? Drie van die 64 kodons is stopkodons, so ons sou grof 20 000*3/64 ≈ 1000 vroeë stopmutasies verwag. Waarnemings toon ongeveer 100 sulke nonsensmutasies, wat 'n sterk selektiewe vooroordeel teen sulke mutasies aandui. Tog vind ons dit interessant om na die persoon langs ons te kyk en te dink watter 100 proteïene in ons genome verskillend afgekap is. Danksy die diploïede aard van ons genome is daar gewoonlik nog 'n volledig ongeskonde kopie van die geen (die situasie staan ​​bekend as heterosigositeit) wat as rugsteun kan dien.

Hoe verskil jou genotipe van elkeen van jou ouers? Gestel hulle het onverwante genotipes, moet die waardes hierbo in die helfte gesny word aangesien jy die helfte van jou pa- en moedergenome deel. So nog 'n hele paar afgeknotte gene en gesubstitueerde aminosure. Die situasie met jou broer of suster is kwantitatief soortgelyk aangesien jy weer gemiddeld die helfte van jou genome deel (met die veronderstelling dat jy nie 'n identiese tweeling is nie ...). Eintlik, vir ongeveer 1/4 van jou genoom, is jy en jou broer of suster soos identiese tweelinge, dit wil sê julle het dieselfde twee ouerlike kopieë van die DNA. Invoegings en delesies (met die bynaam indels) van tot ongeveer 100 basisse is moeiliker om op te noem, maar 'n orde van grootte van 1 miljoen per genoom word waargeneem, ongeveer 3000 daarvan in koderende streke (dus 'n onderverteenwoordiging van ongeveer 'n halwe orde van grootte). Groter variasies van langer strekte, insluitend kopiegetalvariasies, is in die tienduisende per genoom, maar omdat dit sulke lang strekte is, kan hul gesommeerde lengte langer wees as die aantal basisse in SNP's.

Die vermoë om hierdie variasies volledig te karakteriseer is 'n baie onlangse wetenskaplike prestasie, wat eers in die derde millennia begin het met die onvergeetlike wedloop tussen die menslike genoomprojekkonsortia en die groep onder leiding van Craig Venter. Deur die resultate tussen hierdie twee spanne te vergelyk, vind 'n mens dat in die vergelyking van die genoom van Craig Venter met dié van die konsensus menslike genoomverwysingsvolgorde, daar ongeveer 1,2% verskil is wanneer indels en CNV's oorweeg word, 0,1% wanneer SNP's oorweeg word: ≈ 0,3% wanneer inversies in ag geneem word - 'n totaal van 1,6% (BNID 110248). In die dekade wat gevolg het op die opeenvolging van die menslike genoom, het tegnologieë uiters vinnig vorentoe beweeg wat gelei het tot die 1000 Genomes Project wat vir sommige van ons lesers na 'n rotasieprojek kan lyk teen die tyd dat hulle hierdie woorde lees. Wie weet hoe gou die leser werklik na ons aangehaalde nommers kon kyk deur sy of haar genoom uit hul mediese verslag te laai en dit met een of ander toevallige vriend te vergelyk.


Afsluiting

Mutasieteling is lank reeds 'n voordelige hulpmiddel in nie net die plantteler se gereedskapkis nie, maar ook in basiese genetikus. In gewasse waar diversiteit vir 'n gegewe eienskap laag of nie bestaan ​​nie, bied geïnduseerde mutagenese 'n moontlikheid. Met 'n duidelike objektiewe, doeltreffende mutageniese protokol, en 'n hoë deurset en doeltreffende fenotipiese siftingsmetode, kan mutagenese tot groot voordeel wees vir die verbetering van gewasplante.


Wat is die verskil tussen mutasie per basispaar en mutasie per genoom? - Biologie

Mitochondria is "organelle" binne lewende selle wat verantwoordelik is vir die maak van die geldeenheid van energie genaamd ATP (Adenosientrifosfaat), wat alle selle nodig het om te funksioneer. Mitochondria dra hul eie afsonderlike DNA (mtDNA) wat onafhanklik is van die kern-DNS van dieselfde sel. Menslike mtDNS bestaan ​​uit 37 gene wat altesaam ongeveer 16 000 basispare is. Hierdie mtDNA muteer ook teen 'n baie vinniger tempo as kern-DNS (nucDNA). Menslike mtDNS is volledig gekarteer en al die koderende streke is bekend (sowel as die proteïene of RNA waarvoor hulle kodeer). Sommige van die mtDNA kodeer vir niks nie (gedink om hierdie afdelings immuun te maak teen "natuurlike seleksiedruk"), en staan ​​bekend as die "beheerstreke". Een spesifieke streek blyk vinniger te muteer as enige ander streek (1,8 keer vinniger), omdat die variasie tussen mense hier die grootste is. 4 Wanneer die sel verdeel, neem elke sel van die mitochondria saam. Die mitochondria repliseer hulself onafhanklik binne die sel. Verder is daar algemeen aanvaar dat mitochondria altyd van die moeder na die nageslag oorgedra word sonder om betrokke te wees by genetiese skuifel en herkombinering van mtDNA met die mtDNA van die vader. Onlangs is hierdie idee egter uitgedaag. Soos dit blyk, is baie gevalle van paternaal-afgeleide mtDNS in moderne families van mense sowel as ander spesies opgespoor. Oorweeg die bevindinge van 'n interessante studie gepubliseer deur Schwartz en Vissing in die 2002-uitgawe van die New England Journal of Medicine:

" Soogdier mitochondriale DNA (mtDNA) word vermoedelik streng moederlik geërf. Sperm mitochondria verdwyn in vroeë embriogenese deur selektiewe vernietiging, inaktivering, of eenvoudige verdunning deur die groot oorskot van oösiet mitochondria. . . Die onderliggende meganisme wat verantwoordelik is vir die eliminasie van sperm mtDNA in normale embrio's word nie goed verstaan ​​nie. Ons spekuleer dat die proses in sommige gevalle gebrekkig kan wees, wat spermmitochondria toelaat om te oorleef en diegene met 'n selektiewe voordeel die moontlikheid te gee om in sekere weefsels te heers. . . Baie klein hoeveelhede van vaderlik oorgeërfde mtDNA is opgespoor deur die polimerase kettingreaksie (PCR) in muise na verskeie generasies van interspesifieke terugkruisings. Studies van sulke basters en van muis-oösiete wat met sperm in die mikro-inspuiting ingespuit is, ondersteun die hipotese dat spermmitochondria geteiken word vir vernietiging deur kerngekodeerde proteïene. Ons rapporteer die geval van 'n 28-jarige man met mitochondriale miopatie as gevolg van 'n nuwe 2-bp mtDNA-uitwissing in die ND2 geen (ook bekend as MTND2), wat 'n subeenheid van die ensiemkompleks I van die mitochondriale respiratoriese ketting kodeer. Ons het vasgestel dat die mtDNS wat die mutasie huisves, vaderlike oorsprong was en 90 persent van die pasiënt se spier-mtDNS uitmaak." 47

So, wat beteken so 'n bevinding met betrekking tot mtDNA-mutasietempo's en molekulêre horlosies? Wel, oorweeg die volgende opmerkings deur Morris en Lightowlers gepubliseer in 'n 2000-uitgawe van Die Lancet:

Daar word algemeen aanvaar dat mitochondriale DNA (mtDNA) uitsluitlik van die moeder geërf word. Verskeie onlangse referate het egter voorgestel dat elemente van mtDNA soms van die vader geërf kan word. Hierdie hipotese is gebaseer op bewyse dat mtDNA rekombinasie kan ondergaan. As dit wel gebeur, moet moederlike mtDNS in die eier oorsteek met homoloë volgordes in 'n ander DNA-molekule. vaderlike mtDNS lyk die mees waarskynlike kandidaat. As mtDNA kan herkombineer, ongeag die meganisme, is daar belangrike implikasies vir mtDNA-evolusie en vir filogenetiese studies wat mtDNA gebruik. 48

Voordat hierdie bewyse van vaderlike oorerwing ontdek is, is aanvaar dat mtDNA streng die gevolg was van moederlike oorerwing. Op grond van hierdie aanname is aanvaar dat die mitochondriale nageslag presiese kopieë van die mitochondria wat die moeder gehad het sou kry, behalwe as daar 'n mutasiefout was. Hierdie foutkoers in die nie-koderende gedeelte van mitochondriale DNS is lank reeds gedink dat dit een keer elke 300 tot 600 generasies voorkom, of elke 6 000 tot 12 000 jaar vir mense.

Die Berkeley-biochemici wat die teorie ontwikkel het, Allan Wilson, Rebecca Cann en Mark Stoneking, het verskeie oënskynlik redelike aannames gemaak. Aangesien daar geen DNA-veranderinge was as gevolg van genetiese rekombinasie-gebeure (dws: met vaderlike DNA - nou bekend as 'n verkeerde aanname), het hulle aangeneem dat alle veranderinge in die mtDNA die gevolg was van mutasies met verloop van tyd en dat hierdie mutasies plaasgevind het teen 'n konstante koers. Op grond van hierdie aannames het die navorsers geglo dat hulle toegang het tot iets soos 'n "molekulêre horlosie." Omdat mtDNA vermoedelik vinniger muteer as kern DNA (nucDNA), is daar gedink dat die vinniger mutasietempo van mtDNA meer akkurate tydhou as nucDNA.

Die oorspronklike 1987-studie het mtDNA van 136 vroue van baie wêrelddele met verskillende rasse-agtergronde betrek. Die ontleding het blykbaar die idee van 'n enkele voorouerlike mtDNA-molekule ondersteun van 'n vrou wat ongeveer 200 000 jaar gelede in Afrika suid van die Sahara woon. Later het meer gedetailleerde studies blykbaar hierdie gevolgtrekking bevestig. Ongelukkig was daar egter 'n onopgemerkte vooroordeel in die rekenaarprogram sowel as by die navorsers self. Die navorsers het 'n rekenaarprogram gebruik wat ontwerp is om 'n "maksimum parsimony" filogenie of die stamboom met die minste aantal mutasieveranderinge te openbaar. Dit was gebaseer op die aanname dat evolusie die mees direkte en doeltreffende pad sou geneem het (wat nie noodwendig waar is nie, of selfs waarskynlik is nie). Die rekenaarprogram was ook bevooroordeeld deur die volgorde van data-invoer om die inligting wat eerste ingevoer is, te bevoordeel. Hierdie probleem is herken toe die rekenaar verskillende resultate gegee het, afhangende van die volgorde waarin die data ingevoer is. Nou, na duisende rekenaarlopies met die data wat lukraak ingevoer is, blyk dit dat die "Afrikaanse oorsprong" vir moderne mense nie 'n statistiese betekenisvolheid bo ander moontlikhede inhou nie. 26

Die probleme met hierdie studies was so erg dat Henry Gee, 'n lid van die redaksie van die tydskrif, Natuur, het die studies hardhandig beskryf as "garbage." Nadat die aantal betrokke reekse (136 mtDNA-reekse) oorweeg is, het Gee bereken dat die totale aantal potensieel korrekte spaarsame bome iewers meer as een miljard is. 25 Genetikus Alan Templeton (Washington Universiteit) stel voor dat lae-vlak vermenging onder vroeë menslike bevolkings die DNS-volgordes genoegsaam deurmekaar gemaak het sodat die vraag na die oorsprong van moderne mense en 'n datum vir "Eve" nooit deur mtDNA besleg kan word nie. 22 In 'n brief aan Wetenskap, Mark Stoneking (een van die oorspronklike navorsers) het erken dat die teorie van 'n "African Eve" ongeldig is. 23

Nog 'n interessante aspek van die "molekulêre klok" teorie is die manier waarop die mutasietempo self bepaal is. In teenstelling met wat baie dalk dink, is die mutasietempo aanvanklik nie deur enige soort direkte analise bepaal nie, maar deur veronderstelde filogeniese evolusionêre verhoudings tussen mense en sjimpansees. Met ander woorde, die mutasietempo is bereken op grond van die aanname dat die betrokke teorie reeds waar was. Dit is 'n taamlik sirkelvormige aanname en as sodanig sal alle resultate wat op hierdie aanname gebaseer is, ooreenstem met hierdie aanname - soos 'n selfvervullende profesie. Aangesien die koers op grond van vorige aannames van evolusionêre tyd bereken is, sal die resultate outomaties die vorige aannames "bevestig". As 'n mens werklik onafhanklike bevestiging van 'n teorie wil hê, kan jy nie die bevestigingstoets kalibreer deur die teorie, of enige deel van die teorie, wat getoets word nie. En tog, dit is presies wat gedoen is deur wetenskaplikes soos Sarich, een van die pioniers van die molekulêre-klok idee. Sarich het begin deur die mutasiekoerse van verskeie spesies te bereken ". wie se divergensie betroubaar van fossiele gedateer kon word." Hy het toe daardie kalibrasie toegepas op die sjimpansee-mens-splitsing, wat dateer wat van vyf tot sewe miljoen jaar gelede gebreek het. Deur Sarich se mutasiekalibrasies te gebruik, het Wilson en Cann dit op hul mtDNA-studies toegepas en ". die verhouding van mitochondriale DNA divergensie onder mense tot dié tussen mense en sjimpansees." 24 Deur hierdie metode het hulle bereken dat die gemeenskaplike voorouer van alle moderne mense, die "African Eva", ongeveer 200 000 jaar gelede geleef het.

Dit is duidelik dat hierdie datums, bereken vanaf die mtDNA-analise, moet ooreenstem met die veronderstelde evolusionêre tydskaal aangesien die berekening op hierdie voorveronderstelling gebaseer is. Die sirkulariteit van hierdie metode is teenstrydig met goeie wetenskaplike metode en is waardeloos wat onafhanklike voorspellingswaarde betref. Die "mitochondriale klok" teorie was en is basies 'n teorie binne 'n teorie deurdat dit geen onafhanklike voorspellingskrag buite die evolusieteorie het nie. Dit is dan verbasend dat wetenskaplikes nie vroeër hierdie inherente fout opgespoor het nie. Interessant genoeg is egter hierdie fout in redenasie nie vir baie jare opgespoor nie en sou dalk vir baie langer onopgespoor gebly het as 'n meer direkte mutasietempo-analise nie gedoen is nie.

Uiteindelik het wetenskaplikes, wat historiese families en hul genetiese geskiedenisse bestudeer, die mutasietempo's begin bevraagteken wat op evolusionêre filogenetiese aannames gebaseer was. Hierdie wetenskaplikes was "verbaas" om te vind dat die mutasietempo in werklikheid baie hoër was as wat voorheen gedink is. Trouens, dit was ongeveer 20 keer hoër teen ongeveer een mutasie elke 25 tot 40 generasies (ongeveer 500 tot 800 jaar vir mense). Dit blyk dat mense in hierdie gedeelte van die kontrolestreek, wat ongeveer 610 basispare het, tipies met ongeveer 18 mutasies van mekaar verskil. 3 Deur eenvoudige wiskunde volg dit dat moderne mense sowat 300 geslagte terug in tyd 'n gemeenskaplike voorouer deel. As 'n mens 'n tipiese generasietyd van ongeveer 20 jaar aanneem, plaas dit die datum van die gemeenskaplike voorouer op ongeveer 6 000 jaar voor hede. Maar hoe kan dit wees?! Thomas Parsons lyk net so verward. Oorweeg sy volgende kommentaar gepubliseer April van 1997, in die joernaal Natuurgenetika:

" Die tempo en patroon van volgordevervangings in die mitochondriale DNA (mtDNA) beheergebied (CR) is van sentrale belang vir studies van menslike evolusie en vir forensiese identiteitstoetsing. Hier rapporteer ons 'n direkte meting van die intergenerasionele substitusietempo in die menslike CR. Ons het DNS-volgordes van twee CR hiperveranderlike segmente van nabye moederverwante, van 134 onafhanklike mtDNA-afstammelinge vergelyk wat oor 327 generasiegebeure strek. Tien substitusies is waargeneem, wat gelei het tot 'n empiriese koers van 1/33 generasies, of 2.5/site/Myr. Dit is ongeveer twintig keer hoër as skattings wat uit filogenetiese ontledings verkry is. Hierdie ongelykheid kan nie bloot verreken word deur substitusies by mutasie-hot kolle nie, wat bykomende faktore voorstel wat die verskil tussen baie naby- en langtermyn skynbare tempo van volgorde-afwyking veroorsaak. Die data dui ook aan dat uiters vinnige segregasie van CR-volgordevariante tussen generasies algemeen by mense voorkom, met 'n baie klein mtDNA-bottelnek. Hierdie resultate het implikasies vir forensiese toepassings en studies van menslike evolusie.

Die waargenome substitusiekoers wat hier gerapporteer word, is baie hoog in vergelyking met koerse wat uit evolusionêre studies afgelei word. 'n Wye reeks CR-vervangingskoerse is afgelei van filogenetiese studies, wat ongeveer 0.025-0.26/plek/Myr strek, insluitend vertrouensintervalle. 'n Studie wat een van die vinniger skattings opgelewer het, het die substitusietempo van die CR hiperveranderlike streke as 0.118 +- 0.031/site/Myr gegee. As 'n generasietyd van 20 jaar aanvaar word, stem dit ooreen met

1/600 generasies en 'n ouderdom vir die mtDNA MRCA van 133 000 j.a. Dus, ons waarneming van die substitusietempo, 2.5/plek/Myr, is ongeveer 20 keer hoër as wat uit filogenetiese ontledings voorspel sou word. Die gebruik van ons empiriese koers om die mtDNA molekulêre horlosie te kalibreer sal lei tot 'n ouderdom van die mtDNA MRCA van slegs

6 500 j.a., duidelik onversoenbaar met die bekende ouderdom van moderne mense. Selfs met die erkenning dat die MRCA van mtDNA jonger kan wees as die MRCA van moderne mense, bly dit onwaarskynlik om die bekende geografiese verspreiding van mtDNA-volgordevariasie deur menslike migrasie te verduidelik wat eers in die laaste

Die berekening word op die volgende manier gedoen: Kom ons kyk na twee ewekansig gekose mense. As aanvaar word dat alle mense aanvanklik identiese mitochondriale DNA het, sal twee sulke ewekansige menslike families na 33 generasies waarskynlik met twee mutasies verskil, aangesien daar twee afsonderlike oorerwingslyne en waarskynlik een mutasie langs elke lyn sal wees. Na 66 generasies sal twee ewekansig gekose mense met ongeveer vier mutasies verskil. Na 100 generasies sal hulle met ongeveer ses mutasies verskil. Na 300 generasies sal hulle met ongeveer 18 mutasies verskil, wat omtrent die waargenome waarde is.

Hierdie eksperimente is nogal kommerwekkend vir evolusioniste wat voorheen bereken het dat die "mitochondriale eve" (wie se mitochondria vermoedelik die voorouer mitochondria vir alle lewende mense is) ongeveer 100 000 tot 200 000 jaar gelede in Afrika geleef het. 1 Die nuwe berekeninge, gebaseer op bogenoemde eksperimente, sou haar relatief jonk maak

6 500 jaar oud. Nou, die vorige idee dat moderne mense tot 10 000 generasies oud is, moet herevalueer word of ten minste die mtDNA-basis vir daardie aanname moet herevalueer word - en dit was. 2

Meer onlangse direkte mtDNA-mutasiekoersstudies blyk ook die vroeëre bevindings deur Parsons en ander te bevestig. In 'n 2001-artikel gepubliseer in die American Journal of Human Genetics, Evelyne Heyer et. al., hul bevindinge van die mtDNA-mutasietempo in diepgewortelde Frans-Kanadese stambome aangebied.

Hul bevindings "Bevestig[ed] vroeëre bevindings van veel groter mutasiekoerse in families as dié wat op filogenetiese vergelykings gebaseer is. . . Vir die HVI-reekse het ons 220 generasies of 6 600 jaar gekry, en vir die HVII-reekse 275 generasies of 8 250 jaar. Alhoewel elkeen van hierdie waardes met 'n groot variansie geassosieer word, wys hulle albei na

7 000-8 000 jaar en dus tot die vroeë Neolitikum as die tyd van uitbreiding [meestal Noord-Europees van oorsprong] . . . Ons algehele CR mutasietempo skatting van 11.6 per terrein per miljoen generasies. . . is hoër, maar nie beduidend anders nie, as die waarde van 6.3 wat onlangs in die onlangse stamboomstudie van vergelykbare grootte aangemeld is. . . In 'n ander studie (Soodyall et al. 1997) is geen mutasies in 108 transmissies opgespoor nie. Aan die ander kant is twee substitusies in 81 uitsendings deur Howell et al. (1996), en nege substitusies is waargeneem in 327 transmissies deur Parsons et al. (1997). Die kombinasie van al hierdie data (1 729 transmissies) lei tot die mutasietempo van 15,5 (Cl 10,3-22,1). Met inagneming van slegs dié uit diepgewortelde stambome (1 321 transmissies) (Soodyall et al. 1997 Sigurdardottir et al. 2000 die huidige studie) lei tot die waarde van 7.9. Laasgenoemde, deur eksperimentele probleme met heteroplasmie te vermy, kan 'n meer realistiese benadering van die algehele mutasietempo verskaf." 44

Oorweeg ook 'n 2003-artikel wat in die Annale van menslike genetika deur B. Bonne-Tamir et al. waar die skrywers hul resultate van 'n hul studie van "Maternale and Paternal Lineages" van 'n klein geïsoleerde Samaritaanse gemeenskap aangebied het. In hierdie artikel het hulle tot die gevolgtrekking gekom:

"In vergelyking met die resultate wat deur ander verkry is oor mtDNA-mutasietempo's, stem ons boonste limietskatting van die mutasietempo van 1/61 mutasies per generasie noukeurig ooreen met dié wat voorheen gepubliseer is." 45 [in vergelyking met die tempo wat deur Parsons van 1/33 bepaal is generasies, 'n koers van 1/61 is nie meer as dubbel nie]

Nog 'n interessante artikel wat in September 2000 in die Tydskrif gepubliseer is Wetenskaplike deur Denver et al. is ook nogal interessant. Hierdie wetenskaplikes het hul werk met die mtDNA-mutasietempo's van nematodewurms gerapporteer en gevind dat hierdie wurm se molekulêre horlosies eintlik omtrent " loop100 keer vinniger as wat voorheen gedink is" [beklemtoning bygevoeg]. 46

" Om die resultate direk aan mense te ekstrapoleer is nie moontlik nie, sê die wetenskaplikes. Maar hul resultate ondersteun onlangse omstrede studies wat daarop dui dat die menslike molekulêre horlosie ook 100 keer vinniger loop as wat gewoonlik gedink word. Dit kan beteken dat skattings van divergensie tussen sjimpansees en mense, en die opkoms van die moderne mens, baie meer onlangs gebeur het as wat tans geglo word, sê die span. "Ons werk blyk menslike ontledings te ondersteun, wat 'n baie hoë koers voorgestel het," sê Kelley Thomas van die Universiteit van Missouri. "Hierdie werk is relevant vir mense," sê Doug Turnbill van die instituut vir Mensgenetika en Newcastle Universiteit, VK. "As die menslike mutasietempo vinniger is as wat gedink word, sal dit 'n groot impak hê op menslike siektes en forensiese ondersoeke, sowel as die evolusionêre tempo van mense." . . .

Mutasietempo's van mtDNA by mense word gewoonlik beraam deur die volgorde van DNA van mense en ander diere te vergelyk. "Dit is soort analise wat gebruik is om te bepaal dat die Afrika-oorsprong van moderne mense ongeveer 200 000 jaar gelede was," sê Thomas. 'Die probleem met hierdie benadering is dat jy na beide die mutasietempo en die uitwerking van natuurlike seleksie kyk,' sê hy. Die tegniek sal ook veelvuldige mutasies in dieselfde stuk mtDNA mis, sê Paul Sharp van die Instituut vir Genetika aan die Nottingham Universiteit, VK.

Meer onlangse studies het gekyk na die mtDNA van mense wat ver verwant is, maar 'n vroulike voorouer deel. Hierdie benadering het hoër mtDNA-mutasiekoerse aan die lig gebring. Maar die resultate is nie deur baie wetenskaplikes aanvaar nie [beklemtoning bygevoeg].

Om die presiese tempo van mutasie by mense te ken, is baie belangrik vir forensiese wetenskap en studies van genetiese siektes, beklemtoon Turnbill. Forensiese identifikasie berus dikwels op die vergelyking van monsters van DNS met monsters van vermeende familielede. Vinniger menslike molekulêre horlosies kan gevestigde presiese verwantskappe bemoeilik, sê hy." 46

Uiteraard is hierdie koerse, gebaseer op meer direkte waarnemings, nie naastenby dié wat op indirekte evolusionêre aannames gebaseer is nie. Dit "kompliseer" dinge tog nou net 'n bietjie, nie waar nie? Is dit egter nie vreemd dat baie wetenskaplikes nog steeds huiwerig is om hierdie resultate te aanvaar nie? Die vooroordeel ten gunste van beide evolusie sowel as miljoene jare vir veronderstelde divergensietye tussen wesens soos ape en mense is so sterk dat dit byna onmoontlik kan wees om die gedagtes te verander van diegene wat sulke posisies beklee.

Daar is baie ander potensiële probleme vir filogenieë wat staatmaak op mtDNA-volgorde-analise en mutasietempo's. Een probleem is dat mtDNA as 'n enkele genetiese lokus funksioneer, baie soos 'n enkele geen in nucDNA doen. Studies wat van 'n enkele genetiese lokus af werk, is meer geneig om deur lukrake genetiese veranderinge geraak te word as wat studies is wat meer as een lokus insluit (hoe meer, hoe beter). Daarom is enkellokusstudies minder akkuraat in die karakterisering van 'n populasie. Daarbenewens is die nuwe bewyse vir vaderlike mtDNA-vermenging nogal problematies. 16

Ook, soos kortliks hierbo bespreek, is die gebruik van beheerstreke as 'n "molekulêre horlosie" dalk nie so geldig as wat voorheen gehoop is nie. Sommige nukleotiedstreke muteer stadig, terwyl ander relatief vinnig kan muteer. 17 Hierdie mutasie "hotspots" kan redelik vinnig muteer selfs binne 'n enkele leeftyd en is intuïtief redelik algemeen by bejaardes. 18 Natuurlik ontstaan ​​sulke "somatiese" mutasies in mitochondria van verskeie liggaamsweefsels en, tensy dit gamete behels, word dit nie na die volgende generasie oorgedra nie. Hulle sou egter steeds filogenetiese interpretasies beïnvloed. Wetenskaplikes het probeer om vir hierdie probleme te vergoed, maar die verskillende metodes het uiteenlopende resultate opgelewer. 19 Ook, soos hierbo bespreek, lewer direkte vergelykings van moderne rye met historiese rye dikwels baie verskil resultate van dié wat deur indirekte metodes beraam word wat op hedendaagse ryverskille gebaseer is. Vir nog 'n voorbeeld van 'n ander spesie, direkte vergelykings van moderne pikkewyne met histories opeenvolgende pikkewyne het getoon dat hul mtDNA-mutasietempo's 2 tot 7 keer vinniger is as wat voorheen deur indirekte metodes aanvaar is. 20 Sekere van hierdie probleme het in werklikheid daartoe gelei dat sommige wetenskaplikes opgehou het om kontrolegebied-reekse te gebruik om menslike filogenieë te rekonstrueer. 21

Daardie wetenskaplikes wat aanhou om die molekulêre horlosiehipotese te probeer hersien, het probeer om die klok te vertraag deur te wys dat sommige mtDNA-streke baie stadiger muteer as ander streke. Die probleem hier is dat sulke streke uiteraard deur natuurlike seleksie geraak word. Met ander woorde, hulle is nie funksioneel neutraal ten opsigte van seleksiedruk nie.

Intydse eksperimente het byvoorbeeld getoon dat die gemiddelde mitochondriale genoommutasietempo ongeveer 6 x 10 -8 mut/plek/mitochondriale generasie is - in lyn met verskeie skattings van gemiddelde bakteriese mutasietempo's (Vergelyk met nDNA-tempo van 4.4 x 10 -8 mut /webwerf/menslike generasie). Met 'n gemiddelde generasietyd van 45 dae is dit ongeveer 5 x 10 -6 mut/plek/jaar en 5 mut/plek/myr.

Dit is omtrent twee keer so hoog as Parsons se koers van 2,5/mut/plek/myr en sowat 40 tot 50 keer hoër as koerse gebaseer op filogenetiese vergelykings en evolusionêre aannames. En dit is die gemiddelde koers van die hele mitochondriale genoom van 16,000pb. Mens kan redelikerwys dink dat alle aspekte van die hiperveranderlike streke (HVI & HVII) 'n hoër as gemiddelde mutasietempo sou hê as dit werklik neutraal is met betrekking tot funksionele seleksiedruk. Gegewe dit, lyk dit of daardie " stadig muterende terreine" met tempo so stadig as 0.065 mut/site/myr (Heyer et al, 2001) op 'n bevooroordeelde manier deur natuurlike seleksie in stand gehou word.

Weereens, sulke nie-neutrale veranderinge is nie noodwendig die weerspieëling van tydsverloop sedert 'n gemeenskaplike voorouer nie, soveel as wat dit die weerspieëling is van die verskillende funksionele behoeftes van verskillende wesens in verskeie omgewings.

Soos met mitochondriale DNA-mutasietempo's, is die mutasietempo's van kern-DNS dikwels bereken op grond van evolusionêre scenario's eerder as op direkte metodes. Deur sulke metodes is die gemiddelde mutasietempo vir eukariote in die algemeen, tot redelik onlangs (sien verdere bespreking hieronder), geskat op ongeveer 2.2 x 10 -9 mutasies per basispaar per jaar. 29 Met 'n gemiddelde generasietyd van 20 jaar vir mense, blyk dit ongeveer 4,4 x 10 -8 mutasies per basispaar per generasie te wees. Aangesien die meeste skattings van die grootte van die diploïede menslike genoom ongeveer 6,3 miljard basispare beloop, sou hierdie mutasiekoers die gemiddelde kind ongeveer 277 mutasieverskille van sy of haar ouers gee. Dit klink na nogal 'n hoë getal en dit is in werklikheid aan die hoë kant van die spektrum in vergelyking met studies wat meer spesifiek kyk na menslike mutasiekoerse teenoor eukariotiese mutasiekoerse in die algemeen. Dit blyk egter dat 'n oorspronklike studie deur Nachman en Crowell hierdie skatting bevestig het deur kontrolevolgorde by mense en sjimpansees te vergelyk. Met behulp van hierdie volgorde vergelykings, "The gemiddelde mutasie tempo is geskat te wees

2.5 x 10-8 mutasies per nukleotiedplek of 175 mutasies per diploïede genoom per generasie" [Gebaseer op 'n hoër diploïede genoom skatting van 7 biljoen basispare]. 30

Hierdie nie-direkte mutasietempo skattings het ook redelik gelyk, aangesien dit gelyk het of dit ooreenstem met die foutkoerse van DNA-replikasie wat plaasvind tussen die vorming van 'n sigoot in een generasie en die vorming van 'n sigoot in die volgende generasie. In die illustrasie 31 hieronder, let op dat vanaf bevrugting tot die vorming van 'n vrou se eerste funksionele gameet, dit ongeveer 23 mitotiese afdelings neem. Mans, aan die ander kant, dra gemiddeld ongeveer twee keer soveel kiemlynmutasies by as vroue. 33 Ten minste 'n deel van die rede is stamselle by mans wat aanhou verdeel sodat hoe ouer 'n man word voordat hy kinders kry, meer mitotiese verdelings voorkom.

Neem nou in ag dat elke diploïede bevrugte sigoot ongeveer 6 biljoen basispare DNA bevat (

3 miljard van elke gameet/ouer, met 'n konserwatiewe ronde getal). 32 Van seldeling tot seldeling is die foutkoers vir DNA-polimerase gekombineer met ander herstelensieme ongeveer 1 fout in 1 biljoen basispare wat gekopieer is. 42 Teen hierdie tempo is daar ongeveer 6 foute met elke diploïede selreplikasiegebeurtenis. Met 'n manlike/vroulike gemiddeld van 29 mitotiese verdelings voor die produksie van die volgende generasie, werk dit uit op ongeveer 175 mutasies per generasie.

Dit is natuurlik reg in lyn met die mutasiekoerse wat op evolusionêre scenario's gebaseer is. Sommige skattings plaas egter die algehele mutasietempo so laag as 1 fout in 10 miljard basispare wat gekopieer is. 43 Teen hierdie tempo sou 'n mens ongeveer 0.6 foute met elke replikasiegebeurtenis verwag en slegs ongeveer 17 mutasies per persoon per generasie. So, dalk is daar iets anders aan die gang wat ook die kern-DNS-mutasietempo beïnvloed? Soos dit blyk, is replikasiefoute nie die enigste bronne van DNA-mutasies nie. Skade aan DNA kan en kom dikwels spontaan voor. Genoomstabiliteit word voortdurend uitgedaag deur 'n diverse verskeidenheid mutageniese kragte wat foute tydens DNA-replikasie, omgewingsfaktore soos UV-bestraling en endogene mutagene soos suurstofvrye radikale wat tydens oksidatiewe metabolisme gegenereer word, insluit. Hierdie skade moet ook op 'n konstante basis opgespoor en herstel word. Natuurlik is hierdie herstel nie perfek nie en dra waarskynlik aansienlik by tot die werklike mutasiekoers bo en behalwe wat deur die indirekte metodes wat reeds bespreek is, beraam.

Aan die ander kant dui meer direkte metodes om die kernmutasietempo's by diere op te spoor dat die werklike gemete tempo dikwels heelwat anders is as die tempo wat deur evolusionêre aannames (beide hoër en laer) voorgestel word. Byvoorbeeld, die waargenome mutasietempo vir C. elegans is gevind dat dit tien keer hoër is as skattings gebaseer op indirekte metodes en evolusionêre aannames. Beskou die volgende uittreksel uit Denver et. al. gepubliseer in Natuur in 2004:

"Alternatiewe benaderings by soogdiere, wat staatmaak op filogenetiese vergelykings van pseudogene lokusse en viervoudig gedegenereerde kodonposisies, ly aan onsekerhede in die werklike aantal generasies wat die vergelykende spesies skei en die onvermoë om vooroordele wat met natuurlike seleksie geassosieer word, uit te sluit. Hier verskaf ons 'n direkte en onbevooroordeelde skatting van die kernmutasietempo en sy molekulêre spektrum met 'n stel van C. elegans mutasie-akkumulasielyne wat 'n mutasietempo wat ongeveer tien keer hoër is as vorige indirekte skattings en 'n oormaat invoegings bo skrapings openbaar." (sien skakel)

Onlangs was daar ook 'n paar direkte metings van menslike mutasietempo's wat nie heeltemal in lyn is met tempo's gebaseer op evolusionêre aannames nie. Een artikel wat in Science gepubliseer is, het 'n direkte meting van die mutasietempo probeer deur die volledige genoomvolgorde van twee nageslag en hul ouers te vergelyk. Hulle skat dat elke nageslag slegs 70 nuwe mutasies gehad het vir 'n mutasietempo van 1,1 x 10-8 per haploïede genoom per generasie (Roach) et al. 2010: Skakel). Nou, hierdie koers is vir 'n haploïede genoom, wat gelykstaande sou wees aan 'n koers van

140 mutasies per diploïede genoom (d.w.s. redelik naby aan die koers hierbo genoem vir 'n diploïede genoom van

170 mutasies per generasie). As dit waar is, sal die tyd van divergensie van mense en sjimpansees op 9 Myr gestel moet word en baie studies van onlangse menslike evolusie kan met 'n faktor van ten minste twee af wees.

So, wat is die groot probleem? Wel, gegewe 'n mutasiekoers van 140 per persoon per generasie, en die feit dat die meeste mutasies funksionele mutasies skadelik is, hoe ontaard die menslike genepoel nie met verloop van tyd nie? Dit sou dalk as 'n beduidende raaisel erken gewees het as dit nie was vir die feit dat tot ongeveer 2014 baie van die menslike genoom lank deur die meeste wetenskaplikes gedink is om geen noemenswaardige funksionele rol te speel nie. Daar is dus geglo dat dit dus 'n hele aantal mutasies kon onderhou sonder enige noemenswaardige nadelige effek op die algehele funksie van die organisme. Die hoeveelheid van hierdie nie-funksionele DNS is een keer beraam deur die koderende gedeelte van DNS te bereken en dit van die totale genomiese vaste eiendom af te trek. Gegewe die gemiddelde koderende gedeelte van 'n menslike geen op ongeveer 1 350 basispare groot (kodeer vir 'n proteïen van ongeveer 450 aminosure groot) 38 al wat 'n mens hoef te doen is om hierdie getal te vermenigvuldig met die totale aantal gene om by 'n redelike skatting te kom van die totale hoeveelheid koderende genetiese eiendom - oorspronklik vermoedelik iewers tussen 2-5% van die genoom.

Daar was egter nogal 'n geruime tyd onenigheid oor die totale aantal gene in die menslike genoom. Vir baie jare is gedink dat mense tussen 70 000 en 140 000 gene het. Wetenskaplikes wat aan die menslike genoomprojek werk, het egter 'n verrassende ontdekking gemaak. Toe hulle 'n rowwe konsep van die projek in Februarie 2001 voltooi het, het hulle geskat dat die werklike geentelling iewers tussen 30 000 en 40 000 gene was. 39 Maar 'n jaar later, in Februarie 2002, by die jaarvergadering van die American Association for the Advancement of Science (uitgewer van Wetenskap), het een van die aanbieders, Victor Velculescu, voorgestel dat die werklike aantal gene in die menslike genoom tog eintlik nader aan 70 000 gene kan wees. 40

Natuurlik is die huidige skatting vir die aantal gene in die genoom terug na 20-30 000. Hierdie getal is egter byna irrelevant noudat daar gevind word dat nie-proteïenkoderende dele van DNA, soos baie sogenaamde pseudogene en miro-RNA's, beduidende funksionaliteit het - saam met ander groot dele van nie-koderende DNA. Trouens, daar word nou voorgestel dat 'n beduidende fraksie van die menslike genoom funksioneel is met skattings wat wissel tussen 16-20% (Kellis, 2014). Sommige skattings het selfs hoër as dit gegaan (sien skakel). Hierdie toename in die bekende hoeveelheid funksionele eiendom binne die genoom maak dit baie meer waarskynlik dat 'n ewekansige mutasie werklik funksioneel relevant sal wees. Dit lyk dalk na 'n taamlik beduidende probleem gegewe 'n mutasiekoers van ongeveer 170 mutasies per persoon per generasie. Vanaf 2012 dui direkte metings van nucDNA-mutasiekoerse gebaseer op ontleding van moderne familielyne egter daarop dat die werklike nucDNA-mutasiekoers ongeveer 70 puntmutasies per persoon per generasie is (Peter D. Keightley, 2012) - wat minder as die helfte van die vorige skattings. Alhoewel dit iemand help met die nadelige mutasiekoersprobleem, los dit regtig nie die probleem op nie, gegewe die veel meer beduidende toename in die hoeveelheid bekende genetiese vaste eiendom wat eintlik in een of ander mate funksioneel is.

Gemeenskaplike voorouer van mense en ape "Living with the Dinosours"?

As 'n interessante eenkant, hierdie verminderde nucDNA-mutasietempo verander die DNS-gebaseerde "klok" aansienlik tot hoe lank weer mense en ape veronderstel is om 'n gemeenskaplike voorouer te deel - van ongeveer ses miljoen tot ongeveer " 40 miljoen jaar gelede." (Callaway, 2012). "Hierdie baie stadige horlosie het die gemeenskaplike voorouer van ape en mense wat saam met die laaste dinosourusse bestaan." Dit is 'n probleem wat David Reich (Departement van Genetika, Harvard Mediese Skool) uitlig deur op te let:

Dit raak baie inderdaad ingewikkeld. Trouens, ek sou sê dat "baie ingewikkeld" 'n bietjie van 'n understatement is as jy die gemeenskaplike voorouer het van mense en ape wat saam met die dinosourusse leef.

en die genetiese agteruitgang van die mensdom

Diegene wat oorspronklik hierdie vraag bestudeer het, het 'n nadelige mutasiekoers (Ud) van 1 tot 3 per persoon per generasie voorgestel met ten minste sommige wetenskaplikes (Nachmann en Crowell, 2000) wat ten minste 3 of meer bevoordeel. 30 Natuurlik sal die werklike nadelige mutasiekoerse, soos kortliks hierbo genoem is, waarskynlik baie hoër wees. In elk geval, selfs gegewe hierdie aanvanklike aannames (aangesien nadelige mutasies meer as voordelige mutasies met ten minste 1 000 tot 1 is), het dit gelyk of die opbou van nadelige mutasies in 'n bevolking tot uitwissing kan lei. 34,36

Nachmann en Crowell beskryf hierdie verwarrende situasie in die volgende gevolgtrekking uit hul referaat oor menslike mutasiekoerse:

Die hoë nadelige mutasietempo by mense bied 'n paradoks. As mutasies vermenigvuldigend interaksie het, sal die genetiese lading wat met so 'n hoë U [nadelige mutasietempo] geassosieer word, ondraaglik wees in spesies met 'n lae voortplantingstempo [soos mense en ape, ens.]. . .

Die vermindering in fiksheid (d.i. die genetiese lading) as gevolg van skadelike mutasies met vermenigvuldigende effekte word gegee deur 1 - e -U (Kimura en Moruyama 1966).Vir U = 3 word die gemiddelde fiksheid tot 0.05 verminder, of anders gestel, elke wyfie sal 40 nageslag vir 2 moet produseer om te oorleef en die populasie op konstante grootte te hou. Dit veronderstel dat alle mortaliteit as gevolg van seleksie is en dus is die werklike aantal nageslag wat nodig is om 'n konstante bevolkingsgrootte te handhaaf waarskynlik hoër.

Die probleem kan ietwat versag word deur sagte seleksie of deur seleksie vroeg in ontwikkeling (bv. in utero). Baie mutasies is egter onvoorwaardelik skadelik en dit is onwaarskynlik dat die voortplantingspotensiaal gemiddeld vir menslike wyfies 40 sigote kan nader. Hierdie probleem kan oorkom word as die meeste skadelike mutasies sinergistiese epistase toon, dit wil sê as elke bykomende mutasie lei tot 'n groter afname in relatiewe fiksheid. In die uiterste gee dit aanleiding tot afkappingseleksie waarin alle individue wat meer as 'n drempelgetal mutasies dra, uit die populasie uitgeskakel word. Alhoewel uiterste afkappingseleksie onrealisties lyk [die dood van almal met 'n nadelige mutasiebalans], dui die resultate wat hier aangebied word aan dat een of ander vorm van positiewe epistase onder skadelike mutasies waarskynlik is. 30

Nachmann en Crowell het hierdie situasie baie raaiselagtig gevind. Hoe raak mens vinniger ontslae van al die slegte mutasies as wat dit geproduseer word? Hulle het verskeie moontlike oplossings voorgestel, soos 'n konsep wat hulle "positiewe epistase" genoem het. As die funksionele effekte van mutasies egter op 'n vermenigvuldigende manier in plaas van byvoeging verhoog word, sou dit die probleem oplos? Soos hierbo genoem, selfs al sou elke nadelige mutasie die dood van sy eienaar veroorsaak, sou die voortplantingslas van die oorlewendes nie verminder nie, maar dieselfde bly.

Kom ons sê byvoorbeeld dat almal met ten minste drie nadelige mutasies sterf voordat hulle voortplant. Die bevolkingsgemiddelde sal binnekort net bo 3 skadelike mutasiekoerse beweeg. Meer as 95% van elke daaropvolgende generasie sal 3 of meer skadelike mutasies hê in vergelyking met die oorspronklike "neutrale" populasie. Die sterftesyfer sal dramaties toeneem. Om tred te hou, sal die voortplantingsyfers van daardie oorlewende individue moet toeneem in verhouding tot die verhoogde sterftesyfer. Dieselfde ding sou uiteindelik gebeur as die doodslyn op 100, 500, 1000, 10000 of meer skadelike mutasies getrek word. Die enigste verskil is die tydsduur wat dit 'n gegewe populasie sal neem om 'n dodelike aantal skadelike mutasies in sy genepoel op te bou wat by 'n relatief "neutrale" beginpunt begin. Die bevolking kan vir baie generasies redelik goed oorleef sonder om groot toenames in die voortplantingsyfer te gebruik. Sonder om van die ophopende skadelike mutasies ontslae te raak, sou die bevolking egter uiteindelik 'n eksponensiële styging in sy sterftesyfer ervaar aangesien sy gemiddelde bevolking die lyn van dodelike mutasies oorskry het.

Aangesien die teorie van positiewe epistase nie die situasie baie help nie, moet 'n ander proses gevind word om te verduidelik hoe om by voorkeur ontslae te raak van nadelige mutasies van 'n bevolking. Oorweeg 'n uittreksel uit a Wetenskaplike Amerikaner artikel gepubliseer in 1999 met die titel, "Mutations Galore":

Volgens die standaard bevolkingsgenetika-teorie impliseer die syfer van drie skadelike mutasies per persoon per generasie dat drie mense voortydig in elke generasie sal moet sterf (of nie sal voortplant nie) vir elke persoon wat voortgeplant het om die nou afwesige skadelike mutasies uit te skakel [ 75% sterftesyfer]. Mense plant nie vinnig genoeg voort om so 'n groot dodetal te ondersteun nie. Soos James F. Crow van die Universiteit van Wisconsin retories gevra het, in 'n kommentaar in Natuur op Eyre-Walker en Keightley se ontleding: "Waarom is ons nie uitgesterf nie?"

Crow se antwoord is dat seks, wat gene rondskuif, toelaat dat skadelike mutasies in bondels uitgeskakel word. Die nuwe bevindinge ondersteun dus die idee dat seks ontwikkel het omdat individue wat (danksy seks) verskeie slegte mutasies geërf het, die genepoel van almal gelyktydig ontslae raak deur nie te oorleef of voort te plant nie.

Tog het natuurlike seleksie in menslike bevolkings verswak met die koms van moderne medisyne, merk Crow op. So hy teoretiseer dat skadelike mutasies nou dalk teen 'n selfs hoër tempo begin ophoop, met moontlik kommerwekkende gevolge vir die gesondheid. Keightley is skepties: hy dink dat baie ligte skadelike mutasies reeds wydverspreid in menslike bevolkings geword het deur ewekansige gebeurtenisse in evolusie en dat verskeie aanpassings, veral intelligensie, meer as vergoed het. " Ek twyfel of ons 'n boete sal moet betaal soos Crow blykbaar dink," merk hy op. " Ons het tot nou toe uitstekend reggekry." 37

Miskien kan die antwoord dan gevind word in 'n kombinasie van prosesse waar beide seksuele replikasie en natuurlike seleksie 'n rol speel om te verhoed dat 'n stadig voortplantende bevolking uitsterf. Oorweeg byvoorbeeld die volgende grafiek wat wys hoe skadelike mutasies opbou in 'n populasie wat op ongeslagtelike wyse voortplant: 49

Let op hoe die mees geskikte "Stamouderklas" (P) getalle in elke generasie verloor terwyl die getalle van diegene wat groter getalle skadelike mutasies het, al hoe meer opbou. In hierdie artikel merk Rice op dat in ongeslagtelike bevolkings die enigste manier om hierdie opbou van nadelige mutasies werklik te oorkom, is om die voortplantingstempo aansienlik te verhoog. Maar wat van voordelige mutasies? Rice kommentaar, " Skaars omgekeerde en kompenserende mutasies kan skadelike mutasies, deur genetiese rylopery, teen die vloei van genetiese polarisasie beweeg. Maar dit is 'n geringe invloed, analoog aan waterturbulensie wat soms 'n klippie 'n entjie stroomop vervoer." 49 So, hoe kan seksueel voortplantende bevolkings hierdie probleem oorkom?

Wanneer dit by seksueel voortplantende populasies kom, maak die vermoë vir genetiese rekombinasie tydens die vorming van gamete dit moontlik om beide goeie en slegte mutasies te konsentreer. Kom ons sê byvoorbeeld ons het twee individue, elk met 2 nadelige mutasies. Gegewe seksuele herkombinasie tussen hierdie twee individue, is daar 'n redelike kans dat sommige van hul nageslag (1 kans uit 32) nie enige oorgeërfde nadelige mutasies sal hê nie. Maar wat gebeur as die koers van bykomende nadelige mutasies redelik hoog is? - sê 3 per individu per generasie?

Om net 'n bietjie meer hierna te kyk, oorweeg nog 'n voorbeeld van 'n bestendige bevolking van 5 000 individue wat elk begin met 7 nadelige mutasies en 'n gemiddelde nadelige mutasiekoers van 3 per individu per generasie. Gegewe 'n reproduksietempo van 4 nageslag per elk van die 2 500 paartjies (10 000 nageslag), in een generasie, hoeveel nageslag sal dieselfde of minder nadelige mutasies hê as die ouergenerasie?


Klonale seleksie as 'n alternatiewe meganisme vir die generering van veelvuldige mutasies

Die hipotese dat tumorprogressie opeenvolgende golwe van klonale seleksie behels, is aanvanklik deur Nowell (2) bekendgestel. Onder hierdie hipotese verleen elke geselekteerde mutasie 'n proliferatiewe voordeel, wat lei tot opeenvolgende klonale afstammelinge. Die voorkoms van opeenvolgende chromosoomveranderinge is gedemonstreer in kwaadaardige melanoom (39), en die mees omvattende in adenokarsinoom van die kolon (40). 'n Bekommernis met die idee van opeenvolgende mutasies gevolg deur streng seleksie is dat elke mutasie 'n groot selektiewe voordeel sal moet verleen, selfs resessiewe mutasies wat slegs in een van twee allele voorkom. Alhoewel 'n opeenvolgende model vir mutasie-akkumulasie voorgestel is vir die ontstaan ​​van menslike kolonkanker (40), is daar getoon dat slegs 'n klein fraksie van die gewasse (6.6%) die drie mees dikwels afgebakende mutasies bevat (41). Hierdie resultate impliseer dat veelvuldige mutasies bykomend tot dié wat algemeen voorkom by die generering van kolonkanker betrokke kan wees.

'n Mutatorfenotipe en seleksie vir mutasies in spesifieke onkogene en tumoronderdrukkergene is nie wedersyds uitsluitende konsepte nie, dit word nou algemeen aanvaar dat mutasies willekeurig kan voorkom, en mutasies wat klonale proliferasie beheer, kan geselekteer word. Boonop kan hierdie prosesse interafhanklik wees. Opeenvolgende rondtes van seleksie vir mutasies wat proliferasie in E coli lei tot 'n populasie van selle wat 'n mutatorfenotipe uitdruk (42). Met elke rondte van seleksie vir verskillende voordelige mutasies, is daar gelyktydige seleksie vir mutasies in gene wat die mutasies in hierdie gene produseer, (d.w.s. mutatormutante). 'n Soortgelyke rylopery van mutatorgene tydens opeenvolgende rondtes van seleksie is ook in gis gedemonstreer (R. Kolodner, persoonlike mededeling) en kan van toepassing wees op die groei van gewasse waar seleksie is vir mutante wat 'n groeivoordeel onder verskillende toestande toon. Hanahan en Weinberg (43) het in 'n omvattende ontleding ses noodsaaklike veranderings in selfisiologie geïdentifiseer wat kwaadaardige groei lei. Dus kan beide klonale seleksie en die generering van mutatormutante operatief wees tydens tumorprogressie, en die oorheersende pad kan verskil in verskillende gewasse.


Toegang opsies

Kry volledige toegang tot joernaal vir 1 jaar

Alle pryse is NETTO pryse.
BTW sal later by die betaalpunt bygevoeg word.
Belastingberekening sal tydens afhandeling gefinaliseer word.

Kry tydsbeperkte of volledige artikeltoegang op ReadCube.

Alle pryse is NETTO pryse.


Materiaal en metodes

Bakteriese stamme en media.

Die wilde-tipe stam PFM2 is 'n prototrofiese afgeleide van die E coli K12 verwysingsstam MG1655 (73, 74). Die MutL-stam PFM5 is 'n afgeleide van PFM2 met die mutL geen vervang deur 'n in-raam litteken volgorde (75). Besonderhede van die genetiese tegnieke en media wat gebruik word, word in SI Materiale en Metodes.

Beraming van mutasiekoerse deur fluktuasietoetse.

Mutasiekoerse na Nal R of Rif R is beraam met behulp van fluktuasietoetse soos beskryf (76). Verdere besonderhede word gegee in SI Materiale en Metodes.

MA-prosedure.

MA-lyne het ontstaan ​​uit enkelkolonies wat elke dag op LB-agarplate geïsoleer is. Om vooroordeel te vermy, was die kolonie wat vir deurgang gekies is, 'n goed geïsoleerde een naaste aan 'n lyn wat in die middel van die plaat getrek is. Oorspronklik is 100 lyne van die wilde-tipe stam en 70 lyne van die MutL - stam begin, maar verliese het plaasgevind tydens deurgang (wanneer 'n enkele kolonie nie verkry is nie), DNS-voorbereiding, biblioteekkonstruksie en as gevolg van afstamming onduidelikhede (sien Gedeelde mutasie-analise hieronder). Elkeen van hierdie stappe was verantwoordelik vir 'n vermindering van ongeveer 20%, wat gelei het tot die aantal lyne wat in Tabel 1 gegee word. Die verliese was ewekansig en behoort dus nie die resultate te beïnvloed nie. In geen geval het 'n lyn verlore gegaan omdat dit uitgesterf het nie. Verdere besonderhede word gegee in SI Materiale en Metodes.

Skatting van generasies en sellewensvatbaarheid in kolonies.

Die aantal generasies per gang, geskat uit die aantal selle in kolonies van 'n gegewe deursnee, was gewoonlik 28 generasies. Die fraksie van dooie selle in hersuspendeerde kolonies wat met die Lewende/Dooie BacLight Bacterial Viability Kit (Invitrogen, Inc) bepaal is, was 0.05 ± 0.01 (gemiddeld ± SEM). Verdere besonderhede word gegee in SI Materiale en Metodes.

Genomiese DNA Voorbereiding.

Die PureLink Genomic DNA-suiweringstel (Invitrogen Corp.) is gebruik om genomiese DNA te suiwer vanaf 0.5–1 ml van oornag LB-kulture wat uit die vrieskasvoorraad geënt is. DNS konsentrasie en suiwerheid is geassesseer met behulp van 'n NanoDrop ND-1000 Spektrofotometer (Thermo Fisher Scientific, Inc.).

Opeenvolging en kwaliteitbeheer.

Volgordebepaling is uitgevoer by Beijing Genome Institute (BGI) met behulp van die Illumina HiSeq2000-platform. Vir elke MA-lyn is ~101 (470 Mbp) gepaarde-end-lesings (2 × 90 bp) behou nadat leeswerk wat nie aan BGI se gehaltebeheer voldoen het nie, weggegooi is. Lees met enige een van die volgende kenmerke is weggegooi: (ek) ≥10% onleesbare basisse (ii) ≥20% lae gehalte (≤Q20) basisse (iii) adapter besoedeling (≥15-bp oorvleueling wat tot 3-bp wanpassing toelaat) of (iv) duplikaat leespare. Na so 'n filter is 'n gemiddeld van 91,1% van lesings behou.

SNP en Short Indel Calling.

Die verwysingsgenoomvolgorde was NCBI Reference Sequence NC_000913.2. Vir elke monster is Illumina-lesings in lyn gebring met die E coli K12 (stam MG1655) genoom met die kortlees-belyningsinstrument, BWA (ver. 0.5.9) (77). Kort indels (≤4 bp) is opgeroep gebaseer op die leeskartering van die SNP-oproepprosedures. Verdere besonderhede word gegee in SI Materiale en Metodes.

Mutasiebevestiging deur konvensionele volgordebepaling.

Ons het ewekansig 19 BPS'e uit die wilde-tipe 3K MA-lyne (~20% van die totaal) gekies vir bevestiging. Omdat indels oor die algemeen meer uitdagend is om akkuraat te roep as SNP's (78), het ons al 10 van die klein indels nagegaan wat vanaf die wilde-tipe 3K MA-lyn genoem word. Daar was geen vals oproepe in die BPS-datastel nie. Een indel wat as −G genoem is, was eintlik 'n skrapping van 24 nt in 'n herhalingselement alle ander indel-oproepe was korrek. Verdere besonderhede word gegee in SI Materiale en Metodes.

Mutasie Annotasie.

Verskeie pasgemaakte skrifte is geskryf om kandidaatvariante te annoteer. Die koördinate van proteïenkoderende gene is verkry vanaf die GenBank-bladsy van NCBI verwysingsvolgorde NC_000913.2. BPS'e is op grond van die genetiese kode bepaal om sinoniem, nie-sinoniem of nie-koderend te wees. Nie-sinonieme BPS'e is aangewys as konserwatief of nie-konserwatief gebaseer op die BLOSUM62 matriks (79) 'n waarde ≥0 is as konserwatief beskou.

Gedeelde mutasie-analise.

Die wilde-tipe en MutL − stamme het ~80 en

75 generasies van groei, onderskeidelik, aangesien hul fenotipes nagegaan is en soos hulle gevries en hergroei is voor die eerste bottelnek vir die MA-protokol. MA-lyne kan dus mutasies deel wat gedurende hierdie tydperk plaasgevind het. Volgordebelyning en afstammingsanalise is gebruik om mutasies wat onafhanklik ontstaan ​​het te onderskei van dié wat 'n gemeenskaplike voorouer gedeel het. Verdere besonderhede word gegee in SI Materiale en Metodes.

Monte Carlo Simulasies.

'n Pasgemaakte skrif is geskryf om 'n ewekansige verspreiding van BPS'e te simuleer wat ooreenstem met die waargenome mutasiespektra. Vir eenvoud is die aantal mutasies vasgestel op die waargenome getalle 1 000 proewe is gesimuleer.



Kommentaar:

  1. Domhnall

    strange for some communication products ..

  2. Macelroy

    Stem absoluut met jou saam. This seems like a good idea to me. Ek stem saam met jou.

  3. Arajas

    the Competent point of view, cognitively.

  4. Jarett

    Hierdie sin is eenvoudig verbasend)

  5. Phil

    Tussen ons wat praat, sou ek probeer om hierdie probleem self op te los.



Skryf 'n boodskap