Inligting

Rosetvorming: in watter volgorde word blare geskep

Rosetvorming: in watter volgorde word blare geskep


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Uit die onderstaande prent blyk dit dat nuwe blare so iets gevorm word (as u die plant as 'n gewone 12 -uursklok voorstel):

nuwe blaar om 12 uur, dan om 7 uur, dan om 2 uur, dan om 9 uur, ensovoorts.

Ek verbeel my dit kan 'n paar eenvoudige dinge wees as 'voeg altyd 190 grade by'. Word die presiese reëls hiervoor êrens vir verskillende plante gedokumenteer?


Spirale phyllotaxis en die goue hoek

Die ligging van die blare in jou prentjie is nie so eenvoudig soos dit lyk nie. Dit is 'n spiraal fillotaksie, wat baie ingewikkeld kan wees.

Die plant in jou beeld is 'n huisnek, 'n plant uit die genus Sempervivum. In hierdie plante, volgens Jeremy Burgess (Inleiding tot plantselontwikkeling):

... blaar primordia word van mekaar geskei in 'n hoekboog wat 137 ° nader.

Terloops, 137 ° is (amper) die goue hoek (φ).

Hier is 'n beeld wat die fillotaksie van Sempervivum (van Burgess, 1989):

Selfs meer interessant is die patroon wat gemaak word deur die 137.5° GA-spiraal van Aloe polyphylla:

Soms kan dit onsigbare spiraalpatrone veroorsaak, 'n verskynsel genaamd parastisie:

Bron: Burgess, J. (1989). 'N Inleiding tot die ontwikkeling van plantselle. 1ste uitgawe Cambridge [ens.]: Cambridge University Press.

PS: Ek weet dit is so buite die onderwerp, maar ek wil graag hierdie video van Cristóbal Vila deel, wat handel oor Fibonnaci-volgorde, goue verhouding en goue hoek in die natuur. Kyk na die blombedeling om 1:44: https://www.youtube.com/watch?v=kkGeOWYOFoA


'n groep blare wat naby mekaar geleë is op 'n kort vertikale loot wat net effens bogronds uitstyg. Die individuele blare in 'n roset straal in alle rigtings uit. Die boonste blare is gewoonlik kleiner as die onderste en het korter stingels, wat ietwat help om die onderste blare te skadu. Plante wat rosette vorm, groei hoofsaaklik op warm, droë plekke en in poolstreke (gewoonlik op rotse). Een van die faktore wat die ontwikkeling van rosette beïnvloed, is verdamping. Byvoorbeeld, wanneer dit verbou word onder toestande van verhoogde lugvog, ontwikkel sommige plante wat gewoonlik rosette produseer, eerder lote met lang internodes en spiraalvormige blare. Baie plante van verskeie families, insluitend Crassulaceae, Cruciferae, Com-positae en Plantaginaceae, het rosette.

'n algemene siekte van vrugtegewasse (appels, pere, kersies, kweper, pruime) en sommige bome en struike (esdoorn, meidoorn). Roset manifesteer deur die voorkoms van klein smal blare, wat tien tot 30 keer kleiner is as normale blare, en deur die ontwikkeling van rosette van tien tot 20 normale blare aan die bokant van die loot. Die siekte kom in baie lande voor, insluitend die USSR (hoofsaaklik in die Wolga -streek).

Sommige plantkundiges meen dat rosette deur virusse veroorsaak word, ander beskou dit as 'n funksionele patologiese proses wat veroorsaak word deur 'n steuring in die mineraalvoorraad, hoofsaaklik 'n tekort aan sink. Appelbome in boorde word die ergste beskadig. Rosette kan individuele takke, 'n deel van die kroon of die hele kroon beïnvloed. Simptome word duidelik na blom, dit wil sê tydens lootgroei. Rosette verlaag die prikkelbaarheid van die knoppe en die vermoë van die lote om te regenereer, waardeur groei belemmer word en naak, skraal swepe in die kroon verskyn. Erg beskadigde plante dra nie vrugte nie. Rosette wat 'n lang tydperk duur, lei tot uitdroging van die takke en die dood van die boom. Die appelvariëteite wat die meeste weerstand bied teen die siekte is Common Antonovka, Borovinka, Mal&rsquoty, en ander.

Maatreëls om rosette te bestry, sluit in behoorlike tydige afskakeling van siek plante in die kwekery, voorbereiding van inentingsmateriaal van hoë gehalte, bespuiting van die slapende knoppe van geaffekteerde bome met sinksulfaat vroeg in die lente of onmiddellik na blom, en mdashin-besproeide tuine en mplanting van lusern of ander peulgewasse tussen rye om die grond te versuur en die sinkassimilasie te verbeter.


Definieer die embrioniese stadium

Nadat 'n blastosist aan die einde van die eerste week na bevrugting in die baarmoeder ingeplant is, staan ​​sy interne selmassa, wat die embrioblas genoem is, nou as die embrio bekend. Die embrionale stadium duur tot die agtste week na bevrugting, waarna die embrio 'n fetus genoem word. Die embrionale stadium is kort, in totaal slegs ongeveer sewe weke, maar ontwikkelings wat gedurende hierdie stadium plaasvind, bring enorme veranderinge in die embrio teweeg. Tydens die embrionale stadium word die embrio nie net groter nie, maar ook baie meer kompleks. Figuur (PageIndex<2>) toon 'n agt tot nege weke oue embrio. Die vinger, tone, kop, oë en ander strukture van die embrio is sigbaar. Dit is nie oordrewe om te sê dat die embrionale stadium die nodige grondslag lê vir al die oorblywende lewensfases nie.

Figuur ( PageIndex <2> ): 'n Embryo van agt tot nege weke


Meersellige rosetvorming tydens selindringing in die voël primitiewe streep

Selbewegings is 'n fundamentele kenmerk tydens die ontwikkeling van multi-sellulêre organismes. By amniote gastrulasie dring selle deur die primitiewe streep, wat die anterior-posterior as van die embrio identifiseer. Ons het die sitoskeletale argitektuur tydens hierdie morfogenetiese prosesse ondersoek en die mikrobuis -organisasie in heel kuiken -embrio's gekenmerk. Dit het die verspreiding van selle met gepolariseerde en radiale mikrotubule (MT) skikkings oor verskillende streke van die embrio onthul. Selle in die epiblast vertoon gewoonlik radiale MT-skikkings, terwyl die meerderheid selle in die primitiewe streep gepolariseerde MT-skikkings gehad het. Binne die primitiewe streep het baie selle in groepe georganiseer en in rosetagtige strukture gerangskik met 'n duidelike middelpunt wat gekenmerk word deur 'n ophoping van aktien. Uitgebreide konfokale mikroskopie en driedimensionele beeldrekonstruksie het wenke van gepolariseerde selle geïdentifiseer wat uit die rosettevlak uitsteek, gewoonlik uit die middel. Ons stel voor dat die organisasie in strukture in 'n hoër orde die selindringing tydens gastrulasie vergemaklik. Ontwikkelingsdinamika 237: 91–96, 2008. © 2007 Wiley-Liss, Inc.

Die aanvullende materiaal waarna in hierdie artikel verwys word, kan besigtig word by www.interscience.wiley.com/jpages/1058-8388/suppmat

Lêernaam Beskrywing
dvdy21390-DVDY21390 Aanvullende_film1.mov4.8 MB Aanvullende fliek 1: 'n 3D-rekonstruksie in Volocity is as Quicktime-fliek uitgevoer. Figuur 2C-F toon stilbeelde van hierdie volgorde. Sien legende vir besonderhede.

Neem asseblief kennis: Die uitgewer is nie verantwoordelik vir die inhoud of funksionaliteit van enige ondersteunende inligting wat deur die skrywers verskaf word nie. Enige navrae (behalwe ontbrekende inhoud) moet aan die ooreenstemmende outeur vir die artikel gerig word.


Rosette vir verlenging

Rosette (bo) vorm deur vertikale sametrekking en ontspan dan horisontaal (onder, links na regs).

Die rosette is opvallend, maar dit het lank geneem voordat hulle geïdentifiseer is. "Ek het ook baie tyd spandeer om hulle nie te sien nie," sê Zallen. 'Dit was die maak van films wat die verskil gemaak het - dan sien u dat dit rigtinggewend is. As ek nou koerante lees, sien ek dit altyd. ”

In 'n vorige verlengingsmodel, genaamd buurruil, word voorgestel dat enkelsellige aansluitings wat vertikaal loop, tot 'n punt saamtrek en dan weer horisontaal uitbrei. 'Hierdie gedrag vind plaas, maar ons dink dit is slegs 'n deel van die verhaal,' sê Zallen. 'Die beginorde wat hulle benodig, is nie daar nie.'

Maar hoe om 'orde' te definieer? Aanvanklik, sê Zallen, 'het ek nie 'n woordeskat gehad om dit te beskryf nie.' Maar saam met haar fisikus-pa het sy kwantifiseringsmetodes gebruik wat bekend is aan diegene wat seepborrels bestudeer. Paradoksaal genoeg het hulle gevind dat die wanorde op sellulêre vlak toeneem, selfs al kom die weefsel nader aan sy langwerpige, meer wêreldwyd geordende toestand.

Die verhoogde afwyking blyk te wees as gevolg van rosetvorming. Patroneerde gene dryf aktien en dan die ophoping van myosien by die anterioposterior selgrense, en aktomyosien wat parallel met die membraan trek, help waarskynlik om die rosette te vorm.

Wanneer dit vir 25 minute van sogenaamde kiembandverlenging nagespoor word, word 87% van selle kortstondig in een of meer rosette ingewerk. Hierdie hoeveelheid herrangskikking, tesame met buur-uitruiling, kan verantwoordelik wees vir die grootste deel van die verlenging wat gesien word. Die meganisme vir die oplos van rosette is onduidelik. Leidrade moet kom uit die isolering van komponente wat stroomaf van patrone is.


Materiaal en metodes

Onderhoud en voorraad van vis

Sebravisse is by standaardtoestande onderhou (Westerfield, 1994). Embrio's is deur hpf opgevoer by 28.5°C (Kimmel et al., 1995) en volgens somiete getal. Die morfologiese en immunohistologiese analise van lgl2 morphants is uitgevoer in die AB agtergrond.

DNA-konstruksies en plekgerigte mutagenese

Die koderingstreek van sebravisse lgl2 is PCR versterk en gekloon in die ClaEk en XhoI beperkingsplekke van die uitdrukkingsvektor pCS2+. Net so, die vollengte kodering gebied van lgl1 is PCR geamplifiseer vanaf cDNA en gesubkloneer in pCS2+. Die N-terminale myc-tag is gegenereer deur die konstrukte in pCS2+myc te subkloneer. Verdere besonderhede is op aanvraag beskikbaar. IMAGp998C239110Q3 met volledige lengte lgl2 is by RZPD gekoop. Terreingerigte mutagenese is uitgevoer met behulp van die Quick Change Site Directed Mutagenesis Kit (Stratagene, CA, VSA). Die pCS2+14xUAS E1b lgl2:eGFP (Koester en Fraser, 2001) is gekloon deur die bekendstelling van die ClaEk (stomp einde)/XhoEk fragment van lgl2 in pCS2+ 14xUAS uitdrukkingsvektor. Die volgende mutagenese primer rye is gebruik vir lgl2 S5A : 5′-CACGAGTCAAGGCCATCAAAAAGGCTCTGCGACAGGCCTTCCGCAG-3′ en 5′-GATTCGCCGC GCTCGAGTCGCCATGCGCAAAC-3 '. Vetgedrukte nukleotiede dui veranderinge vanaf die wildtipe volgorde aan.

RNA en morpholino inspuitings

DNA konstrukte is getranskribeer met behulp van die SP6 MessageMachine kit (Ambion). In vitro gesintetiseerde mRNA met 'n afdekking is in water opgelos en voor inspuiting met die MO gemeng. Tipies is 100 pg RNA in AB-embrio's ingespuit vir redding en ooruitdrukking. MO's (Gene Tools) is ingespuit by konsentrasies van 70 en 100 μmol/l.

MO-reekse was: MO lgl2-uitra , 5'-TCCCTGGACGAGCCGGGACACAAAC-3 'MO lgl2-utrb , 5'-AGCCGGGACACAAACTGCCCTCTCT-3 'MO lgl2-atg , 5′-GCCCATGACGCCTGAACCTCTTCAT-3′ MO lgl1-atg , 5′-CCGTCTGAACCTAAACTTCATCATC-3′MO lgl1-utr , 5'-TGAAGCCGAATCAGAGGTAAATCAC-3 'MO prkci : 5′-TGTCCCGCAGCGTGGGCATTATGGA-3′ MO prkcz , 5′-GATCCGTTACTGACAGGCATTATA-3′ en MO p53 , 5'-GCGCCATTGCTTTGCAAGAATTG-3 '.

In situ hibridisasie

Hele berging in situ-hibridisering is uitgevoer soos voorheen beskryf (Jowett en Lettice, 1994). Digopigenien-UTP-gemerkte riboprobes is volgens die vervaardiger se instruksies gesintetiseer (Boehringer Mannheim). Die sonde vir lgl2 is versterk van cDNA en subkloneer in TOPO -vektor. Die primers wat gebruik is, was: 5'-CGGCTCGAGCTTGCTCACCTTCAC-3' en 5'-CCCATAACTGGCCCTCGGCATCCC-3'.

Die sonde vir oog1 was 'n geskenk van C. Petit. Die sonde vir ontmoet is vanaf cDNA versterk en in die TOPO -vektor gesubkloneer. Die volgende primers is gebruik: 5'-CACTATTCTGAAGCTGCTTCCATCC-3' en 5'-CGTGATGGAGATAAGGCAAACGGC-3'

Vir dokumentasie is embrio's ontwater, in bensiel: benzoaat skoongemaak en in Permount (Fisher Scientific) gemonteer. Beelde is vasgevang met behulp van 'n Zeiss Axioplan 2-mikroskoop met behulp van 10× en 20× lense, en Metamorph beelding sagteware weergawe 6.1 (Visitron). Beelde is verwerk met Adobe Photoshop -sagteware (Adobe Systems).

Kwantifisering van ZO1-positiewe areas is uitgevoer op streke van belang (ROI's) van konfokale beeld Z-stapelprojeksies met die ImageJ (http://rsb.info.nih.gov/ij/index.html) deeltjie -analise -funksie (parameters op aanvraag beskikbaar). Statistiese analise is uitgevoer met behulp van eenrigting ANOVA. A P waarde van minder as 0,05 is beskou as betekenisvol. Neuromast -verspreidingsanalise is uitgevoer op 48 hpf -embrio's. Statistiese analise is uitgevoer met behulp van tweerigting ANOVA of die F-toets soos toepaslik. A P-waarde van minder as 0.05 is beskou om betekenisvolheid aan te dui.

Alle statistiese ontledings is uitgevoer met behulp van GraphPad Prism 4 statistiese sagteware (GraphPad Software, La Jolla, CA, VSA).

Immunhistochemie, western blotting en falloidinekleuring

Immunohistochemie en faloidienkleuring is uitgevoer soos voorheen beskryf (Horne-Badovinac et al., 2001). Die Delta D en β-catenin immunohistochemiese kleuring is uitgevoer deur embrio's in 10% TCA te fixeer, gevolg deur verskeie spoelings en permeabilisering met 0.2% Triton X-100 vir 30 minute gevolg deur blokkering vir 2 uur. Voor montering is gekleurde weefsel oorgedra deur 'n reeks gegradeerde gliserol van 25%, 50%en 75%. Vir western blotting het ons in wese dieselfde protokol gebruik as wat voorheen beskryf is (Horne-Badovinac et al., 2001) met behulp van embrionale weefsels tot 24-30 hpf.

Die volgende teenliggaampies is gebruik: konyn anti-aPKCζ (1:200, Santa Cruz Biotechnology, VSA) muis anti-ZO1 (1:200, Zymed) muis anti-mens E-cadherin (1:200, BD Biosciences Pharmingen, Materiaalnommer 610182) muis anti-γ-tubulien (1:200, Biozol) muis anti-Delta D (1:400) (Itoh et al., 2003) konyn anti-β-catenin (1:600, 'n geskenk van die Birchmeier laboratorium ) konyn anti-Xenopus Lgl1 C-terminus ('n geskenk van die Sokol-laboratorium) (Dollar et al., 2005) en bok-teen-muis RRX (1: 200), anti-konyn Cy5 (1: 200), anti-muis Cy5 (1: 200) en anti-konyn Cy2 (1:200) (Jackson ImmunoResearch). Kernkleuring is uitgevoer met behulp van 4'6-diamidino-2-fenielindool, dihidrochloried (1: 1000, FluoroPure graad). Konfokale beelde is verkry met die Zeiss LSM510 META konfokale mikroskoop met behulp van 'n Plan Neofluar 100× oliedompellens en zoom 1.0. Konfokale beelde en driedimensionele rekonstruksies van Z-stapels is uitgevoer met behulp van die LSM 510 Meta sagteware. Beelde is verwerk met behulp van Photoshop -sagteware (Adobe).

Tydsverloopbeelding

Voordat lewende beeldvorming plaasgevind het, is embrio's vir 1 uur by Danieau se 100 µM van die vitale kleurstof BODIPY ceramide (Molecular Probes) geïnkubeer. Embrio's is in 1,8% lae -smeltende agarose gemonteer en met Tricain (Sigma) verdoof en met die Zeiss LSM510 META konfokale mikroskoop afgebeeld met behulp van 'n Plan Neofluar 40 × olie -onderdompelingslens en zoom 1.0.


Tipes blaarvorms

Blare kan as eenvoudig of saamgestel ingedeel word, afhangende van hoe hul lem (of lamina) verdeel is.

Leerdoelwitte

Onderskei tussen die soorte blaarvorme

Belangrike wegneemetes

Kern punte

  • In 'n eenvoudige blaar, die lem is heeltemal onverdeelde blare kan ook gevorm word van lobbe waar die gapings tussen lobbe nie tot by die hoof aar.
  • In 'n saamgestelde blaar word die blaarblad verdeel en pamflette vorm wat aan die middelste aar geheg is, maar hul eie stingels het.
  • Die pamflette van palmagtig saamgestelde blare straal uitwaarts vanaf die einde van die blaarsteel.
  • Blare wat saamgevoeg is, het hul pamflette langs die middelste aar gerangskik.
  • Tweeling-saamgestelde (dubbel-samegestelde) blare se pamflette is gerangskik langs 'n sekondêre aar, wat een van verskeie are is wat van die middelste aar aftak.

Sleutel terme

  • eenvoudige blaar: 'n blaar met 'n onverdeelde lem
  • saamgestelde blaar: 'n blaar waar die lem verdeel is en pamflette vorm
  • palmblad saamgestelde blaar: blaar waarvan die blaartjies uitstraal vanaf die punt van die blaarsteel
  • pinnately saamgestelde blaar: 'n blaar waar die pamflette langs die middelaar gerangskik is

Blaarvorm

Daar is twee basiese vorme van blare wat beskryf kan word met inagneming van die manier waarop die lem (of lamina) verdeel is. Blare kan eenvoudig of saamgestel wees.

Eenvoudige en saamgestelde blare: Blare kan eenvoudig of saamgestel wees. In eenvoudige blare is die laminaat deurlopend. (a) Die piesangplant (Musa sp.) het eenvoudige blare. In saamgestelde blare word die lamina in pamflette geskei. Saamgestelde blare kan palmvormig of geveerd wees. (b) In palmagtige saamgestelde blare, soos dié van die perdekastanje (Aesculus hippocastanum), die pamflette vertak uit die blaarsteel. (c) In veervormig saamgestelde blare vertak die pamflette vanaf die middelnerf, soos op 'n skrop hickory (Carya floridana). (d) Die heuningsprinkaan het dubbelsamegestelde blare, waarin blaartjies van die are vertak.

In 'n eenvoudige blaar, soos die piesangblaar, is die lem heeltemal onverdeeld. Die blaarvorm kan ook gevorm word uit lobbe waar die gapings tussen lobbe nie tot by die hoofaar kom nie. 'N Voorbeeld van hierdie tipe is die esdoornblaar.

In 'n saamgestelde blaar is die blaarblad heeltemal verdeel, wat pamflette vorm, soos in die sprinkaanboom. Saamgestelde blare is 'n kenmerk van sommige families van hoër plante. Elke pamflet is aan die rachis (middelaar), maar kan sy eie steel hê. 'n Handpalmagtige saamgestelde blaar se blaartjies wat uitwaarts uitstraal vanaf die punt van die blaarsteel, soos vingers van die palm van 'n hand. Voorbeelde van plante met palmagtige saamgestelde blare sluit in gif klimop, die buckeye-boom of die bekende huisplant Schefflera sp. (algemeen genoem “sambreelplant”). Veervormig saamgestelde blare kry hul naam van hul veeragtige voorkoms, die pamflette is langs die middelaar gerangskik, soos in roosblare of die blare van hickory-, pekanneut-, as- of okkerneutbome. In 'n pienk saamgestelde blaar word die middelste aar die middelrib genoem. Tweevoudig saamgestelde (of dubbelsamegestelde) blare word twee keer verdeel, die pamflette word langs 'n sekondêre aar gerangskik, wat een van verskeie are is wat van die middelaar aftak. Elke pamflet word 'n “pinnule” genoem. Die pinnules op een sekondêre aar word “pinna” genoem. Die syboom (Albizia) is 'n voorbeeld van 'n plant met tweevoudige blare.


MATERIAAL EN METODES

Plantgroei, transgene plante en fenotipes

T-DNA invoeglyne vir LMI1 is verkry uit die SALK-versameling (Alonso et al.,2003) en twee keer teruggekruis na die wilde tipe (Kol). LFY-allele is verkry vanaf die Arabidopsis Biologiese Hulpbronsentrum (ABRC) saadversameling (http://www.biosci.ohio-state.edu/

plantbio/Facilities/abrc/abrchome.htm). Plante is by 22 ° C verbou in lang- (16 uur lig) of kort dag (9 uur lig) toestande teen 120 μmol/m 2 s koel wit lig. Rozetblaargetalle is getel by die bout, en sekondêre bloeiwyses en skutblare is getel na die vorming van die eerste blomme. Sessiele blare sonder blare wat sekondêre bloeiwyses vertoon, of blomme op die primêre bloeiwyse word in hierdie teks as skutblare genoem, in ooreenstemming met die gebruik wat deur Dinneny et al voorgestel word (Dinneny et al., 2004). Laterale aanhangsels word as sekondêre bloeiwyses beskou as die tak minstens 3 cm lank was en minstens drie blomme gedra het.

35S:MYC-LMI1-HA is gegenereer in 35S:LFY-GR plante (Wagner et al., 1999), met behulp van die plant transformasie vektor pGAL3300. 'n 9×MYC-epitoopmerker (Feldman et al., 1997) is in raam by die N-terminale punt bygevoeg en 'n 3×HA-epitoopmerker by die C-terminale punt. Die vollengte LMI1 cDNA is versterk deur PCR van saailing -RNA na omgekeerde transkripsie, gevolg deur volgordebepaling. Die primers wat vir amplifikasie gebruik is, was GAGTGGTCAACAACGAGCAA en GGAAATCGGTACGCATTCAT. Verskeie onafhanklike transgene lyne is geïsoleer wat LMI1-proteïen oor die volle lengte uitgedruk het en toegeneem het LMI1 uitdrukking in vergelyking met die wilde tipe. Reël 23 is gebruik vir chromatien -immunopresipitasies; soortgelyke resultate as dié wat hier aangebied word, is met ander lyne verkry.

Vir verslaggewerontledings het ons pBI101 (Clontech, Mountain View, CA) plus 3955 bp stroomop van die LMI1-vertalingsbegin gebruik. Boonop is 1016 bp van die stroomaf intergeniese gebied gebruik om die NOS -terminatorreeks in pBI101 te vervang. Planttransformasie is uitgevoer soos voorheen beskryf (Bechthold en Ellis, 1993). Plante is gefotografeer met behulp van 'n Olympus SZX12 dissekteermikroskoop toegerus met 'n SPOT Insight kamera (Diagnostic, Sterling Heights, MI).

RT-PCR en real-time PCR

Totale RNA is geïsoleer uit bogrondse plantweefsels wat in volgehoue ​​lig gegroei word by 55 μmol/m 2 s op halfsterkte Murashige en Skoog-medium. RNA-isolasie en RT-PCR is uitgevoer soos beskryf (William et al., 2004). Kwantitatiewe intydse PCR is uitgevoer op RNA behandel met DNase Set (Qiagen, Valencia, CA) in 'n 20-μl PCR-reaksie met behulp van die QuantiTect SYBR Green PCR Kit (Qiagen, Valencia, CA) op 'n DNA Engine Opticon Thermic cycler (MJ Navorsing). Die termiese fietstoestande was soos volg: 15 minute by 95 ° C, 44 siklusse van 15 sekondes by 94 ° C, 30 sekondes by 54 ° C en 30 sekondes by 72 ° C, gevolg deur 'n smeltkurwe -analise. Relatiewe hoeveelhede van alle mRNA is uit drempelsikluswaardes en standaardkurwes bereken, en genormaliseer met die vlak van eukariotiese translasie-inisiasiefaktor 4A-1(EIF4A) vir mRNA en invoer vir ChIP. Vir inligting oor primers (en versterkingsiklusgetalle), sien tabel S1 in die aanvullende materiaal.

Chromatien immunopresipitasie

Chromatien-immunopresipitasie is hoofsaaklik uitgevoer soos voorheen beskryf (Kwon et al., 2005 William et al., 2004), behalwe dat 100 mg weefsel per monster gebruik is. Die MYC antiserum wat gebruik is, kom uit die Myc1-9E10-sellyn. Na binding van die immunokomplekse aan proteïen G magnetiese krale (Dynal, Brown Deer, WI), is wasgoed uitgevoer volgens Ricci et al. (Ricci et al., 2002). Sien Tabel S1 in die aanvullende materiaal vir meer inligting oor die primers wat vir ChIP gebruik word.

GUS -toetse en snitte

GUS-kleuring en histologiese snitte is uitgevoer soos voorheen beskryf (Sieburth en Meyerowitz, 1997), behalwe dat die weefsel vir 1 uur by kamertemperatuur met FAA gefixeer is. Die kleuring was vier uur by 37 ° C of 20 uur by 30 ° C. Skoonmaak van weefsels is uitgevoer soos beskryf deur Kwon et al. (Kwon et al., 2005).


Inhoud

Arabidopsis thaliana is 'n eenjarige (selde tweejaarlikse) plant wat gewoonlik 20-25 cm lank word. [6] Die blare vorm 'n roset aan die basis van die plant, met 'n paar blare ook op die blomstam. Die basale blare is groen tot effens perserig van kleur, 1,5–5 cm lank en 2–10 mm breed, met 'n hele tot grof getande rand, die stamblare is kleiner en ongestinkt, gewoonlik met 'n hele rand. Blare is bedek met klein, eensellige hare wat trichome genoem word. Die blomme het 'n deursnee van 3 mm, gerangskik in 'n lintvormige struktuur, die struktuur van die tipiese Brassicaceae. Die vrugte is 'n siliqua van 5–20 mm lank, wat 20-30 sade bevat. [9] [10] [11] [12] Wortels is eenvoudig in struktuur, met 'n enkele primêre wortel wat vertikaal afwaarts groei, wat later kleiner laterale wortels produseer. Hierdie wortels vorm interaksies met risosfeer bakterieë soos Bacillus megaterium. [13]

A. thaliana kan sy hele lewensiklus binne ses weke voltooi. Die sentrale stam wat blomme produseer, groei na ongeveer 3 weke, en die blomme bestuif natuurlik. In die laboratorium, A. thaliana kan in Petri-borde, potte of hidroponika, onder fluoresserende ligte of in 'n kweekhuis gekweek word. [14]

Die plant is die eerste keer in 1577 in die Harzberge beskryf deur Johannes Thal [de] (1542–1583), 'n dokter van Nordhausen, Thüringen, Duitsland, wat dit genoem het Pilosella siliquosa. In 1753 het Carl Linnaeus die plant herdoop Arabis thaliana ter ere van Thal. In 1842 het die Duitse plantkundige Gustav Heynhold die nuwe genus opgerig Arabidopsis en het die plant in daardie genus geplaas. Die generiese naam, Arabidopsis, kom van Grieks, wat beteken "oorgelyks Arabies"(die genus waarin Linnaeus dit aanvanklik geplaas het).

Duisende natuurlike ingeteelde toetredings van A. thaliana is versamel uit sy natuurlike en bekendgestelde reeks. [15] Hierdie toetredings toon aansienlike genetiese en fenotipiese variasie, wat gebruik kan word om die aanpassing van hierdie spesie by verskillende omgewings te bestudeer. [15]

A. thaliana is inheems aan Europa, Asië en Afrika, en sy geografiese verspreiding is taamlik deurlopend van die Middellandse See tot Skandinawië en Spanje tot Griekeland. [16] Dit blyk ook inheems te wees in tropiese alpiene ekosisteme in Afrika en miskien in Suid -Afrika. [17] [18] Dit is wêreldwyd bekendgestel en genaturaliseer, [19] insluitend in Noord -Amerika rondom die 17de eeu. [20]

A. thaliana groei maklik en baanbrekers is dikwels rotsagtige, sanderige en kalkryke gronde. Dit word algemeen beskou as 'n onkruid, vanweë die wydverspreide verspreiding daarvan in landbouvelde, paaie, spoorlyne, afvalgrond en ander versteurde habitatte, [19] [21], maar as gevolg van die beperkte mededingingsvermoë en die klein grootte, word dit nie gekategoriseer nie as 'n skadelike onkruid. [22] Soos die meeste Brassicaceae -spesies, A. thaliana is eetbaar deur mense in 'n slaai of gaar, maar dit geniet nie wydverspreide gebruik as 'n lentegroente nie. [23]

Plantkundiges en bioloë het begin navorsing doen A. thaliana in die vroeë 1900's, en die eerste sistematiese beskrywing van mutante is rondom 1945 gedoen. [24] A. thaliana word nou wyd gebruik vir die bestudering van plantwetenskappe, insluitend genetika, evolusie, bevolkingsgenetika en plantontwikkeling. [25] [26] [27] Alhoewel A. thaliana Dit het min direkte betekenis vir die landbou, en verskeie eienskappe daarvan maak dit 'n nuttige model om die genetiese, sellulêre en molekulêre biologie van blomplante te verstaan.

Die eerste mutant in A. thaliana is in 1873 deur Alexander Braun gedokumenteer, wat 'n dubbele blomfenotipe beskryf (die gemuteerde geen was waarskynlik Agame, gekloon en gekenmerk in 1990). [28] Friedrich Laibach (wat die chromosoomgetal in 1907 gepubliseer het) het nie voorgestel nie A. thaliana as 'n modelorganisme tot 1943. [29] Sy student, Erna Reinholz, publiseer haar proefskrif oor A. thaliana in 1945, wat die eerste versameling van A. thaliana mutante wat hulle gegenereer het met behulp van X-straal mutagenese. Laibach het sy belangrike bydraes tot A. thaliana navorsing deur 'n groot aantal toetredings te versamel (wat dikwels twyfelagtig as "ekotipes" genoem word). Met die hulp van Albert Kranz is dit georganiseer in 'n groot versameling van 750 natuurlike toetredings van A. thaliana van regoor die wêreld.

In die 1950's en 1960's het John Langridge en George Rédei 'n belangrike rol gespeel in die vestiging daarvan A. thaliana as 'n bruikbare organisme vir biologiese laboratoriumeksperimente. Rédei het verskeie wetenskaplike resensies geskryf wat die model aan die wetenskaplike gemeenskap bekend gestel het. Die begin van die A. thaliana navorsing gemeenskap datums na 'n nuusbrief genoem Arabidopsis Inligtingsdiens, [30] gestig in 1964. Die eerste Internasionale Arabidopsis Die konferensie is in 1965 in Göttingen, Duitsland, gehou.

In die 1980's, A. thaliana wyd gebruik word in plantnavorsingslaboratoriums regoor die wêreld. Dit was een van verskeie kandidate wat mielies, petunia en tabak insluit. [29] Laasgenoemde twee was aantreklik, aangesien hulle maklik transformeerbaar was met die destyds huidige tegnologieë, terwyl mielies 'n goed gevestigde genetiese model vir plantbiologie was. Die deurbraakjaar vir A. thaliana as 'n model plant was 1986, waarin T-DNA-gemedieerde transformasie en die eerste gekloon A. thaliana geen beskryf is. [31] [32]

Genomika Redigeer

Kerngenoom Edit

Vanweë die klein grootte van sy genoom en omdat dit diploïed is, Arabidopsis thaliana is nuttig vir genetiese kartering en opeenvolging - met ongeveer 157 megabase pare [35] en vyf chromosome, A. thaliana het een van die kleinste genome onder plante. [8] Daar word lank gedink dat dit die kleinste genoom van alle blomplante het, [36], maar dit word nou beskou as die titel van plante in die genus Genlisea, bestel Lamiales, met Genlisea tuberosa, 'n vleisetende plant, wat 'n genoomgrootte van ongeveer 61 Mbp toon. [37] Dit was die eerste plantgenoom wat in volgorde geneem is, voltooi in 2000 deur die Arabidopsis Genome Initiative. [38] Die nuutste weergawe van die A. thaliana genoom word onderhou deur die Arabidopsis -inligtingsbron. [39]

27 600 proteïenkoderende gene en ongeveer 6 500 nie-koderende gene. [40] Die Uniprot-databasis lys egter 39 342 proteïene in hul Arabidopsis verwysingsproteoom. [41] Onder die 27,600 proteïenkoderende gene word 25,402 (91,8%) nou geannoteer met 'betekenisvolle' produkname, [42] hoewel 'n groot deel van hierdie proteïene waarskynlik slegs swak verstaan ​​en slegs in algemene terme bekend is (bv. DNS-bindende proteïen sonder bekende spesifisiteit). Uniprot lys meer as 3 000 proteïene as "ongekarakteriseer" as deel van die verwysingsproteoom.

Chloroplast genoom Edit

Die plastome van A. thaliana is 'n 154,478 basis-paar-lange DNA-molekule, [33] 'n grootte wat tipies voorkom by die meeste blomplante (sien die lys met volgorde plastome). Dit bestaan ​​uit 136 gene wat kodeer vir klein subeenheid ribosomale proteïene (rps, in geel: sien figuur), groot subeenheid ribosomale proteïene (rpl, oranje), hipotetiese chloroplast oop leesraamproteïene (ycf, suurlemoen), proteïene betrokke by fotosintetiese reaksies (groen) of by ander funksies (rooi), ribosomale RNA's (rrn, blou), en dra RNA's (trn, swart). [34]

Mitochondriale genoom Redigeer

Die mitochondriale genoom van A. thaliana is 367 808 basispare lank en bevat 57 gene. [43] Daar is baie herhaalde streke in die Arabidopsis mitochondriale genoom. Die grootste herhalings kombineer gereeld en isomeriseer die genoom. [44] Soos die meeste plantmitochondriale genome, is die Arabidopsis mitochondriale genoom bestaan ​​as 'n komplekse rangskikking van oorvleuelende vertakte en lineêre molekules in vivo. [45]

Genetika wysig

Genetiese transformasie van A. thaliana is roetine, gebruik Agrobacterium tumefaciens om DNA na die plantgenoom oor te dra. Die huidige protokol, genaamd "blommedip", behels dat blomme eenvoudig in 'n oplossing gedoop word Agrobacterium met 'n plasmied van rente en 'n skoonmaakmiddel. [46] [47] Hierdie metode vermy die behoefte aan weefselkultuur of plantregenerasie.

Die A. thaliana gene-uitklopversamelings is 'n unieke bron vir plantbiologie wat moontlik gemaak word deur die beskikbaarheid van hoë deursetstransformasie en befondsing vir genomiese hulpbronne. Die plek van T-DNA-invoegings is bepaal vir meer as 300 000 onafhanklike transgeniese lyne, met die inligting en sade wat toeganklik is deur aanlyn T-DNA-databasisse. [48] ​​Deur hierdie versamelings is invoegmutante beskikbaar vir die meeste gene in A. thaliana.

Gekarakteriseerde toetredings en mutante lyne van A. thaliana dien as eksperimentele materiaal in laboratoriumstudies. Die agtergrondlyne wat die meeste gebruik word, is Ler (Landsberg erecta), en Kol, of Columbia. [49] Ander agtergrondlyne wat minder dikwels in die wetenskaplike literatuur aangehaal word, is Ws, of Wassilewskija, C24, Cvi, of Kaap Verdiese Eilande, Nossen, ens. 0, Col-1, ens., Verkry en gekenmerk in die algemeen, is mutante lyne beskikbaar deur voorraadsentrums, waarvan die bekendste die Nottingham Arabidopsis Stock Center-NASC [49] en die Arabidopsis Biological Resource Center-ABRC in Ohio, VSA. [51] Die Col-0-toetreding is deur Rédei gekies uit 'n (nie-bestraalde) bevolking van sade wat aangewys is as 'Landsberg' wat hy van Laibach ontvang het. [52] Columbia (vernoem na die ligging van Rédei se voormalige instelling, Universiteit van Missouri-Columbia) was die verwysingstoetreding wat in die Arabidopsis Genoom -inisiatief. Die Later (Landsberg erecta) lyn is deur Rédei (vanweë sy kort statuur) gekies uit 'n Landsberg-bevolking wat hy met X-strale gemutageniseer het. Soos die Ler versameling mutante is afgelei van hierdie aanvanklike reël, Ler-0 stem nie ooreen met die Landsberg-toetredings nie, wat La-0, La-1, ens.

Trichoomvorming word deur die GLABROUS1-proteïen geïnisieer. Uitklophoue van die ooreenstemmende geen lei tot kaalplante. Hierdie fenotipe is reeds gebruik in geen redigering eksperimente en kan van belang wees as visuele merker vir plantnavorsing om geen redigering metodes soos CRISPR/Cas9 te verbeter. [53] [54]

Nie-Mendeliese oorerwingskonflik Redigeer

In 2005 het wetenskaplikes aan die Purdue Universiteit dit voorgestel A. thaliana beskik oor 'n alternatief vir voorheen bekende meganismes van DNA-herstel, wat 'n ongewone patroon van oorerwing voortbring, maar die verskynsel waargeneem (terugkeer van mutante kopieë van die WARMKOP gene to a wild-type state) was later suggested to be an artifact because the mutants show increased outcrossing due to organ fusion. [55] [56] [57]

Lifecycle Edit

The plant's small size and rapid lifecycle are also advantageous for research. Having specialized as a spring ephemeral, it has been used to found several laboratory strains that take about 6 weeks from germination to mature seed. The small size of the plant is convenient for cultivation in a small space, and it produces many seeds. Further, the selfing nature of this plant assists genetic experiments. Also, as an individual plant can produce several thousand seeds, each of the above criteria leads to A. thaliana being valued as a genetic model organism.

Flower development Edit

A. thaliana has been extensively studied as a model for flower development. The developing flower has four basic organs - sepals, petals, stamens, and carpels (which go on to form pistils). These organs are arranged in a series of whorls, four sepals on the outer whorl, followed by four petals inside this, six stamens, and a central carpel region. Homeotic mutations in A. thaliana result in the change of one organ to another—in the case of the agamous mutation, for example, stamens become petals and carpels are replaced with a new flower, resulting in a recursively repeated sepal-petal-petal pattern.

Observations of homeotic mutations led to the formulation of the ABC model of flower development by E. Coen and E. Meyerowitz. [58] According to this model, floral organ identity genes are divided into three classes - class A genes (which affect sepals and petals), class B genes (which affect petals and stamens), and class C genes (which affect stamens and carpels). These genes code for transcription factors that combine to cause tissue specification in their respective regions during development. Although developed through study of A. thaliana flowers, this model is generally applicable to other flowering plants.

Leaf development Edit

Studies van A. thaliana have provided considerable insights with regards to the genetics of leaf morphogenesis, particularly in dicotyledon-type plants. [59] [60] Much of the understanding has come from analyzing mutants in leaf development, some of which were identified in the 1960s, but were not analysed with genetic and molecular techniques until the mid-1990s. A. thaliana leaves are well suited to studies of leaf development because they are relatively simple and stable.

Met behulp van A. thaliana, the genetics behind leaf shape development have become more clear and have been broken down into three stages: The initiation of the leaf primordium, the establishment of dorsiventrality, and the development of a marginal meristem. Leaf primordia are initiated by the suppression of the genes and proteins of class I KNOX family (such as SHOOT APICAL MERISTEMLESS). These class I KNOX proteins directly suppress gibberellin biosynthesis in the leaf primordium. Many genetic factors were found to be involved in the suppression of these class I KNOX genes in leaf primordia (such as ASYMMETRIC LEAVES1, BLADE-ON-PETIOLE1, SAWTOOTH1, ens.). Thus, with this suppression, the levels of gibberellin increase and leaf primordium initiate growth.

The establishment of leaf dorsiventrality is important since the dorsal (adaxial) surface of the leaf is different from the ventral (abaxial) surface. [61]

Microscopy Edit

A. thaliana is well suited for light microscopy analysis. Young seedlings on the whole, and their roots in particular, are relatively translucent. This, together with their small size, facilitates live cell imaging using both fluorescence and confocal laser scanning microscopy. [62] By wet-mounting seedlings in water or in culture media, plants may be imaged uninvasively, obviating the need for fixation and sectioning and allowing time-lapse measurements. [63] Fluorescent protein constructs can be introduced through transformation. The developmental stage of each cell can be inferred from its location in the plant or by using fluorescent protein markers, allowing detailed developmental analysis.

Light sensing, light emission, and circadian biology Edit

The photoreceptors phytochromes A, B, C, D, and E mediate red light-based phototropic response. Understanding the function of these receptors has helped plant biologists understand the signaling cascades that regulate photoperiodism, germination, de-etiolation, and shade avoidance in plants.

The UVR8 protein detects UV-B light and mediates the response to this DNA-damaging wavelength.

A. thaliana was used extensively in the study of the genetic basis of phototropism, chloroplast alignment, and stomal aperture and other blue light-influenced processes. [64] These traits respond to blue light, which is perceived by the phototropin light receptors. Arabidopsis has also been important in understanding the functions of another blue light receptor, cryptochrome, which is especially important for light entrainment to control the plants' circadian rhythms. [65] When the onset of darkness is unusually early, A. thaliana reduces its metabolism of starch by an amount that effectively requires division. [66]

Light responses were even found in roots, previously thought to be largely insensitive to light. While the gravitropic response of A. thaliana root organs is their predominant tropic response, specimens treated with mutagens and selected for the absence of gravitropic action showed negative phototropic response to blue or white light, and positive response to red light, indicating that the roots also show positive phototropism. [67]

In 2000, Dr. Janet Braam of Rice University genetically engineered A. thaliana to glow in the dark when touched. The effect was visible to ultrasensitive cameras. [68]

Multiple efforts, including the Glowing Plant Project, have sought to use A. thaliana to increase plant luminescence intensity towards commercially viable levels.

On the Moon Edit

On January 2, 2019, China's Chang'e-4 lander brought A. thaliana to the moon. [69] A small microcosm 'tin' in the lander contained A. thaliana, seeds of potatoes, and silkworm eggs. As plants would support the silkworms with oxygen, and the silkworms would in turn provide the plants with necessary carbon dioxide and nutrients through their waste, [70] researchers will evaluate whether plants successfully perform photosynthesis, and grow and bloom in the lunar environment. [69]

Understanding how plants achieve resistance is important to protect the world's food production, and the agriculture industry. Many model systems have been developed to better understand interactions between plants and bacterial, fungal, oomycete, viral, and nematode pathogens. A. thaliana has been a powerful tool for the study of the subdiscipline of plant pathology, that is, the interaction between plants and disease-causing pathogens.

Pathogen type Example in A. thaliana
Bakterieë Pseudomonas syringae, Xanthomonas campestris
Swamme Colletotrichum destructivum, Botrytis cinerea, Golovinomyces orontii
Oomycete Hyaloperonospora arabidopsidis
Viraal Cauliflower mosaic virus (CaMV), tomato mosaic virus (TMV)
Nematode Meloidogyne incognita, Heterodera schachtii

Die gebruik van A. thaliana has led to many breakthroughs in the advancement of knowledge of how plants manifest plant disease resistance. The reason most plants are resistant to most pathogens is through nonhost resistance - not all pathogens will infect all plants. An example where A. thaliana was used to determine the genes responsible for nonhost resistance is Blumeria graminis, the causal agent of powdery mildew of grasses. A. thaliana mutants were developed using the mutagen ethyl methanesulfonate and screened to identify mutants with increased infection by B. graminis. [72] [73] [74] The mutants with higher infection rates are referred to as PEN mutants due to the ability of B. graminis to penetrate A. thaliana to begin the disease process. Die PEN genes were later mapped to identify the genes responsible for nonhost resistance to B. graminis.

In general, when a plant is exposed to a pathogen, or nonpathogenic microbe, an initial response, known as PAMP-triggered immunity (PTI), occurs because the plant detects conserved motifs known as pathogen-associated molecular patterns (PAMPs). [75] These PAMPs are detected by specialized receptors in the host known as pattern recognition receptors (PRRs) on the plant cell surface.

The best-characterized PRR in A. thaliana is FLS2 (Flagellin-Sensing2), which recognizes bacterial flagellin, [76] [77] a specialized organelle used by microorganisms for the purpose of motility, as well as the ligand flg22, which comprises the 22 amino acids recognized by FLS2. Discovery of FLS2 was facilitated by the identification of an A. thaliana ecotype, Ws-0, that was unable to detect flg22, leading to the identification of the gene encoding FLS2. FLS2 shows striking similarity to rice XA21, the first PRR isolated in 1995

A second PRR, EF-Tu receptor (EFR), identified in A. thaliana, recognizes the bacterial EF-Tu protein, the prokaryotic elongation factor used in protein synthesis, as well as the laboratory-used ligand elf18. [78] Using Agrobacterium-mediated transformation, a technique that takes advantage of the natural process by which Agrobacterium transfers genes into host plants, the EFR gene was transformed into Nicotiana benthamiana, tobacco plant that does not recognize EF-Tu, thereby permitting recognition of bacterial EF-Tu [79] thereby confirming EFR as the receptor of EF-Tu.

Both FLS2 and EFR use similar signal transduction pathways to initiate PTI. A. thaliana has been instrumental in dissecting these pathways to better understand the regulation of immune responses, the most notable one being the mitogen-activated protein kinase (MAP kinase) cascade. Downstream responses of PTI include callose deposition, the oxidative burst, and transcription of defense-related genes. [80]

PTI is able to combat pathogens in a nonspecific manner. A stronger and more specific response in plants is that of effector-triggered immunity (ETI), which is dependent upon the recognition of pathogen effectors, proteins secreted by the pathogen that alter functions in the host, by plant resistance genes (R-genes), often described as a gene-for-gene relationship. This recognition may occur directly or indirectly via a guardee protein in a hypothesis known as the guard hypothesis. The first R-gene cloned in A. thaliana was RPS2 (resistance to Pseudomonas syringae 2), which is responsible for recognition of the effector avrRpt2. [81] The bacterial effector avrRpt2 is delivered into A. thaliana via the Type III secretion system of P. syringae pv tomato strain DC3000. Recognition of avrRpt2 by RPS2 occurs via the guardee protein RIN4, which is cleaved . Recognition of a pathogen effector leads to a dramatic immune response known as the hypersensitive response, in which the infected plant cells undergo cell death to prevent the spread of the pathogen. [82]

Systemic acquired resistance (SAR) is another example of resistance that is better understood in plants because of research done in A. thaliana. Benzothiadiazol (BTH), a salicylic acid (SA) analog, has been used historically as an antifungal compound in crop plants. BTH, as well as SA, has been shown to induce SAR in plants. The initiation of the SAR pathway was first demonstrated in A. thaliana in which increased SA levels are recognized by nonexpresser of PR genes 1 (NPR1) [83] due to redox change in the cytosol, resulting in the reduction of NPR1. NPR1, which usually exists in a multiplex (oligomeric) state, becomes monomeric (a single unit) upon reduction. [84] When NPR1 becomes monomeric, it translocates to the nucleus, where it interacts with many TGA transcription factors, and is able to induce pathogen-related genes such as PR1. [85] Another example of SAR would be the research done with transgenic tobacco plants, which express bacterial salicylate hydroxylase, nahG gene, requires the accumulation of SA for its expression [86]

Although not directly immunological, intracellular transport affects susceptibility by incorporating - or being tricked into incorporating - pathogen particles. Byvoorbeeld die Dynamin-related protein 2b/drp2b gene helps to move invaginated material into cells, with some mutants increasing PstDC3000 virulence even further. [87]

Evolutionary aspect of plant-pathogen resistance Edit

Plants are affected by multiple pathogens throughout their lifetimes. In response to the presence of pathogens, plants have evolved receptors on their cell surfaces to detect and respond to pathogens. [88] Arabidopsis thaliana is a model organism used to determine specific defense mechanisms of plant-pathogen resistance. [89] These plants have special receptors on their cell surfaces that allow for detection of pathogens and initiate mechanisms to inhibit pathogen growth. [89] They contain two receptors, FLS2 (bacterial flagellin receptor) and EF-Tu (bacterial EF-Tu protein), which use signal transduction pathways to initiate the disease response pathway. [89] The pathway leads to the recognition of the pathogen causing the infected cells to undergo cell death to stop the spread of the pathogen. [89] Plants with FLS2 and EF-Tu receptors have shown to have increased fitness in the population. [86] This has led to the belief that plant-pathogen resistance is an evolutionary mechanism that has built up over generations to respond to dynamic environments, such as increased predation and extreme temperatures. [86]

A. thaliana has also been used to study SAR. [90] This pathway uses benzothiadiazol, a chemical inducer, to induce transcription factors, mRNA, of SAR genes. This accumulation of transcription factors leads to inhibition of pathogen-related genes. [90]

Plant-pathogen interactions are important for an understanding of how plants have evolved to combat different types of pathogens that may affect them. [86] Variation in resistance of plants across populations is due to variation in environmental factors. Plants that have evolved resistance, whether it be the general variation or the SAR variation, have been able to live longer and hold off necrosis of their tissue (premature death of cells), which leads to better adaptation and fitness for populations that are in rapidly changing environments. [86] In the future, comparisons of the pathosystems of wild populations + their coevolved pathogens with wild-wild hybrids of known parentage may reveal new mechanisms of balancing selection. In life history theory we may find that A. thaliana maintains certain alleles due to pleitropy between plant-pathogen effects and other traits, as in livestock. [91]

Ongoing research on A. thaliana is being performed on the International Space Station by the European Space Agency. The goals are to study the growth and reproduction of plants from seed to seed in microgravity. [92] [93]

Plant-on-a-chip devices in which A. thaliana tissues can be cultured in semi-in vitro conditions have been described. [94] Use of these devices may aid understanding of pollen-tube guidance and the mechanism of sexual reproduction in A. thaliana.

Self-pollination Edit

A. thaliana is a predominantly self-pollinating plant with an outcrossing rate estimated at less than 0.3%. [95] An analysis of the genome-wide pattern of linkage disequilibrium suggested that self-pollination evolved roughly a million years ago or more. [96] Meioses that lead to self-pollination are unlikely to produce significant beneficial genetic variability. However, these meioses can provide the adaptive benefit of recombinational repair of DNA damages during formation of germ cells at each generation. [ aanhaling nodig ] Such a benefit may have been sufficient to allow the long-term persistence of meioses even when followed by self-fertilization. A physical mechanism for self-pollination in A. thaliana is through pre-anthesis autogamy, such that fertilisation takes place largely before flower opening.

    and NASC: [49] curated sources for diverse genetic and molecular biology information, links to gene expression databases [97] etc. (seed and DNA stocks) (seed and DNA stocks)
  1. ^ Warwick SI, Francis A, Al-Shehbaz IA (2016). "Brassicaceae species checklist and database". Species 2000 & ITIS Catalogue of Life (26 ed.). ISSN2405-8858.
  2. ^
  3. "Arabidopsis thaliana". Germplasm Resources Information Network (GRIN). Agricultural Research Service (ARS), United States Department of Agriculture (USDA) . Retrieved 11 December 2017 .
  4. ^
  5. Hoffmann MH (2002). "Biogeography of Arabidopsis thaliana (L.) Heynh. (Brassicaceae)". Journal of Biogeography. 29: 125–134. doi:10.1046/j.1365-2699.2002.00647.x.
  6. ^
  7. Mitchell-Olds T (December 2001). "Arabidopsis thaliana and its wild relatives: a model system for ecology and evolution". Tendense in ekologie en evolusie. 16 (12): 693–700. doi:10.1016/s0169-5347(01)02291-1.
  8. ^
  9. Sharbel TF, Haubold B, Mitchell-Olds T (2000). "Genetic isolation by distance in Arabidopsis thaliana: biogeography and postglacial colonization of Europe". Molekulêre ekologie. 9 (12): 2109–2118. doi:10.1046/j.1365-294x.2000.01122.x. PMID11123622. S2CID1788832.
  10. ^ ab
  11. Krämer U (March 2015). "Planting molecular functions in an ecological context with Arabidopsis thaliana". eLife. 4: –06100. doi:10.7554/eLife.06100. PMC4373673 . PMID25807084.
  12. ^
  13. Durvasula A, Fulgione A, Gutaker RM, Alacakaptan SI, Flood PJ, Neto C, Tsuchimatsu T, Burbano HA, Picó FX, Alonso-Blanco C, Hancock AM (May 2017). "Arabidopsis thaliana". Verrigtinge van die National Academy of Sciences van die Verenigde State van Amerika. 114 (20): 5213–5218. doi:10.1073/pnas.1616736114. PMC5441814 . PMID28473417.
  14. ^ ab
  15. "Genome Assembly". The Arabidopsis Information Resource . Retrieved 29 March 2016 .
  16. ^ Flora of NW Europe: Arabidopsis thalianaArchived 8 December 2007 at the Wayback Machine
  17. ^ Blamey, M. & Grey-Wilson, C. (1989). Flora of Britain and Northern Europe. 0-340-40170-2
  18. ^ Flora of Pakistan: Arabidopsis thaliana
  19. ^ Flora of China: Arabidopsis thaliana
  20. ^
  21. López-Bucio J, Campos-Cuevas JC, Hernández-Calderón E, Velásquez-Becerra C, Farías-Rodríguez R, Macías-Rodríguez LI, Valencia-Cantero E (February 2007). "Bacillus megaterium rhizobacteria promote growth and alter root-system architecture through an auxin- and ethylene-independent signaling mechanism in Arabidopsis thaliana". Molecular Plant-Microbe Interactions. 20 (2): 207–17. doi: 10.1094/MPMI-20-2-0207 . PMID17313171.
  22. ^
  23. Meinke DW, Cherry JM, Dean C, Rounsley SD, Koornneef M (October 1998). "Arabidopsis thaliana: a model plant for genome analysis". Wetenskap. 282 (5389): 662, 679–82. Bibcode: 1998Sci. 282..662M. CiteSeerX10.1.1.462.4735 . doi:10.1126/science.282.5389.662. PMID9784120.
  24. ^ ab
  25. The 1001 Genomes Consortium (July 2016). "1,135 Genomes Reveal the Global Pattern of Polymorphism in Arabidopsis thaliana". Sel. 166 (2): 481–491. doi:10.1016/j.cell.2016.05.063. PMC4949382 . PMID27293186.
  26. ^
  27. "Arabidopsis thaliana (L.) Heynh". www.gbif.org . Retrieved 8 December 2018 .
  28. ^
  29. Hedberg, Olov (1957). "Afroalpine Vascular Plants: A Taxonomic Revision". Acta Universitatis Upsaliensis: Symbolae Botanicae Upsalienses. 15 (1): 1–144.
  30. ^
  31. Fulgione A, Hancock AM (September 2018). "Archaic lineages broaden our view on the history of Arabidopsis thaliana". The New Phytologist. 219 (4): 1194–1198. doi: 10.1111/nph.15244 . PMID29862511.
  32. ^ ab
  33. "Arabidopsis thaliana – Overview". Ensiklopedie van die lewe.
  34. ^
  35. Exposito-Alonso M, Becker C, Schuenemann VJ, Reiter E, Setzer C, Slovak R, Brachi B, Hagmann J, Grimm DG, Chen J, Busch W, Bergelson J, Ness RW, Krause J, Burbano HA, Weigel D (February 2018). "The rate and potential relevance of new mutations in a colonizing plant lineage". PLOS Genetics. 14 (2): e1007155. doi:10.1371/journal.pgen.1007155. PMC5825158 . PMID29432421.
  36. ^
  37. "Arabidopsis thaliana (thale cress)". Kew Gardens.
  38. ^
  39. "State and Federal Noxious Weeds List | USDA PLANTS". plants.sc.egov.usda.gov . Retrieved 8 December 2018 .
  40. ^
  41. "IRMNG". Ensiklopedie van die lewe. Archived from the original on 1 April 2018.
  42. ^[1] TAIR: About Arabidopsis
  43. ^
  44. Rensink WA, Buell CR (June 2004). "Arabidopsis to rice. Applying knowledge from a weed to enhance our understanding of a crop species". Plantfisiologie. 135 (2): 622–9. doi:10.1104/pp.104.040170. PMC514098 . PMID15208410.
  45. ^
  46. Coelho SM, Peters AF, Charrier B, Roze D, Destombe C, Valero M, Cock JM (December 2007). "Complex life cycles of multicellular eukaryotes: new approaches based on the use of model organisms". Gene. 406 (1–2): 152–70. doi:10.1016/j.gene.2007.07.025. PMID17870254.
  47. ^
  48. Platt A, Horton M, Huang YS, Li Y, Anastasio AE, Mulyati NW, Agren J, Bossdorf O, Byers D, Donohue K, Dunning M, Holub EB, Hudson A, Le Corre V, Loudet O, Roux F, Warthmann N, Weigel D, Rivero L, Scholl R, Nordborg M, Bergelson J, Borevitz JO (February 2010). Novembre J (ed.). "The scale of population structure in Arabidopsis thaliana". PLOS Genetics. 6 (2): e1000843. doi:10.1371/journal.pgen.1000843. PMC2820523 . PMID20169178.
  49. ^
  50. Yanofsky MF, Ma H, Bowman JL, Drews GN, Feldmann KA, Meyerowitz EM (July 1990). "The protein encoded by the Arabidopsis homeotic gene agamous resembles transcription factors". Natuur. 346 (6279): 35–9. Bibcode:1990Natur.346. 35Y. doi:10.1038/346035a0. PMID1973265. S2CID4323431.
  51. ^ ab
  52. Meyerowitz EM (January 2001). "Prehistory and history of Arabidopsis research". Plantfisiologie. 125 (1): 15–9. doi:10.1104/pp.125.1.15. PMC1539315 . PMID11154286.
  53. ^
  54. "About AIS". The Arabidopsis Information Resource. 8 November 2018 . Retrieved 25 April 2021 .
  55. ^
  56. Lloyd AM, Barnason AR, Rogers SG, Byrne MC, Fraley RT, Horsch RB (October 1986). "Transformation of Arabidopsis thaliana met Agrobacterium tumefaciens". Wetenskap. 234 (4775): 464–6. Bibcode:1986Sci. 234..464L. doi:10.1126/science.234.4775.464. PMID17792019. S2CID22125701.
  57. ^
  58. Chang C, Meyerowitz EM (March 1986). "Molecular cloning and DNA sequence of the Arabidopsis thaliana alcohol dehydrogenase gene". Verrigtinge van die National Academy of Sciences van die Verenigde State van Amerika. 83 (5): 1408–12. Bibcode: 1986PNAS. 83.1408C. doi:10.1073/pnas.83.5.1408. PMC323085 . PMID2937058.
  59. ^ ab
  60. "Arabidopsis thaliana chloroplast, complete genome — NCBI accession number NC_000932.1". National Center for Biotechnology Information . Retrieved 4 November 2018 .
  61. ^ ab
  62. Sato S, Nakamura Y, Kaneko T, Asamizu E, Tabata S (1999). "Complete structure of the chloroplast genome of Arabidopsis thaliana". DNA Research. 6 (5): 283–290. doi: 10.1093/dnares/6.5.283 . ISSN1340-2838. PMID10574454.
  63. ^
  64. Bennett MD, Leitch IJ, Price HJ, Johnston JS (April 2003). "Comparisons with Caenorhabditis (approximately 100 Mb) and Drosophila (approximately 175 Mb) using flow cytometry show genome size in Arabidopsis to be approximately 157 Mb, thus approximately 25% larger than the Arabidopsis genome initiative estimate of approximately 125 Mb". Annals of Botany. 91 (5): 547–57. doi:10.1093/aob/mcg057. PMC4242247 . PMID12646499.
  65. ^ (Leutwileret al., 1984). In our survey Arabidopsis .
  66. ^
  67. Fleischmann A, Michael TP, Rivadavia F, Sousa A, Wang W, Temsch EM, Greilhuber J, Müller KF, Heubl G (December 2014). "Evolution of genome size and chromosome number in the carnivorous plant genus Genlisea (Lentibulariaceae), with a new estimate of the minimum genome size in angiosperms". Annals of Botany. 114 (8): 1651–63. doi:10.1093/aob/mcu189. PMC4649684 . PMID25274549.
  68. ^
  69. The Arabidopsis Genome Initiative (December 2000). "Analysis of the genome sequence of the flowering plant Arabidopsis thaliana". Natuur. 408 (6814): 796–815. Bibcode:2000Natur.408..796T. doi: 10.1038/35048692 . PMID11130711.
  70. ^
  71. "TAIR - Genome Annotation".
  72. ^
  73. "Details - Arabidopsis_thaliana - Ensembl Genomes 63". ensembl.gramene.org . Retrieved 15 June 2021 .
  74. ^
  75. "Arabidopsis thaliana (Mouse-ear cress)". www.uniprot.org . Retrieved 15 June 2021 .
  76. ^
  77. Cheng, Chia-Yi Krishnakumar, Vivek Chan, Agnes P. Thibaud-Nissen, Françoise Schobel, Seth Town, Christopher D. (2017). "Araport11: a complete reannotation of the Arabidopsis thaliana reference genome". Die Plantjoernaal. 89 (4): 789–804. doi:10.1111/tpj.13415. ISSN1365-313X.
  78. ^
  79. "Arabidopsis thaliana ecotype Col-0 mitochondrion, complete genome — NCBI accession number BK010421". National Center for Biotechnology Information . Retrieved 10 April 2019 .
  80. ^
  81. Klein M, Eckert-Ossenkopp U, Schmiedeberg I, Brandt P, Unseld M, Brennicke A, Schuster W (1994). "Physical mapping of the mitochondrial genome of Arabidopsis thaliana by cosmid and YAC clones". Plant Journal. 6 (3): 447–455. doi: 10.1046/j.1365-313X.1994.06030447.x . PMID7920724.
  82. ^
  83. Gualberto JM, Mileshina D, Wallet C, Niazi AK, Weber-Lotfi F, Dietrich A (2014). "The plant mitochondrial genome: dynamics and maintenance". Biochimie. 100: 107–120. doi:10.1016/j.biochi.2013.09.016. PMID24075874.
  84. ^
  85. Clough SJ, Bent AF (December 1998). "Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana". Die Plantjoernaal. 16 (6): 735–43. doi:10.1046/j.1365-313x.1998.00343.x. PMID10069079.
  86. ^
  87. Zhang X, Henriques R, Lin SS, Niu QW, Chua NH (2006). "Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method". Natuurprotokolle. 1 (2): 641–6. doi:10.1038/nprot.2006.97. PMID17406292. S2CID6906570.
  88. ^
  89. "T-DNA Express: Arabidopsis Gene Mapping Tool". signal.salk.edu.
  90. ^ abc
  91. "Eurasian Arabidopsis Stock Centre (uNASC)". arabidopsis.info.
  92. ^
  93. Magliano TM, Botto JF, Godoy AV, Symonds VV, Lloyd AM, Casal JJ (June 2005). "New Arabidopsis recombinant inbred lines (Landsberg erecta x Nossen) reveal natural variation in phytochrome-mediated responses". Plantfisiologie. 138 (2): 1126–35. doi:10.1104/pp.104.059071. PMC1150426 . PMID15908601.
  94. ^
  95. "ABRC". abrc.osu.edu.
  96. ^
  97. "NASC Collection Info". arabidopsis.info.
  98. ^
  99. Hahn F, Mantegazza O, Greiner A, Hegemann P, Eisenhut M, Weber AP (2017). "Arabidopsis thaliana". Grense in plantkunde. 8: 39. doi:10.3389/fpls.2017.00039. PMC5258748 . PMID28174584.
  100. ^
  101. Hahn F, Eisenhut M, Mantegazza O, Weber AP (5 April 2018). "Arabidopsis With Cas9-Based Gene Targeting". Grense in plantkunde. 9: 424. doi:10.3389/fpls.2018.00424. PMC5895730 . PMID29675030.
  102. ^
  103. Lolle SJ, Victor JL, Young JM, Pruitt RE (March 2005). "Genome-wide non-mendelian inheritance of extra-genomic information in Arabidopsis". Natuur. 434 (7032): 505–9. Bibcode:2005Natur.434..505L. doi:10.1038/nature03380. PMID15785770. S2CID1352368. Washington Post summary.
  104. ^
  105. Peng P, Chan SW, Shah GA, Jacobsen SE (September 2006). "Plant genetics: increased outcrossing in hothead mutants". Natuur. 443 (7110): E8, discussion E8–9. Bibcode:2006Natur.443E. 8P. doi: 10.1038/nature05251 . PMID17006468. S2CID4420979.
  106. ^
  107. Pennisi E (September 2006). "Genetics. Pollen contamination may explain controversial inheritance". Wetenskap. 313 (5795): 1864. doi:10.1126/science.313.5795.1864. PMID17008492. S2CID82215542.
  108. ^
  109. Coen ES, Meyerowitz EM (September 1991). "The war of the whorls: genetic interactions controlling flower development". Natuur. 353 (6339): 31–7. Bibcode:1991Natur.353. 31C. doi:10.1038/353031a0. PMID1715520. S2CID4276098.
  110. ^
  111. Tsukaya H (7 June 2013). "Leaf development". The Arabidopsis Book. 11: e0163. doi:10.1199/tab.0163. PMC3711357 . PMID23864837.
  112. ^
  113. Turner S, Sieburth LE (22 March 2003). "Vascular patterning". The Arabidopsis Book. 2: e0073. doi:10.1199/tab.0073. PMC3243335 . PMID22303224.
  114. ^
  115. Efroni I, Eshed Y, Lifschitz E (April 2010). "Morphogenesis of simple and compound leaves: a critical review". Die plantsel. 22 (4): 1019–32. doi:10.1105/tpc.109.073601. PMC2879760 . PMID20435903.
  116. ^ Moreno N, Bougourd S, Haseloff J and Fiejo JA. 2006. Chapter 44: Imaging Plant Cells. In: Pawley JB (Editor). Handbook of Biological Confocal Microscopy - 3rd edition. SpringerScience+Business Media, New York. p769-787
  117. ^
  118. Shaw SL (February 2006). "Imaging the live plant cell". Die Plantjoernaal. 45 (4): 573–98. doi:10.1111/j.1365-313X.2006.02653.x. PMID16441350.
  119. ^
  120. Sullivan JA, Deng XW (August 2003). "From seed to seed: the role of photoreceptors in Arabidopsis development". Ontwikkelingsbiologie. 260 (2): 289–97. doi:10.1016/S0012-1606(03)00212-4. PMID12921732.
  121. ^
  122. Más P (2005). "Circadian clock signaling in Arabidopsis thaliana: from gene expression to physiology and development". The International Journal of Developmental Biology. 49 (5–6): 491–500. doi: 10.1387/ijdb.041968pm . PMID16096959.
  123. ^
  124. Scialdone A, Mugford ST, Feike D, Skeffington A, Borrill P, Graf A, Smith AM, Howard M (June 2013). "Arabidopsis plants perform arithmetic division to prevent starvation at night". eLife. 2: e00669. arXiv: 1306.5148 . doi:10.7554/eLife.00669. PMC3691572 . PMID23805380.
  125. ^
  126. Ruppel NJ, Hangarter RP, Kiss JZ (February 2001). "Red-light-induced positive phototropism in Arabidopsis roots". Planta. 212 (3): 424–30. doi:10.1007/s004250000410. PMID11289607. S2CID28410755.
  127. ^"Plants that Glow in the Dark", Bioresearch Online, 18 May 2000
  128. ^ ab
  129. Letzter, Rafi (4 January 2019). "There Are Plants and Animals on the Moon Now (Because of China)". Space.com . Retrieved 15 January 2019 .
  130. ^
  131. Connor, Neil (13 April 2018). "China plans to grow flowers and silkworms on the dark side of the moon". Die Telegraaf. ISSN0307-1235 . Retrieved 15 January 2019 .
  132. ^ Hassani, M.A., Durán, P. and Hacquard, S. (2018) "Microbial interactions within the plant holobiont". Mikrobioom, 6(1): 58. doi:10.1186/s40168-018-0445-0. Material was copied from this source, which is available under a Creative Commons Attribution 4.0 International License
  133. ^
  134. Collins NC, Thordal-Christensen H, Lipka V, Bau S, Kombrink E, Qiu JL, Hückelhoven R, Stein M, Freialdenhoven A, Somerville SC, Schulze-Lefert P (October 2003). "SNARE-protein-mediated disease resistance at the plant cell wall". Natuur. 425 (6961): 973–7. Bibcode:2003Natur.425..973C. doi:10.1038/nature02076. PMID14586469. S2CID4408024.
  135. ^
  136. Lipka V, Dittgen J, Bednarek P, Bhat R, Wiermer M, Stein M, Landtag J, Brandt W, Rosahl S, Scheel D, Llorente F, Molina A, Parker J, Somerville S, Schulze-Lefert P (November 2005). "Pre- and postinvasion defenses both contribute to nonhost resistance in Arabidopsis". Wetenskap. 310 (5751): 1180–3. Bibcode:2005Sci. 310.1180L. doi:10.1126/science.1119409. hdl: 11858/00-001M-0000-0012-3A32-0 . PMID16293760. S2CID35317665.
  137. ^
  138. Stein M, Dittgen J, Sánchez-Rodríguez C, Hou BH, Molina A, Schulze-Lefert P, Lipka V, Somerville S (March 2006). "Arabidopsis PEN3/PDR8, an ATP binding cassette transporter, contributes to nonhost resistance to inappropriate pathogens that enter by direct penetration". Die plantsel. 18 (3): 731–46. doi:10.1105/tpc.105.038372. PMC1383646 . PMID16473969.
  139. ^
  140. Knepper C, Day B (March 2010). "From perception to activation: the molecular-genetic and biochemical landscape of disease resistance signaling in plants". The Arabidopsis Book. 8: e012. doi:10.1199/tab.0124. PMC3244959 . PMID22303251.
  141. ^
  142. Gómez-Gómez L, Felix G, Boller T (May 1999). "A single locus determines sensitivity to bacterial flagellin in Arabidopsis thaliana". Die Plantjoernaal. 18 (3): 277–84. doi: 10.1046/j.1365-313X.1999.00451.x . PMID10377993.
  143. ^
  144. Gómez-Gómez L, Boller T (June 2000). "FLS2: an LRR receptor-like kinase involved in the perception of the bacterial elicitor flagellin in Arabidopsis". Molekulêre sel. 5 (6): 1003–11. doi:10.1016/S1097-2765(00)80265-8. PMID10911994.
  145. ^
  146. Zipfel C, Kunze G, Chinchilla D, Caniard A, Jones JD, Boller T, Felix G (May 2006). "Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts Agrobacterium-mediated transformation". Sel. 125 (4): 749–60. doi:10.1016/j.cell.2006.03.037. PMID16713565. S2CID6856390.
  147. ^
  148. Lacombe S, Rougon-Cardoso A, Sherwood E, Peeters N, Dahlbeck D, van Esse HP, Smoker M, Rallapalli G, Thomma BP, Staskawicz B, Jones JD, Zipfel C (April 2010). "Interfamily transfer of a plant pattern-recognition receptor confers broad-spectrum bacterial resistance". Natuurbiotegnologie. 28 (4): 365–9. doi:10.1038/nbt.1613. PMID20231819. S2CID7260214. ,
  149. ^
  150. Zhang J, Zhou JM (September 2010). "Plant immunity triggered by microbial molecular signatures". Molecular Plant. 3 (5): 783–93. doi:10.1093/mp/ssq035. PMID20713980.
  151. ^
  152. Kunkel BN, Bent AF, Dahlbeck D, Innes RW, Staskawicz BJ (August 1993). "RPS2, an Arabidopsis disease resistance locus specifying recognition of Pseudomonas syringae strains expressing the avirulence gene avrRpt2". Die plantsel. 5 (8): 865–75. doi:10.1105/tpc.5.8.865. PMC160322 . PMID8400869.
  153. ^
  154. Axtell MJ, Staskawicz BJ (February 2003). "Initiation of RPS2-specified disease resistance in Arabidopsis is coupled to the AvrRpt2-directed elimination of RIN4". Sel. 112 (3): 369–77. doi:10.1016/S0092-8674(03)00036-9. PMID12581526. S2CID1497625.
  155. ^
  156. Cao H, Bowling SA, Gordon AS, Dong X (November 1994). "Characterization of an Arabidopsis Mutant That Is Nonresponsive to Inducers of Systemic Acquired Resistance". Die plantsel. 6 (11): 1583–1592. doi:10.1105/tpc.6.11.1583. PMC160545 . PMID12244227.
  157. ^
  158. Mou Z, Fan W, Dong X (June 2003). "Inducers of plant systemic acquired resistance regulate NPR1 function through redox changes". Sel. 113 (7): 935–44. doi:10.1016/S0092-8674(03)00429-X. PMID12837250. S2CID1562690.
  159. ^
  160. Johnson C, Boden E, Arias J (August 2003). "Salicylic acid and NPR1 induce the recruitment of trans-activating TGA factors to a defense gene promoter in Arabidopsis". Die plantsel. 15 (8): 1846–58. doi:10.1105/tpc.012211. PMC167174 . PMID12897257.
  161. ^ abcde
  162. Delaney TP, Uknes S, Vernooij B, Friedrich L, Weymann K, Negrotto D, Gaffney T, Gut-Rella M, Kessmann H, Ward E, Ryals J (November 1994). "A central role of salicylic Acid in plant disease resistance". Wetenskap. 266 (5188): 1247–50. Bibcode: 1994Sci. 266.1247D. doi:10.1126/science.266.5188.1247. PMID17810266. S2CID15507678.
  163. ^
  164. Ben Khaled, Sara Postma, Jelle Robatzek, Silke (4 August 2015). "A Moving View: Subcellular Trafficking Processes in Pattern Recognition Receptor–Triggered Plant Immunity". Annual Review of Phytopathology. Annual Reviews. 53 (1): 379–402. doi:10.1146/annurev-phyto-080614-120347. ISSN0066-4286.
  165. ^
  166. Bent AF, Kunkel BN, Dahlbeck D, Brown KL, Schmidt R, Giraudat J, Leung J, Staskawicz BJ (September 1994). "RPS2 of Arabidopsis thaliana: a leucine-rich repeat class of plant disease resistance genes". Wetenskap. 265 (5180): 1856–60. Bibcode: 1994Sci. 265.1856B. doi:10.1126/science.8091210. PMID8091210.
  167. ^ abcd
  168. Zipfel C, Robatzek S, Navarro L, Oakeley EJ, Jones JD, Felix G, Boller T (April 2004). "Bacterial disease resistance in Arabidopsis through flagellin perception". Natuur. 428 (6984): 764–7. Bibcode:2004Natur.428..764Z. doi:10.1038/nature02485. PMID15085136. S2CID4332562.
  169. ^ ab
  170. Lawton K, Friedrich L, Hunt M (1996). "Benzothiadizaole induces disease resistance by a citation of the systemic acquired resistance signal transduction pathway". Die Plantjoernaal. 10 (1): 71–82. doi: 10.1046/j.1365-313x.1996.10010071.x . PMID8758979.
  171. ^
  172. Fridman, Eyal (2015). "Consequences of hybridization and heterozygosity on plant vigor and phenotypic stability". Plantkunde. Elsevier. 232: 35–40. doi:10.1016/j.plantsci.2014.11.014. ISSN0168-9452.
  173. ^
  174. Link BM, Busse JS, Stankovic B (2014). "Seed-to-Seed-to-Seed Growth and Development of Arabidopsis in Microgravity". Astrobiology. 14 (10): 866–875. Bibcode:2014AsBio..14..866L. doi:10.1089/ast.2014.1184. PMC4201294 . PMID25317938.
  175. ^
  176. Ferl RJ, Paul AL (April 2010). "Lunar plant biology--a review of the Apollo era". Astrobiology. 10 (3): 261–74. Bibcode:2010AsBio..10..261F. doi:10.1089/ast.2009.0417. PMID20446867.
  177. ^
  178. Yetisen AK, Jiang L, Cooper JR, Qin Y, Palanivelu R, Zohar Y (May 2011). "A microsystem-based assay for studying pollen tube guidance in plant reproduction". J. Micromech. Microeng. 25 (5): 054018. Bibcode:2011JMiMi..21e4018Y. doi:10.1088/0960-1317/21/5/054018. CS1 onderhoud: gebruik skrywers parameter (skakel)
  179. ^
  180. Abbott RJ, Gomes MF (1989). "Population genetic structure and outcrossing rate of Arabidopsis thaliana (L.) Heynh". Oorerflikheid. 62 (3): 411–418. doi: 10.1038/hdy.1989.56 .
  181. ^
  182. Tang C, Toomajian C, Sherman-Broyles S, Plagnol V, Guo YL, Hu TT, Clark RM, Nasrallah JB, Weigel D, Nordborg M (August 2007). "The evolution of selfing in Arabidopsis thaliana". Wetenskap. 317 (5841): 1070–2. Bibcode: 2007Sci. 317.1070T. doi:10.1126/science.1143153. PMID17656687. S2CID45853624.
  183. ^http://www.arabidopsis.org/portals/expression/microarray/microarrayDatasetsV2.jsp
    Media related to Arabidopsis thaliana at Wikimedia Commons Featured article in Genome News Network - A comprehensive review published yearly related to research in Arabidopsis

160 ms 9.0% recursiveClone 140 ms 7.9% Scribunto_LuaSandboxCallback::gsub 100 ms 5.6% Scribunto_LuaSandboxCallback::callParserFunction 80 ms 4.5% Scribunto_LuaSandboxCallback::expandTemplate 80 ms 4.5% Scribunto_LuaSandboxCallback::sub 80 ms 4.5% Scribunto_LuaSandboxCallback::find 60 ms 3.4% Scribunto_LuaSandboxCallback::getAllExpandedArguments 40 ms 2.2% [others] 480 ms 27.0% Number of Wikibase entities loaded: 38/400 -->


Verwysings

Enserink, M. 2013. To stop malaria, infect the mosquitoes. Science Now (9 May 2013), http://www.sciencemag.org/news/2013/05/stop-malaria-infect-mosquitoes.

Francis, J. W. 2003. The organosubstrate of life: a creationist perspective of microbes and viruses. In Proceedings of the Fifth International Conference on Creationism, ed. R. L. Ivey, pp. 434–444. Pittsburgh, Pennsylvania: Creation Science Fellowship.

Gardner, M. J., N. Hall, E. Fung, O. White, M. Berriman, R. W. Hyman, J. M. Carlton, et al. 2002. Genome sequence of the human malaria parasite Plasmodium falciparum. Natuur 419:498–511 doi:10.1038/nature01097 in Plasmodium genomics special issue, 3 October 2002.

Gillen, A. L. 2013. Parasitology Lab Manual, 2de uitgawe. Kearney, Nebraska: RL Simonson Studios.

Gillen, A. L. 2007. The Genesis of Germs: Disease and the Coming Plagues in a Fallen World. Green Forest, Arkansas: Master Books.

Kalanon, M. and G. McFadden. 2010. Malaria, Plasmodium falciparum, and its apicoplast. Biochemical Society transactions 38(3):775–82. doi: 10.1042/BST0380775. Retrieved from liberty.illiad.oclc.org.

Marquardt, W. C., R. S. Demaree, and R. B. Grieve. 2000. Parasitology and Vector Biology, 2de uitgawe. San Diego, California: Harcourt Academic Press.

Perry, A. 2011. Lifeblood. New York: PublicAffairs.

Roberts, L. S., J. Janovy, Jr., and S. Nadler. 2013. Schmidt and Roberts’ Foundations of Parasitology, 9th edition. Boston, Massachusetts: WCB McGraw-Hill.

Shah, S. 2011. The Fever: How Malaria Has Ruled Humankind for 500,000 Years (reprint edition). New York: Picador.

Short, A. R. 1955. The Bible and Modern Medicine. London: The Paternoster Press.

Smith, D. 2013. Steal my sunshine. Die wetenskaplike 27:35–40.

Smyth, J. D. 1976. Introduction to Animal Parasitology. London: Hodder and Stoughton.

Spielman, A. and M. D’Antonio, 2001. Mosquito: A Natural History of Our Most Persistent and Deadly Foe, 1st edition. New York: Hyperion.

Tortora, G. J., B. R. Funke, and C. L. Case. 2013. Microbiology, An Introduction,11th edition. San Francisco, Kalifornië: Pearson Benjamin/Cummings Pub. Co.


Kyk die video: ناو هواپیمابر آدمیرال کوزنتسوف (September 2022).