Inligting

Wat is die verskil tussen taksonomiese hulpmiddels Flora, Manual en Catalogue?

Wat is die verskil tussen taksonomiese hulpmiddels Flora, Manual en Catalogue?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Die drie tipe boeke wat hierbo genoem is, is taksonomiese hulpmiddels wat inligting bied oor spesies wat in 'n gebied voorkom. Die presiese verskil tussen hulle is egter nie vir my duidelik nie. Verduidelik asseblief.


A Flora beskryf plante en waar hulle woon. Floras sluit tipies 'n digotome sleutel vir identifikasiedoeleindes in en dikwels sal ook reekskaarte insluit. Floras is byna altyd ontwerp om gelyktydig streeksbeperk en streeksuitputtend/volledig te wees (d.w.s. sluit alle plante in wat in daardie streek groei of ten minste alle taksonomiese afdelings van gespesifiseerde taksa). Sien Voorbeeld.

A handleiding is baie wyer van toepassing op plante, en gee jou tipies opdrag oor 'n onderwerp (bv. identifikasie/differensiasie van spesies). 'n Handleiding hoef nie volledig te wees nie en die omvang daarvan word tipies deur die gebruiker gedefinieer (alhoewel dikwels gebaseer op die skaal/omvang van sy onderliggende onderwerp). Sommige het egter die term handleiding gebruik om min of meer sinoniem te wees met Flora of andersins soortgelyke dokument (sien bv. hier).

A katalogus is bloot 'n lys van alle spesies wat op een of ander manier georganiseer is. Hierdie is gewoonlik alfabeties (teenoor taksonomies georganiseer soos 'n tipiese Flora). U sal ook nooit 'n sleutel in 'n katalogus vind nie, en u sal dikwels minder fitografiese besonderhede vind.

Sien Hoofstuk 6 in Beskrywing van spesies: Praktiese taksonomiese prosedure vir bioloë deur Judith Winston vir verdere bystand.


Enterobacter

Ons redakteurs sal nagaan wat jy ingedien het en bepaal of die artikel hersien moet word.

Enterobacter, (genus Enterobacter), een van 'n groep staafvormige bakterieë van die familie Enterobacteriaceae. Enterobacter is gram-negatiewe bakterieë wat as fakultatiewe anaërobe geklassifiseer word, wat beteken dat hulle in beide aërobiese en anaërobiese omgewings kan floreer. Baie spesies besit flagella en is dus beweeglik. Eienskappe soos beweeglikheid, sowel as sekere biochemiese eienskappe, insluitend die vermoë om 'n ensiem bekend as ornitiendekarboksilase te sintetiseer, word gebruik om te onderskei Enterobacter van die baie soortgelyke en nou verwante Klebsiella bakterieë. Enterobacter is vernoem na die organismes se oorheersende natuurlike habitat, die ingewande van diere (van Grieks enteron, wat "derm" beteken).

Enterobacter is alomteenwoordig van aard hul teenwoordigheid in die dermkanale van diere lei tot hul wye verspreiding in grond, water en riool. Hulle word ook in plante aangetref. In mense, meervoudig Enterobacter Dit is bekend dat spesies as opportunistiese patogene (siekteveroorsakende organismes) optree, insluitend E. cloacae, E. aerogenes, E. gergoviae, en E. agglomerans. Patogeen Enterobacter kan enige van 'n verskeidenheid toestande veroorsaak, insluitend oog- en velinfeksies, meningitis, bakteremie (bakteriële bloedinfeksie), longontsteking en urienweginfeksies. In baie gevalle word siekte veroorsaak deur E. cloacae of deur E. aerogenes word geassosieer met blootstelling aan die organismes in nosokomiale omgewings, soos hospitale of verpleeginrigtings.

Die opkoms van dwelm-weerstandige Enterobacter organismes het ingewikkelde behandelingsregimes, veral binne nosokomiale omgewings, waar sulke organismes al hoe meer algemeen geword het. Tradisionele benaderings tot behandeling Enterobacter infeksies behels enkelmiddel antimikrobiese terapie, tipies met 'n aminoglikosied, 'n fluorokinolon, 'n kefalosporien of imipenem. In sommige gevalle is subpopulasies van Enterobacter is in staat om ensieme bekend as beta-laktamases te produseer, wat die sentrale ringstruktuur wat verantwoordelik is vir die aktiwiteit van beta-laktam antibiotika, 'n groep wat imipenem ('n tipe karbapenem) en kefalosporiene insluit, kloof. Herhaalde blootstelling aan hierdie middels kies vir beta-laktamase-sintese Enterobacter, wat sodoende aanleiding gee tot middelweerstand, insluitend teen karbapenems, wat eens hoogs effektief teen multi-middel-weerstandige organismes was. Nuwer benaderings tot Enterobacter infeksies het kombinasie-terapie-regimes aangeneem met verskeie antibiotika met verskillende kernstrukture, soos 'n aminoglikosied of 'n fluorokinoloon in kombinasie met 'n beta-laktammiddel. Ten spyte van die belofte van hierdie meer diverse strategie, is dit egter geassosieer met die seleksie van multi-middel-weerstandige organismes.

Weerstand van Enterobacter vir nie-beta-laktam antibiotika, insluitend fluorokinolone soos ciprofloxacin, behels duidelike sellulêre en genetiese meganismes. Voorbeelde van bakterieë wat sulke meganismes gebruik, is onder meer ciprofloxacin-bestand E. aerogenes en is bestand teen verskeie middels E. aerogenes, wat in baie gevalle bestand is teen ciprofloxacin en imipenem. In Enterobacter organismes wat weerstand bied teen aminoglikosiede, is weerstand geassosieer met 'n bakteriese genetiese element bekend as 'n integron. Integrone bevat gene wat antibiotika-weerstandsvermoëns verleen en word deur genetiese rekombinasie in bakteriële genome geïnkorporeer. Hulle word doeltreffend uitgeruil en versprei onder sirkulerende bakteriese populasies, soos dié wat in nosokomiale omgewings voorkom. In E. cloacae weerstand teen die aminoglikosied gentamisien is toegeskryf aan die teenwoordigheid van integrone in die organisme se genoom.

Vrylewend Enterobacter in staat is om stikstof te bind. Sekere spesies, veral E. cloacae, is betrokke by simbiotiese stikstofbinding in plante en is geïsoleer van die wortelknoppe van sekere gewasse, soos koring en sorghum, en van die risosfere van rys.


“Die katakombes van die natuur”

Die winter van soek na die opgestopte eekhoring was dieselfde winter wat ek deurgebring het om die roofvoëls dop te hou wat vlugtig om ons huis sou woon. Deur die blaarlose bome het ek valke en valke gewaar terwyl hulle deur die bos sny en op die ledemate van die suiker -esdoorn kom lê wat die grens tussen ons agterplaas en die bos daarbuite aanwys. Dit was nie ongewoon om 'n valk op die kaal takke te sien sit nie, wat soms sy kop effens beweeg, die lug en grond skandeer, ander kere roerloos bly, in die landskap verdwyn, voordat dit weer in vlug oor die wit lug ontplof het.

Maar so gou as moontlik was ek betower deur die skoonheid van 'n voël of ek sou verplig voel om dit te probeer identifiseer. Ek en my vrou was toegerus met 'n verkyker en reisboek om te bepaal: was die horisontale band 'n aanduiding van 'n Cooper's Hawk, of kan dit 'n ander roofvoël wees? Ek het geleer om voëls te definieer deur hierdie soort eenvoudige en oënskynlik arbitrêre beskrywers, wat elke dier tot 'n stel kleure of geometriese vorms verminder het: die peregrine, met sy verhelderende donker kolle onder die oë, die skerp-skynvalk met sy gestreepte, vierkantige stert. Asof dit alles is wat jy moet weet, asof 'n mens die wese kan noem en sodoende 'n soort bemeestering daaroor kan hê, deur 'n bepaalde kenmerk op te spoor, identiteit te abstraheer in 'n paar onderskeidende tekens.

Los Angeles County Museum of Natural History, 2012. [Wikimedia Commons]

Hoe gaan 'n mens te werk om te besluit watter aspekte van 'n dier die mees relevant is vir sy taksonomie? In 1836 het Henry David Thoreau se broer John en suster Sophia 'n notaboek begin hou waarin hulle die voëlspesies wat hulle in die woude rondom Concord, Massachusetts gesien het, in 'n kort volgorde begin soek het, het hulle begin soek na die taksonomiese kategorieë waarmee hulle die voëls van Noord-Amerika kon onderskei. Maar soos Branka Arsić skryf, in haar verkenning van voëls en Thoreau, "getuig die notaboek van John se toenemende frustrasie met wetenskaplike metodologieë van klassifikasie." 2 As 'n mens deur die bundel blaai, word sy toenemende misnoeë tasbaar. Eers het Johannes probeer om die voëls volgens trekpatrone te organiseer, en toe volgens die seisoene waarin hulle waarskynlik sal verskyn, en toe volgens 'n streng alfabetiese volgorde. Al hierdie metodes het hy laat vaar, aangesien hy telkens tot die harde gevolgtrekking gekom het dat enige taksonomiese stelsel skade aanrig, anders as wesens bymekaar rangskik ter wille van een of ander vermeende orde, terwyl hy heeltyd ander affiniteite ontken wat dalk nie per se wetenskaplik is nie, maar wat nietemin skerper, meer openbarende betekenisse kan hê.

Soms het John in sy notaboek na spesifieke voëls verwys - "17 Mei '37 'n Volwasse mannetjie op 'Chesuncook' in geselskap met die mannetjies van verlede seisoen wie se ligter verekleed aangenaam gekontrasteer het met die briljante drag van hierdie meer gevorderde eksemplaar" - as as om aan te dui tot watter mate taksonomie, deur veralgemeende eienskappe uit te lig, onvermydelik versuim om individuele variëteit en verskil te verantwoord. "Wat hom interesseer," sluit Arsić af, "is wat geen nomenklatuur, hoe belê in nuanse, kan bied nie: die besondere en die relasionele (hoe 'n bepaalde Oriole kontrasteer met ander in die waargenome groep), die daardie.” 3

Uiteindelik is John Thoreau se impuls om die strenghede van taksonomie te wantrou, om te breek voor die proses om 'n dierspesie uit sy habitat te onttrek en dit binne 'n gesoute hiërargie te plaas. Sulke skematisering verg dikwels 'n figuurlike moord, soms selfs letterlik. John James Audubon, die groot voëlkenner en illustreerder, het onthou hoe hy as jong seun 'n visvanger doodgemaak het om dit te kan teken. Hy het beskryf hoe hy “die liggaam van die vissersvoël deurboor en dit op die raad.” “Uiteindelik — daar het voor my gestaan ​​die werklike Kingfisher," die onbeweeglike onderwerp vir wat Audubon triomfantlik sy "eerste tekening eintlik uit die natuur" genoem het. 4

Monsters van taksidermied voëls by Mev M. A. Maxwell’s Rocky Mountain Museum, ca. 1875. [Boston Openbare Biblioteek]

Die meer bekende Thoreau, Henry, het die taksonomiese imperatief heeltemal verwerp. "Ek haat museums, daar is niks wat my geeste so weeg nie," skryf hy in syne Tydskrif. “Hulle is die katakombes van die natuur. … Hulle is dooie natuur wat deur dooie mense versamel is. Ek weet nie of ek die meeste peins oor die liggame wat met katoen en saagsels gevul is of dié wat met ingewande en vlesige vesel buite die houertjies gestop is nie.” 5 Thoreau het gesien dat sodra 'n eksemplaar in 'n museum ingebring is, vir studie gearresteer en vir die nageslag gekatalogiseer is, dit reeds sy substansie verloor het. En in werklikheid, vir al sy voordele vir kennis, het taksonomie nog altyd dade van geweld, van oorheersing gekoester en selfs goedgepraat. Soos die moorddadige regter Holden verduidelik, in Bloedmeridiaan, "Wat ook al in die skepping bestaan ​​sonder my medewete, bestaan ​​sonder my toestemming." In Cormac McCarthy se somber en gewelddadige roman vang en versamel die regter natuurlike monsters. "Hierdie anonieme wesens ... lyk dalk min of niks in die wêreld," sê hy. “Tog kan die kleinste krummel ons verteer. Enige kleinste ding onder jou rots uit mans se kennis. Slegs die natuur kan die mens verslaaf en slegs wanneer die bestaan ​​van elke laaste entiteit uitgeroei word en naak voor hom staan, sal hy behoorlik oorheersing van die aarde wees.”

Ons obsessie met taksonomie het lankal sy donkerder kant gehad. Linnaeaanse klassifikasie is gebruik om die pseudo-wetenskaplike teorieë van die 19de- en vroeë 20ste-eeuse rassebiologie te versterk - om voorafbestaande oortuigings te regverdig dat Afrikane van Europeërs onderskei kan word, dat as jy genoeg neuse, wenkbroue en kakebeen meet, jy rassistiese politiek en koloniale strewes kan rasionaliseer. Die era waarin die vordering van die wetenskap plaasgevind het, waarin Carl Linnaeus probeer om die natuurlike wêreld te verstaan ​​deur dit in koninkryke, filums en gesinne te organiseer, was terselfdertyd 'n era van keiserlike verowering waarin miljoene onderwerp, verslaaf en gekoloniseer is . In hierdie siening kan geen natuurkundige se werk - ook nie museum se uitstalling - as werklik belangeloos verstaan ​​word nie.


Hoofstuk 1: Inleiding

Elektroniese biologiese literatuur

Die groot verspreiding van die biologiese literatuur het die rekenaar 'n onontbeerlike deel van enige bioloog se gereedskapstel gemaak. Abstracte en indekse is sedert die vroeë 1970's gerekenariseer en is oorspronklik deur opgeleide tussengangers soos bibliotekarisse en inligtingspesialiste gesoek (sien die inleiding tot Hoofstuk 4 vir meer inligting). Vanaf die middel 1980's was hierdie nutsmiddels beskikbaar vir eindgebruikers, en hul beskikbaarheid het eers in die jare sedertdien uitgebrei. Die volgende golf van rekenarisering het toegang tot joernale verbeter, en elektroniese boeke het met 'n paar dekades agter hul periodieke broers en susters aangetrek, maar begin tot hul reg kom.

Elektroniese joernale het vandag alledaags geword, slegs 15 jaar gelede, hulle was 'n nuwigheid, wat 'n groot mate van bespreking ontlok het oor nut, beskikbaarheid, koste, argiefberging, eienaarskap, intellektuele eiendomsregte, portuurbeoordeling en kopieregnakoming. Hierdie omstrede kwessies is steeds relevant, maar die elektroniese era vorder vinnig. Al die groot kommersiële uitgewers en genootskap-uitgewers stel tans hul tydskrifte elektronies beskikbaar, en verskeie inisiatiewe in die biologiese wetenskappe het kleiner genootskap-uitgewers gehelp om na volteks oor te gaan. Stanford University Library bied sedert 1995 elektroniese publikasiehulp aan deur sy HighWire Press (http://www.highwire.org). Hulle bied tans toegang tot meer as 1500 tydskrifte wat deur verenigings en universiteitspers gepubliseer is. 'n Meer onlangse inisiatief gemaak deur die Scholarly Publishing and Academic Resources Coalition (SPARC), genaamd BioOne (http://www.bioone.org), het 'n enkele databasis geskep wat artikels bevat uit joernale gepubliseer deur lidverenigings van die American Institute of Biological Sciences (AIBS). Dit is in April 2001 bekendgestel met ongeveer 30 joernale wat deelgeneem het, en is nou tot meer as 175 titels in 3 versamelings.

Die meeste e-tydskrifte wat tans beskikbaar is, is elektroniese weergawes van bestaande gedrukte tydskrifte. In die onstuimige vroeë dae van elektroniese publikasie is 'n aantal nuwe paradigmas in die vooruitsig gestel, insluitende die afskaffing of drasties wysiging van die huidige stelsel van ewekniebeoordeling. Voordrukargiewe soos die fisikadiens arXiv (http://arxiv.org/‎) is gesien as 'n manier om vinnige toegang tot navorsing te verskaf. Deels as gevolg van die bekommernisse oor ewekniebeoordeling wat vroeër genoem is, het die begin van die elektroniese joernaaltydperk in die lewenswetenskappe 'n baie rustiger begin as in fisika. Die vroegste e-tydskrifte in die middel tot laat 1990's was bloot elektroniese weergawes van standaard gedrukte joernale, gewoonlik in gebundelde subskripsies met beide gedrukte en aanlyn weergawes vir een prys. Nuwe tydskrifte wat slegs in elektroniese formaat gepubliseer is, sonder 'n gedrukte ekwivalent, maar nadat hulle die gewone portuurbeoordelingsproses ondergaan het, is bekendgestel, maar het deur talle struikelblokke te staan ​​gekom. Die eerste goed befondsde aanlynjoernaal in die lewenswetenskappe was die Online Journal of Current Clinical Trials (OJCCT), wat in Julie 1992 gestig is. Ondanks uitgebreide pogings was dit aanvanklik moeilik om skrywers te vind wat bereid was om in die tydskrif te publiseer, selfs ná 1994 toe dit 'n amptelike stempel van goedkeuring gekry het deur die eerste aanlyn-joernaal te word wat in Indeks Medicus. Dit het in 1996 opgehou om te publiseer, maar dit was slegs die eerste van baie aanlyn-enigste tydskrifte. Nou in die middel-2010's het baie standaardjoernale opgehou om in druk gepubliseer te word en is slegs aanlyn beskikbaar en baie nuutgeskepte tydskrifte is slegs aanlyn beskikbaar.

Die kwessie van hoe om elektroniese joernaal-ruglêers te argiveer is een waarmee uitgewers en bibliotekarisse al baie geworstel het. Ons weet hoe om kopieë van gedrukte boeke en joernale te bewaar: uitgewers druk dit op suurvrye papier en bibliotekarisse plaas kopieë daarvan in klimaatbeheerde fasiliteite op verskeie plekke regoor die wêreld. In elektroniese tydskrifte is die situasie heeltemal anders. Aanvanklik het uitgewers beheer oor die elektroniese teruglêers vir hul joernale behou, wat veroorsaak het dat bibliotekarisse en gebruikers bekommerd was oor wat sou gebeur wanneer die hou van die lêers nie meer ekonomies voordelig vir die uitgewers was nie, of as hulle uit die bedryf sou gaan. Ook, gegewe al die veranderinge in elektroniese media (magnetiese bande tot thumb drives) en standaard sagteware programme (onthou WordPerfect?), is daar kommer oor die migreer van al die massas data van een standaardplatform na 'n ander. Bibliotekarisse en uitgewers het aan hierdie kwessie gewerk, so robuuste en oortollige standaarde en stelsels is in plek wat naatlose opdaterings en oordragte in die toekoms behoort moontlik te maak. Hierdie stelsels moet nog aansienlik in die werklike lewe getoets word, maar om dit te hê, is 'n verligting vir almal wat betrokke is. Portiek (http://www.portico.org/), LOCKSS (Baie kopieë hou goed veilig, http://www.lockss.org/), en CLOCKSS (Beheerde LOCKSS, http://www.clockss.org ) is van die belangrikste inisiatiewe.

'N Ander reeks inisiatiewe wat 'n omwenteling in die biologiese literatuur gemaak het, fokus op Open Access (OA). Die ontstaan ​​van die OA -beweging gaan terug na die begin van die internet -tydperk, met sy mantra dat 'inligting gratis wil wees'. Daarbenewens het die intekenpryskrisis in die 1980's en 1990's skrywers en bibliotekarisse aangemoedig om alternatiewe vir die tradisionele maniere van publikasie te ondersoek. Die finale uitkoms van die spanning tussen tradisionele uitgewery en OA moet nog bepaal word, maar onder andere regeringsbeleide soos die NIH Openbare Toegangsbeleid wat hieronder bespreek word, waarborg dat daar 'n plek vir OA in die toekoms van wetenskaplike kommunikasie sal wees.

Daar is baie "geure" van Oop Toegang, maar die basiese definisie wat deur advokaat Peter Suber (2013) verskaf word, is dat "Ooptoegang (OA) literatuur digitaal, aanlyn, gratis en vry van die meeste kopiereg- en lisensiebeperkings is. ” Die twee tipes OA wat in die lewenswetenskappe gevind word, sluit in Author Pays (ook bekend as "goue" OA) en ooptoegangbewaarplekke ("groen" OA). Die Author Pays -model het die meeste aandag getrek, beide positief en negatief. In hierdie model betaal skrywers van wetenskaplike publikasies 'n fooi aan die tydskrifuitgewer om hul artikels onmiddellik na publikasie gratis beskikbaar te stel. Sommige joernale is heeltemal OA, soos die PLoS-joernale, maar daar is baie ander gemengde joernale waarin sommige skrywers kies om vir Open Access te betaal en sommige nie.Hierdie OA-artikels ontvang dieselfde portuurbeoordeling wat ander artikels ontvang en baie toekennings verskaf fondse vir OA-publikasies. Hierdie model is eerder soortgelyk aan die stelsel wat in baie samelewingspublikasies voorkom, waarin daar van skrywers verwag word om bladsykoste te betaal. Dit help om intekeningpryse laag te hou. Twee hoofbronne vir OA-inligting is die Directory of Open Access Journals (DOAJ), wat OA-joernale lys (http://www.doaj.org/‎), en die SHERPA/Romeo-webwerf (http://www.sherpa) .ac.uk/romeo/), wat 'n lys van uitgewer-OA-beleide bevat.

Die biologiese en mediese wetenskappe was in die voorhoede van die Oop Toegang-beweging. Meer as die helfte van die groot tydskrifte wat in die DOAJ gelys is, is biomediese biomediese tydskrifte, en publiseer ook meer artikels as die tydskrifte op ander terreine en vra hoër skrywersgeld. Die drie grootste OA-uitgewers, PLoS, Biomed Central en Oxford University Press, publiseer almal in die biomediese veld (Walters en Linville, 2011). Meer onlangs, in Augustus 2013, het ’n reeks verslae wat vir die Europese Kommissie se Direktoraat-Generaal vir Navorsing en Innovasie in diens geneem is, getoon dat 40% van artikels wat wêreldwyd van 2004-2011 gepubliseer is, as Oop Toegang beskikbaar was (Archambault et al, 2013). Biologie het 57% OA behaal, terwyl 61% van biomediese navorsingsartikels as OA beskikbaar was. Die NIH- en NSF -beleid vir openbare toegang wat hieronder bespreek word, het ook 'n beduidende uitwerking op die OA -oorsaak op biomediese gebiede gehad.

Sommige van die vroeë kommer oor die Author Pays-model het gefokus op die moontlikheid van misbruik. Terwyl die groot OA-uitgewers soos PLoS en BioMed Central streng ewekniebeoordelingsprosesse het wat gelykstaande is aan dié in die beste standaardjoernale, was die vrees nog altyd dat gewetenlose uitgewers hierdie model as 'n kontantkoei sou sien, wat enige soort drek publiseer soos solank skrywers bereid was om die geld op te hoes. Terwyl die oorgrote meerderheid OA-uitgewers meer gefokus is op die ideaal om inligting gratis beskikbaar te stel en gelyk te maak eerder as om geld te maak, is sommige gewetenlose uitgewers geïdentifiseer. Skrywers wat op soek is na OA-tydskrifte om in te publiseer, moet baie van dieselfde vrae vra as wat hulle vir enige tydskrif sou vra. Wie publiseer die tydskrif? Is die skrywersfooie in lyn met ander OA-joernale in jou vakgebied? Het jy of jou mentors al ooit daarvan gehoor? Is die joernaal in enige van die belangrikste indekse geïndekseer? Het skrywers wat jy ken en respekteer daarin gepubliseer, of is op die redaksie?

Die OA Repository of Green OA-model verskil van die Author Pays-model. In hierdie model stel skrywers na publikasie in 'n joernaal hul artikels gratis beskikbaar in 'n soort bewaarplek, soos die skrywer se persoonlike webwerf of 'n institusionele of dissiplinêre bewaarplek. In sommige gevalle laat uitgewers slegs gekopieerde teksverwerkingsweergawes van die finale artikel toe, eerder as 'n PDF van die werklike artikel, in 'n bewaarplek. Baie joernale volg nou hierdie Groen-model deur al die inhoud van hul joernale gratis beskikbaar te stel na 'n embargo-tydperk, wat gewoonlik tussen 6 maande tot 'n jaar of selfs langer is. Die aanname in hierdie model is dat die meeste van die gebruik van artikels binne 'n redelike kort tydperk na die publikasie daarvan plaasvind, sodat uitgewers nie die verlies van intekeninge waag deur ouer inhoud gratis beskikbaar te stel nie. Dit is die model wat gevolg word deur die NIH- en NSF-beleide wat hieronder bespreek word.

Soos ander inisiatiewe wat poog om die publikasiemodel vir wetenskaplikes te verander, was OA van die begin af omstrede. Die geskiedenis van PubMed Central illustreer dit. Die oorspronklike PubMed Central-voorstel, wat die eerste keer in Maart 1999 gepubliseer is, was vir 'n enkele alles-insluitende databasis wat alle biomediese navorsingsartikels uit tradisionele tydskrifte sowel as voordrukke bevat, alles gratis beskikbaar. Beide dele van die voorstel was omstrede, en toe die PubMed Central-projek in Februarie 2000 aanlyn gegaan het, was dit met 'n baie meer beperkte omvang as wat oorspronklik beplan is. Dit het uit slegs 'n paar joernale bestaan ​​en die idee van die voordrukbediener is heeltemal laat vaar. Vanaf Februarie 2001 was slegs sowat 10 joernale beskikbaar op PubMed Central, maar teen 2013 was meer as 'n duisend joernale ingesluit. Ondanks die vroeë terugslae het OA -ondersteuners voortgegaan, en in April 2008 is die beleid vir openbare toegang toegepas. Dit vereis dat alle navorsing wat gefinansier word deur NIH -toelaes binne 12 maande na publikasie in die openbaar beskikbaar gestel moet word, en in Februarie 2013 is 'n soortgelyke beleid aangeneem wat die NSF en al die ander federale agentskappe raak wat meer as $ 100 miljoen per jaar bestee om navorsing te ondersteun. Skrywers moet óf in tydskrifte publiseer volgens die groen OA -stelsel óf hul artikels in PubMed Central of 'n ander bewaarplek deponeer. Die VSA is nie die enigste land wat belangstel in OA-bewaarplekke nie. Terselfdertyd wat PubMed Central voorgestel is, is die E-BioSci OA-portaal geïmplementeer.

Een van die potensiële voordele van die OA-model wat breedvoerig deur OA-voorstanders voorgehou is, is dat groter beskikbaarheid van gratis artikels tot groter sigbaarheid en gebruik van daardie artikels sal lei. Navorsing wat aanhalingsyfers vir OA- en nie -OA -artikels bestudeer, is gemeng, met die meeste onlangse studies wat slegs 'n beskeie styging in die aanhalingsyfers vir OA -artikels toon (Davis en Walters, 2011 Archambault et al, 2013). Dit bevat vergelykings van OA- en nie-OA-artikels in dieselfde tydskrifte vir gemengde modelle (Davis, 2009).

Nie-Europese en klein Europese lande het vinnig waarde gevind in die OA-model as 'n meganisme om die navorsing wat in hul eie lande uitgevoer word, te bevorder. Een goeie voorbeeld is Brasilië se SciELO (http://www.scielo.org), 'n platform wat meer as 1 000 OA-joernale uit verskeie Suid- en Sentraal-Amerikaanse lande publiseer. Waters en Linville (2011) het bevind dat 27% van die OA -tydskrifte wat hulle bestudeer het, artikels in ander tale as Engels gepubliseer het, en dat die persentasie OA -tydskrifte wat buite Europa en Noord -Amerika gepubliseer is, toegeneem het van 10% in 2005 tot 31% in 2009 Alhoewel dit nie 'n heeltemal geldige vergelyking is nie, vergelyk dit met die 19% van nie-Europese en Noord-Amerikaanse tydskrifte wat in BIOSIS-voorskoue bogenoemde.

Navorsers in die biologiese wetenskappe skep massiewe hoeveelhede data wat toeganklik moet wees om bruikbaar te wees. Die data kan ekologiese data uit langtermynstudies, die besit van museumversamelings, neurowetenskaplike beelde of molekulêre of genetiese rye insluit. Die data is voorheen in artikels of boeke gepubliseer en selde bygewerk, maar met die ontwikkeling van elektroniese joernale en databasisse is hierdie materiaal baie meer toeganklik en makliker om te manipuleer. Molekulêre biologie is 'n goeie voorbeeld van 'n dissipline wat elektroniese publikasie gebruik om nuwe data met 'n multidissiplinêre navorsingsgemeenskap te deel deur middel van elektroniese produksies soos GenBank, PDB (die Protein Data Bank), die Human Genome Project, ensovoorts. Wat uniek is aan hierdie databasisse, is dat data aanvaar word voordat dit in die vaktydskrifliteratuur gepubliseer word, en in werklikheid vereis die meeste tydskrifte dat sekwense by GenBank gevoeg word voordat dit in druk gepubliseer word.

As gevolg van die beskikbaarheid van al hierdie data, het tegnieke om data te vind en met mekaar te verbind een van die vinnigste groeigebiede in die biologie en inligtingswetenskap geword. Bioinformatika, die gebruik van rekenaar- en inligtingwetenskap om biologiese data te ontleed, het in gebruik ontplof. Terwyl die term dikwels gebruik word om net na die ontleding van genomiese of molekulêre biologie-inligting te verwys, het alle areas van biologie wat groot hoeveelhede data skep, hul eie bioinformatika-behoeftes en praktisyns. Die Oop Toegang-beweging het sommige areas van bioinformatika soos teksontginning moontlik gemaak. Artikels wat agter 'n betaalmuur toegesluit is, is nie beskikbaar vir die ontginning van tekste nie, maar abstrakte in PubMed en volledige teks uit OA -tydskrifte. Die volgende stap is om die tydskrifliteratuur met die groot molekulêre biologie databasisse op nuwe en interessante maniere te kombineer.

Al die bogenoemde besprekings van die elektroniese biologiese literatuur fokus op elektroniese tydskrifte en databasisse, 'n maatstaf vir die belangrikheid daarvan vir die biologiese wetenskappe. Elektroniese boeke het stadiger gekom. Die vroegste e-boeke het ensiklopedieë, woordeboeke en handboeke ingesluit. Alhoewel sommige implementerings van elektroniese handboeke nie gewild onder studente was nie, is hul belofte voor die hand liggend. Meer onlangs was monografieë wat tydskrifte naboots deurdat dit bestaan ​​uit individuele hoofstukke wat as aparte artikels optree eerder as 'n samehangende geheel, suksesvol aanlyn, en die meeste uitgewers vervaardig elektroniese weergawes van hul boeke. Een komplikasie is die veelheid van onversoenbare e-boeklesers, hoewel een manier om hierdie probleem te omseil is om wetenskaplike boeke as PDF-lêers van individuele hoofstukke te publiseer. Biblioteke kan inteken op individuele titels of groot of klein boekpakkette, baie soos die berugte Big Deals wat tydskrifuitgewers bied.

Daar is relatief min OA-boeke, maar buite kopiereg kan boeke gesien word as die e-boek-ekwivalent van OA, alhoewel die twee kwessies slegs tangensiaal verwant is. Op hierdie stadium, volgens die Amerikaanse kopieregwetgewing is alle boeke wat voor 1923 gepubliseer is buite kopiereg (ook bekend as in die publieke domein) en kan dit gebruik en herpubliseer word aangesien verlangde boeke wat tussen 1923 en 1989 gepubliseer is, moontlik of nie buite kopiereg is nie en materiaal wat na 1989 gepubliseer is, is byna seker onder kopiereg. Ander lande se kopieregwette verskil, so die kwessie is uiters ingewikkeld en kan wetenskaplike vooruitgang vertraag. Seker die bekendste digitaliseringsprojek is Google se Google Book-projek (http://books.google.com), wat daarop gemik is om al die wêreld se literatuur te digitaliseer, baie probleme ondervind wat met kopiereg verband hou, maar boeke in die publieke domein baie meer toeganklik gemaak het. Die Internet Archive by http://archive.org (ook die tuiste van die Wayback Machine, wat webbladsye argiveer) is nog 'n digitaliseringsprojek, hoewel dit op materiaal in die publieke domein fokus.

Van selfs groter belang vir bioloë, veral taksonome, is die Biodiversity Heritage Library (BHL), wat die doel het om al die biodiversiteitsliteratuur in die wêreld te digitaliseer. Hierdie projek het in 2005 begin en is geskep deur 'n koalisie van groot botaniese tuine, natuurhistoriese museums en universiteite in die VSA en die Verenigde Koninkryk. Een groot voordeel van hierdie projek is om die historiese taksonomiese literatuur (wat kan teruggaan na Linnaeus se publikasies) wyer beskikbaar te maak vir plaaslike taksonome wat nie maklike toegang tot die groot Amerikaanse en Europese institusionele biblioteke het nie, wat moontlik die enigste kopieë van seldsame taksonomiese werke. Die BHL-rekords voer in die Ensiklopedie van die lewe, 'n projek wat daarop gemik is om 'n webblad vir elk van die ongeveer 1,8 miljoen spesies organismes te produseer (sien Hoofstuk 3).

Alhoewel niemand die toekoms van die biologiese literatuur kan lees nie, is dit veilig om te sê dat dit vinnig sal aanhou groei, en dat terwyl ewekniebeoordeling sal voortgaan, nuwe formate wat die beste van die gedrukte wêreld en die nuwe elektroniese wêreld saamsmelt, sal ontstaan. Uitgewers, skrywers en bibliotekarisse sal voortgaan om te worstel met kwessies rakende Open Access en tydskrifpryse.

Bibliografie

Archambault, Eric, et al. (2013). Aandeel van ooptoegang portuurbeoordeelde referate op Europese en wêreldvlak—2004-2011. http://www.science-metrix.com/pdf/SM_EC_OA_Availability_2004-2011.pdf.

Davis, P. M. (2009). Outeur-keuse ooptoegang-publisering in die biologiese en mediese literatuur: 'n Aanhalingsanalise. Tydskrif van die Amerikaanse Vereniging vir Inligtingwetenskap en Tegnologie 60(1):3-8.

Davis, P.M. en W.H. Walters. (2011). Die impak van vrye toegang tot die wetenskaplike literatuur: 'n oorsig van onlangse navorsing. Tydskrif van die Mediese Biblioteekvereniging 99(3): 208-217.

Walters, W. H. en A. C. Linvill. (2011). Kenmerke van ooptoegang-joernale in ses vakgebiede. Kollege- en navorsingsbiblioteke 72(4): 372-392.


Mikrobiese agteruitgang van forensiese monsters van biologiese oorsprong: potensiële bedreiging vir menslike DNA-tipering

Forensiese biologie is 'n subdissipline van biologiese wetenskap met 'n amalgaam van ander takke van wetenskap wat in die strafregstelsel gebruik word. Enige kernsel/weefsel wat DNS bevat, hetsy lewend of dood, kan as forensiese uitstallings gebruik word, 'n bron van ondersoek deur DNS-tipering. Hierdie biologiese materiale van menslike oorsprong is 'n ryk bron van proteïene, koolhidrate, lipiede, spoorelemente sowel as water en bied dus 'n deugsame milieu vir die groei van mikrobes. Die hardnekkige mikrobiese groei verhoog die afbraakproses en word versterk met die verloop van tyd en onbehoorlike berging van die biologiese materiaal. Degradasie van hierdie biologiese materiaal dra 'n groot uitdaging in die stroomafwaartse prosesse van forensiese DNS-tiperingstegniek, soos kort tandem-herhalings (STR) DNS-tipering. Mikrobiese agteruitgang lewer onbehoorlike of geen PCR-amplifikasie, heterosigotiese piekwanbalans, DNA-besmetting uit nie-menslike bronne, afbraak van DNA deur mikrobiese byprodukte, ens. Gevolglik word die mees presiese STR DNA-tiktegniek vernietig en kan beslis nie 'n definitiewe mening gegee word nie met gedegradeerde forensiese uitstallings. Geskikte voorsorgmaatreëls moet dus getref word vir behoorlike berging en verwerking van die biologiese uitstallings om hul verrottingsproses deur mikro-organismes te minimaliseer.

Dit is 'n voorsmakie van intekeninginhoud, toegang via u instelling.


Resultate

Vier geldige spesies van die genus Adialytus, sowel as twee bykomende fenotipes: “Adialytus arvicola” (Ster ý) en “Adialytus vgl. dubbelsinnig” (Haliday) (Tabel 1) is versamel en geïdentifiseer in samewerking met 14 plantluisspesies op 15 gasheerplante. Baie eksemplare van Adialytus ambiguus (Haliday) was inkonsekwent anders as ondersoekde monsters wat in ander lande ontstaan ​​het. Ons het hierdie monsters as “ gekategoriseerAdialytus vgl. dubbelsinnig”. Adialytus veronicaecola (Starý) en “Adialytus arvicola” (Star ý) word opnuut uit Iran opgeneem. Laasgenoemde spesie is van gekweek Sipha plantluise wat ook die spesifieke gashere vir was Adialytus ambiguus. Ons het beduidende verskille tussen die Adialytus ambiguus en “Adialytus arvicola” fenotipe, gebaseer op die karakters van voorvlerk, vlagsegmente, agterpote, blaarsteel (Tabel 2) en kleur. Daarbenewens, 'n vergelyking met tipe monsters van Adialytus arvicola uit die Tsjeggiese Republiek (Starý 1961a) het die bestaan ​​van sterk verskille duidelik bevestig.

Tabel 1.

'n Lys van plantluis-parasitiese assosiasies.

Plantluis familiePlantluisspesiesParasitoïede spesies
ChaitophorineSipha maydis Passerini Adialytus vgl. dubbelsinnig (Haliday)Adialytus arvicola (Starý)
Sipha elegans del Guercio Adialytus ambiguus (Haliday)Adialytus vgl. dubbelsinnig (Haliday)Adialytus arvicola (Starý)
Sipha flava (Forbes) Adialytus arvicola (Starý)
Chaitophorus spp. Adialytus salicaphis (Fitch)
ThelaxinaeThelaxes suberi (deur Guercio) Adialytus thelaxis (Starý)
AphidiinaeAphis craccivora Koch Adialytus veronicaecola (Starý)ϋr/>
Aphis gossypii Glover
Aphis sp.

Tabel 2.

Die morfometriese en meristiese data vir verskillende karakters van Adialytus spesie (Wyfie) in Iran.

F1 † l/w F2 l/wF3 l/wF4 l/wF1/F2 lengteF1/F3 lengteF1/F4 lengteF1LP § F2LPPt # l/wR1 § § /Pt lengteSetae op ClypeusPetiool l/wOvipo-sitor-skedel/w
Adialytus ambiguus2.10 𠄲.302.40𠄲.601.90𠄲.101.80𠄲.001.00𠄱.100.90𠄱.000.90 𠄱.0001𠄲2.90 𠄳.001.30𠄱.404𠄵1.80 𠄲.002.90 𠄳.20
Adialytus vgl. dubbelsinnig2.60𠄲.852.70 𠄲.902.70𠄲.851.80𠄲.000.90 𠄱.000.90𠄱.100.90 𠄱.100𠄱2𠄳2.85 𠄳.100.90𠄱.104𠄵1.80 𠄲.002.80 𠄳.20
Adialytus arvicola2.50𠄲.802.10 𠄲.452.20𠄲.401,70𠄱,900.90 𠄱.100.90 𠄱.100.95 𠄱.200𠄱2𠄴3.00 𠄳.200.70 𠄰.806 𠄸2.00𠄲.202.80𠄳.10
Adialytus salicaphis2.70 𠄲.902.60 𠄲.902.50𠄲.802.30 𠄲.501.00𠄱.200.90 𠄱.101.00 𠄱.203𠄵3𠄵3.25𠄳.350.90𠄱.008�2.20𠄲.402.40 𠄲.50
Adialytus thelaxis1.60 𠄱.701,50𠄱,601,50𠄱,601,60𠄱,701.00𠄱.201.00𠄱.200.90 𠄱.103𠄵4𠄶2.80𠄳.100.90𠄱.008�1.80𠄲.002.60 𠄲.70
Adialytus veronicaecola2.00 𠄲.201.90𠄲.001.90 𠄲.002.05𠄲.151.00𠄱.101.00𠄱.101.00𠄱.100𠄱0𠄱3.00𠄳.200,60𠄰,706 𠄸1.90𠄲.202.15𠄲.30

† : F1�: Flagellomers 1𠄴 ‡ l/w: Lengte / breedte verhouding § LP: Longitudinale plakodes § § R1: Radiale aar 1 (= metakarpus) # : Pterostigma

Sleutel tot Adialytus spesies in Iran (gebaseer op volwasse wyfies)

1Ovipositor skede aansienlik verleng, lengte/breedte verhouding van 2.80𠄳.20 (Figuur 6A𠄼) 2
Ovipositor skede dik, lengte/breedte verhouding van 2.20𠄲.70 (Figuur 6D𠄿) 4
2Aar R1 (= metakarpus) van voorvlerk 0.7𠄰.8 × so lank as pterostigma (Fig 3C)Adialytus arvicola” (Starý)
Die aar R1 van die voorvlerk is ongelyk (Fig 3B) of aansienlik langer (Fig 3A) as pterostigma3
3Aar R1 van voorvlerk 1.3𠄱.4 × so lank soos pterostigma, bereik die toppunt van vlerk (Fig 3A)Adialytus ambiguus (Haliday)
Aar R1 van voorvlerk 0.9𠄱.1 × so lank soos pterostigma, bereik nie die toppunt van vlerk nie (Fig 3B)Adialytus vgl. dubbelsinnig ” (Haliday)
4Vlagsegmente (Fig 2E) subkwadraat, effens langer as hul maksimum breedte, l/w verhouding van 1,5𠄱,6. Flagellêre segmente (Fig. 2E) en agterste femur (Fig. 4E) bedek met lang en algemeen opgestelde setae. Ovipositor skede skerp hoekig (Fig 6E) Adialytus thelaxis (Starý)
Vlagsegmente (Figuur 2D, 2F) silindries, aansienlik langer as hul maksimum breedte, l/w verhouding van 2.0 𠄲.9.Vlagsegmente en agterste femur bedek met aangedrukte (Figuur 2F, 4F) of semi-regop (Figuur 2D, 4D) setae. Ovipositor-skede rondhoekig (Figuur 6D, 6F) 5
5Eerste metasomale tergiet (bladsteel) langwerpig, 2.2 x020132.4 × so lank as wyd op spirakels (figuur 5D). Vlagsegmente bedek met oorwegend semi-regop setae wat gelyk is aan deursnee van segment. Flagellomere 1 met 3 en#x020134 langsplasodes (figuur 2D). Agterste femur bedek met oorwegend semi-opgerigte setae (Fig 4D)Adialytus salicaphis (Fitch)
Eerste metasomale tergiet (blaarstel) kort, 1,9𠄲.1X so lank as wyd by spirakels (Fig 5F). Vlagsegmente bedek met aangedrukte setae wat duidelik korter is as deursnee van segment. Flagellomer 1 met 0𠄱 longitudinale plakode (Fig 2F). Agterste femur bedek met kort saamgedrukte setae (Fig. 4F) Adialytus veronicaecola (Starý)

Lys van Adialytus spesies en hul gasheerverenigings

Adialytus dubbelsinnig

Antenne van Adialytus spesies A Adialytus ambiguus B Adialytus vgl. dubbelsinnig C Adialytus arvicola D Adialytus salicaphis E Adialytus thelaxis F Adialytus veronicaecola.

Voorvleuel van Adialytus spesies A Adialytus ambiguus B Adialytus vgl. dubbelsinnig C Adialytus arvicola D Adialytus salicaphis E Adialytus thelaxis F Adialytus veronicaecola.

Agterbeen van Adialytus spesies, uitgesluit tarsomere A Adialytus ambiguus B Adialytus vgl. dubbelsinnig C Adialytus arvicola D Adialytus salicaphis E Adialytus thelaxis F Adialytus veronicaecola.

Petiool of eerste metasomale tergiet van Adialytus spesies A Adialytus ambiguus B Adialytus vgl. dubbelsinnig C Adialytus arvicola D Adialytus salicaphis E Adialytus thelaxis F Adialytus veronicaecola.

Vroulike geslagsdele van Adialytus spesies A Adialytus ambiguus B Adialytus vgl. dubbelsinnig C Adialytus arvicola D Adialytus salicaphis E Adialytus thelaxis F Adialytus veronicaecola.

Aphidius ambiguus Haliday, 1834: 104�.

Materiaal ondersoek.
Kommentaar:

Hierdie spesie is nou verwant aan ander parasitoïede van Sipha plantluise, in sy langwerpige ovipositor -omhulsel (Fig. 6A) en driehoekige vorm van die blaarsteel wat anterior en spiraalvormige knolle dra (Fig. 5A). Dit kan van ander spesies onderskei word deur 'n baie lang aar R1 (= metacarpus) (Fig. 3A). Die agterste femur en tibia is bedek met beide kort en algemeen regop lang setae (Fig. 4A).

Adialytus dubbelsinnig

Materiaal ondersoek.

22♂ 20♀,Sipha maydis Passerini aan Bromus tectorum, NK, Gharemeidan (37뀥'42"N, 56뀳'19"E, 1544 m), 14.V.2008, 15 ♂ 18 ♀, coll. S. Kazemzadeh Sipha elegansdel Guercio aan Gastridium phleoides, IS, Nazhvan (32뀸'25"N, 51뀵'48"E, 1582 m), 05.IX.2011, 7 ♂ 2 ‌ ♀, coll. E. Nader.

Kommentaar.

Die monsters hardloop gewoonlik na Adialytus ambiguus volgens die algemene karakters van die eerste metasomale tergiet (Figuur 5B), ovipositorskede (Figuur 6B), die flagellomere (Figuur 2B) en die setae op die agterste femur (Figuur 4B). Dit kan onderskei word van Adialytus ambiguus deur die korter aar R1 wat 0,9 𠄱.1 × is, so lank as pterostigma te hê wat nie die toppunt van die voorvleuel bereik nie (Fig. 3B). Dit kan geskei word van Adialytus arvicola (Fig 3C), deur sy langer aar R1.

Adialytus arvicola

Materiaal ondersoek.

38♂ 63♀, Sipha flava(Forbes) op ‌Agropyrum repens, KE, Kermanshah (34 뀙'33 "N, 47 뀅'53" E, 1322 m), 25.VI.2011, 22 ‌ ♂ 55 ‌ ♀, coll. Y. Nazari Sipha maydisPasserini aan Avena fatua, KE, Kermanshah (34 뀙'33 "N, 47 뀅'53" E, 1322 m), 11.VI.2011, 2♂, kol. Y. Nazari aan Bromus tectorum, KE, Sanandaj (35 뀗'52 "N, 46 끙'59" E, 1517 m), 16.V.2005, 1♂, kol. E. Rakhshani op Cynodon dactylon, KN, Kerman (30뀔'28"N, 57뀇'20"E, 1775 m), 22.XI.2007, 6♂ 2♀, kol. H. Barahoei aan Sorghum halepense, KE, Kermanshah (34뀙'35"N, 47뀆'00"E, 1320 m), 11.VI.2011, 2 ‌ ♂ 3 ‌ ♀, vers .: Y. Nazari Sipha elegans del Guercio aan Triticum aestivum, KR, Mashhad (36 뀕'22 "N, 59 뀨'42" E, 1164m), 12.IV.2012, 5 ♂ 3 ♀, coll. J. Karimi.

Kommentaar.

Oor die algemeen kan hierdie spesie met ander verwar word Adialytus spesie aan Sipha plantluise, maar dit kan onmiddellik onderskei word deur sy baie kort aar R1 (0,7 𠄰.8 × so lank as pterostigma) (figuur 3C). Sy blaarsteel het ook baie sterker anterior en spirakulêre tuberkels (Fig 5C). Die meeste van die metasoma is gelerig, terwyl in ander Adialytus spesie dit is eenvormig bruin tot donkerbruin.

Adialytus salikaphis

Trioxys salicaphis Fitch, 1855: 841.

Materiaal ondersoek.

138♂ 223‌♀, Chaitophorus euphraticus Hodjat aan Populus euphratica, SB, Zahedan (29뀣'27"N, 60끈'49"E, 1498 m), 24.III.2003, 3 ♂ 7 ‌ ♀, coll. E. Rakhshani Chaitophorus remaudierei Pintera aan Salix alba, KD, Marivan (35뀱'33"N, 46뀉'21"E, 1293 m), 08.X.2004, 4♂ 6‌♀, versamel. E. Rakhshani Chaitophorus salijaponicus niger Mordvilko aan Salix alba, FA, Sepidan (30뀕'55"N, 51끘'43"E, 2244 m), 23.V.2009, 7 ♂ 9 ‌ ♀, coll. S. Taheri NK, Shirvan, 24.VI.2008, 32 ♂ 54 ♀, coll. S. Kazemzadeh NK, Esfarayen (37뀅'12"N, 57뀰'39"E, 1293 m), 17.V.2008, 8♂ 13♀, kol. S. Kazemzadeh Chaitophorus populialbae (Boyer de Fonscolombe) op Populus alba, AL, Karadj (35끄'45"N, 51뀐'07"E, 1296 m), 09.X.2002, 16 ♂ 29 ♀, coll. E. Rakhshani Chaitophorus populeti(Panzer) aan Populus nigra, TH, Teheran (35 끇'52 "N, 51 뀤'08" E, 1650 m), 09.XI.2002 32♂ 48♀ kol. E. Rakhshani Chaitophorus leucomelasKoch aan Populus nigra, KN, Lalezar (29뀱'05"N, 56끈'59"E, 2845 m), 09.X.2007, 5♂ 15♀, versamel. H. Barahoei AL, Karadj (35 끕'06 "N, 51 뀅'04" E, 1875 m) 27.VI.2003 11♂ 18♀, kol. E. Rakhshani op Populus sp. FA, Sepidan (30뀕'55"N, 51끘'43"E, 2244 m), 22.V.2009, 8♂ 12♀, versamel: S. Taheri Chaitophorus vitellinae(Schrank) aan Salix alba, MA, Mahallat (33 끓'12 "N, 50 뀧'31" E, 1652 m), 22.IV.2005, 5 ♂ 4 ♀, coll .: E. Rakhshani Chaitophorussp., aan Populus alba, NK, Shirvan (37뀣'35"N, 57끔'40"E, 1082 m), 24.V.2008, 7 ♂ 8 ♀, coll. S. Kazemzadeh.

Kommentaar.

Adialytus salicaphis verskil van ander afstammelinge deur baie langwerpige eerste metasomale tergiet (blare) (Figuur 5D), en kort en digte marginale setae van die voorvlerk (Fig 3D). Dit kan ook onderskei word van Adialytus arvicola volgens die aantal longitudinale plakodes op flagellomeer 1 (3𠄵 in Adialytus salicaphis vs. 0𠄱 duim Adialytus arvicola). Die monsters van Adialytus salicaphis geassosieer met Salix spp., veral dié wat van Chaitophorus salijaponicus niger op Salix alba, was effens anders as die monsters waaruit grootgemaak is Chaitophorus spp. op Populus. Die groot verskille was die mindere aantal setae op die clypeus (4𠄵 vs. 8�), minder longitudinale plakodes op die eerste flagellomeer (1𠄲 vs. 3𠄵) en oorwegend op die aangedrukte en kort vlagsetellomere agter femur in vergelyking met die lang semi-regop tot regop setae onder die kort setae in eksemplare van Populus.

Adialytus laxis

Materiaal ondersoek.

11♂ 26♀, Thelaxes suberi (del Guercio) aan Quercus sp., GN, Rasht (37뀗'24"N, 49뀵'43"E, -4 m), 24.V.2004, 4 ♂ 3 ♀, vers .: E. Rakhshani op Quercus castanifolia, GL, Gorgan (36 끇'33 "N, 54 뀧'02" E, 340 m), 06.IV.2010, 7♂ 23♀, kol. A. Sargazi.

Kommentaar.

Hierdie spesie kan maklik van ander afstammelinge geskei word deur hoofsaaklik regop lang setae op die flagellomere (Figuur 2E) en die agterste femur (Figuur 4E) te hê. Die setae op die postero-dorsale aspek van die blaarsteel is soortgelyk (Fig 5E). Daarbenewens, Adialytus thelaxis is die enigste spesie met 'n skerppuntige ovipositor-skede (Fig 6E).

Adialytus veronicaecola

Lysiphlebus veronicaecola Starý, 1978: 528�.

Materiaal ondersoek.

2♂ 3♀, Aphis craccivoraKoch aan Phaseolus vulgaris, IS, Flavarjan (32뀰'56"N, 51뀩'02"E, 1618 m), 2♀, kol. E. Nader Aphis sp. op Rubia tinctorum, IS, Mobarakeh (32뀰'56"N, 51뀰'17"E, 1658 m), 13.XI.2010, 1 ♂ 1 ♀, coll. E. Nader Aphis gossypiiGlover aan Cucurbita pepo, IS, Ghahderijan (32뀶'18"N, 51뀨'25"E, 1611 m), 05.XI.2010, 1♂, kol. E. Nader.

Kommentaar.

Hierdie spesie is uniek in die sin dat dit uit geteel is Aphis spesies. Volgens die algemene karakters van die voorvleuel (Fig. 3F), blaarsteel of eerste metasomale tergiet (Fig. 5F) en die ovipositor -skede (Fig. 6F) is dit nou verwant aan Adialytus salicaphis waarvan dit onmiddellik onderskei kan word deur oorwegend kort en aangedrukte setae op die flagellomere (Figuur 2F) en agter femur (Figuur 4F). Dit kan ook onderskei word van Adialytus salicaphis deur minder longitudinale plakodes op flagellomere 1 en 2 te hê (0𠄱 in Adialytus veronicaecola vis 3 𠄵 in Adialytus salicaphis). Daarbenewens, Adialytus veronicaecola verskil van die ander spesies deur 'n stewige ovipositor-skede te hê met 'n sterk konvekse postero-dorsale buitelyn (Fig. 6F).


Materiaal en metodes

'n Meer gedetailleerde beskrywing kan gevind word in Aanvullende Eksperimentele Prosedures.

Diere

Wild-tipe vroulike C57BL/6 muise is geteel in twee verskillende omgewings (Kamer 1 en Kamer 2) in dieselfde SPF-eenheid wat óf 'n standaard chow dieet gevoer het (Kos A: R34), Labfor, Lactamin, Stockholm, Swede) of 'n outoklaafdieet (Food B: 5021 Labdiet ®, IPS, London, UK via Opend, Herfolge, Denemarke). Kiemvrye muise is gekoloniseer met keelflora van muise in die twee kamers en behandel as konvensionele diere 53. Wilde vrylewende huismuise (Mus musculus) is lewend in suidoos-Noorweë gevang met behulp van Ugglan-valle (Grahnab, Gnosjö, Swede), goedgekeur deur die Noorse Omgewingsagentskap, en direk na die Universiteit van Göteborg vervoer, goedgekeur deur die Sweedse Landbouraad. Alle proefprosedures vir diere is uitgevoer in ooreenstemming met die Sweedse wet op welsyn van diere en goedgekeur deur die Sweedse laboratorium vir etiese diere in Göteborg.

Monsterversameling vir mikrobiota-analise

Deur skoon, steriele disseksie -gereedskap te gebruik, is die ileum (slegs Si8), distale kolon en caecum verwyder. Die lumeninhoud van Si8 en distale kolon is verwyder deur die derminhoud in 'n versamelbuis saggies uit te druk. Die dermsegment is dan liggies met 2 × 1 ml steriele PBS gespoel. Die weefsel is beskou as die slymmonster. Die monsters is onmiddellik in vloeibare stikstof gevries en later by -80°C gestoor tot ontleding.

DNA onttrekking

DNA is onttrek en gehomogeniseer met 'n FastPrep ® -24 -instrument (MP Biomedicals) en daarna met lisosiem behandel en neergeslaan. Die opgeloste DNA is behandel met RNase A (Qiagen) en proteïenase K in Buffer AL (Qiagen). Die DNA is met behulp van QIAamp DNA mini kit (Qiagen) onttrek.

16S rRNA-geenmerker pirosevolgordebepaling en volgorde-analise

Bakteriële 16S rRNA-geenvolgordes is vanaf elke monster geamplifiseer deur die primers 27F (5′ AGAGTTTGATCCTGGCTCAG 3′) met Titanium Adapter B en 338R (5′ TGCTGCCTCCCGTAGGAGT 3′) met Titaan-spesifieke strepieskode-volgorde bestaande uit titanium-spesifieke strepieskode-aanpassing A en 'n monster-nucleott-teikenvolgorde te gebruik. die V1–V2 hiperveranderlike gebied van die 16S rRNA geen met behulp van FastStart Taq DNA Polimerase (Roche). Drievoud PCR's is uitgevoer vir elke monster wat saamgevoeg en gesuiwer is met AMPure krale (Becton Dickinson). Die monsters is geamplifiseer in PCR-mengsel-in-olie-emulsies en in volgorde van die 338r-primer gerangskik deur Roche 454 FLX en Titaanchemie (Roche) by die Science for Life Laboratories (Solna, Swede) te gebruik. Na-verwerking van pyrosequencing-data is gedoen met behulp van QIIME sagteware 1.7.0 pakket 54. Die rye is aan operasionele taksonomiese eenhede (OTU's) toegeken deur UCLUST 55 te gebruik. Die lesings is in lyn gebring met die Greengenes Core verwysingsbelyning deur PyNAST 56 te gebruik. Die GG-taksonomieë is gebruik om opsommings te maak van die taksonomiese verspreidings van OTU's oor verskillende vlakke (filum, orde, familie, genus en spesies) 'n Filogenetiese boom is gebou met FastTree 57 en gebruik vir ramings van α-diversiteit (Rarefaction curves, Chao1 58, Shannon diversiteit 59 ) en β-diversiteit (met gebruik van ongeweegde UniFrac 20 .

Slymmetings

Die dikte van die dermslym is gemeet soos voorheen beskryf 21 60 . Slymdeurdringbaarheid is gemeet soos voorheen beskryf 15 21 .

Weefselfiksasie en immunokleuring

Stukke ileum of kolon met fekale materiaal is in Carnoy (metanol) gefixeer en bakteriese FISH en immunokleurings is gedoen met MUC2C3 antisera 14 , apoMuc2 antisera 61 of Anti-Ki67 teenliggaampie (ab16667, Abcam) en DNA deur Hoechst 34580 (Life-tegnologie) as voorheen beskryf 14 . Die afdelings is ontleed vir kriplengte, aantal lamina propria-selle, aantal bekerselle en aantal Ki67-positiewe selle.

Proteomiese analise van slymmonsters

Die slymmonsters wat na diktemetings verwyder is, is opgelos in 'n guanidinium hidrochloried-gebaseerde buffer en verwerk deur die FASP metode soos voorheen beskryf. Die monsters is ontleed deur nano-omgekeerde fase vloeistofchromatografie (nRPLC) gekoppel aan elektrosproei-ionisasie-tandem massaspektrometrie (ESI-MS/MS) in 'n LTQ-Orbitrap XL (Thermo Scientific) 62 . Data van die MS/MS-eksperimente is met die MaxQuant 1.2.2.5-sagteware 63 ontleed. Relatiewe proteïenhoeveelhede is in dpm gekwantifiseer deur intensiteit-gebaseerde absolute kwantifisering (iBAQ) 64 .

Statistiese analise

Vir alle slym-, histologie- en immunokleurmetingsdata is ontleed met behulp van 'n tweestert Mann-Whitney U-toets. Vir die mikrobiota-analise is beduidende verskille met die Wilcoxon-rangsom-toets, en P-waardes is omgeskakel na vals ontdekkingskoerswaardes (V-waardes) om reg te stel vir veelvuldige toetsing in die R-sagteware (http://www.r-project.org/).

Beskikbaarheid van data

Die data agter die grafieke word in 'n brondatalêer by http://embor.embopress.org/ aangebied. Mikrobiota 16S rDNA-volgordedata is in die ENA-volgorde-leesargief gedeponeer onder toegangsnommer PRJEB7982 (http://www.ebi.ac.uk/ena/data/view). Die massaspektrometrie-proteomika-data is by die ProteomeXchange-konsortium (http://proteomecentral.proteomexchange.org) gedeponeer via die PRIDE-vennootbewaarplek 65 met die datastel-identifiseerder PXD001479.


Die Hersiene Taksonomie (2001)

'N Groep kognitiewe sielkundiges, kurrikulumteoretici en onderrignavorsers en toets- en assesseringspesialiste publiseer in 2001 'n hersiening van Bloom ’s Taxonomy met die titel 'n Taksonomie vir Onderrig, Leer en Assessering. Hierdie titel trek die aandag weg van die ietwat statiese opvatting van “opvoedkundige doelwitte” (in Bloom’ se oorspronklike titel) en wys op 'n meer dinamiese opvatting van klassifikasie.

Die skrywers van die hersiene taksonomie onderstreep hierdie dinamiek deur werkwoorde en gerunds te gebruik om hul kategorieë en subkategorieë te benoem (eerder as die selfstandige naamwoorde van die oorspronklike taksonomie). Hierdie “aksiewoorde” beskryf die kognitiewe prosesse waardeur denkers kennis ontmoet en daarmee werk:

  • Onthou
    • Herken
    • Herinner
    • Tolk
    • Voorbeeld
    • Klassifikasie
    • Opsomming
    • Afleidend
    • Vergelyk
    • Verduidelik
    • Uitvoer
    • Implementering
    • Onderskei
    • Organiseer
    • Toeskryf
    • Nagaan
    • Kritiseer
    • Genereer
    • Beplanning
    • Produksie

    In die hersiene taksonomie is kennis aan die basis van hierdie ses kognitiewe prosesse, maar die skrywers daarvan het 'n aparte taksonomie geskep van die tipes kennis wat in kognisie gebruik word:

    • Feitelike kennis
      • Kennis van terminologie
      • Kennis van spesifieke besonderhede en elemente
      • Kennis van klassifikasies en kategorieë
      • Kennis van beginsels en veralgemenings
      • Kennis van teorieë, modelle en strukture
      • Kennis van vakspesifieke vaardighede en algoritmes
      • Kennis van vakspesifieke tegnieke en metodes
      • Kennis van kriteria om te bepaal wanneer toepaslike prosedures gebruik moet word
      • Strategiese Kennis
      • Kennis oor kognitiewe take, insluitend toepaslike kontekstuele en voorwaardelike kennis
      • Selfkennis

      Mary Forehand van die Universiteit van Georgia bied 'n gids vir die hersiene weergawe met 'n kort opsomming van die hersiene taksonomie en 'n nuttige tabel van die ses kognitiewe prosesse en vier tipes kennis.


      Beskrywings

      Volgens Kew Species Profile

      Cuscuta epithymum is 'n wortellose, geheel en al parasitiese plant wat die algemeenste op heide (Calluna vulgaris), gorse (Ulex europaeus) en klawer (Trifolium) spesies. Klawerdodder is inheems aan Europa, maar kom byna wêreldwyd voor. Dit is 'n lid van die Convolvulaceae -familie, wat insluit Ipomoea en Convolvulus spesies, waarvan baie algemeen bekend staan ​​as bindweed en morning glory. Klawerdodder word normaalweg deur insekte bestuif, maar kan ook selfbestuif. Studies het getoon dat blomme deur baie verskillende insekte besoek word, insluitend miere, bye en wespies.

      Soort Profiel Aardrykskunde en verspreiding

      Alhoewel klawerblaar inheems in Europa is, het dit sedertdien oor ses kontinente versprei, wat dit byna wêreldwyd voorkom. Die genus Cuscuta kom nie op hoë breedtegrade in die Noordelike Halfrond of in woestyngebiede van Afrika en Asië voor nie. Klein, afgeleë eilande soos die Galapagos-eilande het ook nie spesies van hierdie genus nie. Die bekendstelling van klawerdodder na nie-inheemse gebiede kan volg op onbedoelde invoer van sade van C. epithymum in voergewasse.

      Oorsig: Clover dodder is 'n wortellose, parasitiese plant waarin blare tot klein skubbe verminder word. Die stamme is haarloos, draadagtig (0,25-0,40 mm dik) en kan geel, rooi of pers wees.

      Blomme: Trosse van 7-25 stingelslose, perserige blomme word in 'n kompakte bol gerangskik. Blomme is 2,5-3,0 mm lank en het vyf kelkblare en blomblare. Die kelkblare kom saam om 'n kelkvorm te vorm, elke individuele kelkblaar is langer as wat dit wyd is. Die kroonbuis ('n buisvormige struktuur wat gevorm word wanneer alle kroonblare in 'n blom verenig word) is langer as die koppievormige kelkblaarsamestelling. Meeldrade (manlike dele) steek uit die blomme en het ovaalvormige helmknoppe (stuifmeeldraende dele). Binne blomme strek die styl (vroulike struktuur) van die bokant van die eierstok af en is gewoonlik so lank as die eierstok.

      Vrugte: Die vrug is 'n sferiese kapsule wat langs sy omtrek oopmaak en bo-op die verdorde kroonblare. Elke kapsule bevat vier klein saadjies van ongeveer 1 mm in deursnee.

      Daar is ses variëteite van Cuscuta epithymum , wat onderskei word deur verskille in hul blomstruktuur, sowel as die aantal blomme en hoe hulle gegroepeer is.

      Inval van die gasheerplant

      Klawer dodder sade ontkiem April-Julie in reaksie op seisoenale temperatuur veranderinge. 'N Geswelde, wortelagtige orgaan kom uit die saad, maar kan slegs 'n paar dae oorleef en moet dus vinnig 'n gasheerplant vind. Wanneer 'n gasheer gevind word, groei klawerdodder 'n suier wat daaraan heg. Die wortelagtige orgaan verdor dan en klawerblaar groei steeds met behulp van voedingstowwe wat uit die gasheerplant deur die suier gesteel word.

      Selle van die suier produseer 'n kleefstof wat as 'n effektiewe gom werk. Binne die weefsel van die suier ontwikkel 'n indringende orgaan (haustorium) en dring direk deur die gasheerweefsel om 'n brug tussen gasheer en parasiet te skep. Hierdie direkte kontak maak vinnige groei moontlik en is een van die redes hiervoor Cuscuta spesies is die vinnigste groeiende parasitiese plante.

      Klawer dodder stingels wind linksom om die gasheerplant soos dit groei. Nuwe haustoria (organe wat die gasheerweefsel binnedring) ontwikkel naby mekaar oral waar die dodderstam stywe spoele produseer terwyl dit teen die gasheerplant klim. Hierdie stywe spoele word afgewissel met losser spoele wat soek na nuwe gasheertakke of nuwe gashere om te parasiteer. Omvang van groei hang af van die klawerdodder se verenigbaarheid met die gasheer en groeikragtigheid van die gasheerplant.

      Wanneer dit op meerjarige gashere groei, Cuscuta epithymum veroorsaak die vorming van galblare (groei van gasheerweefsel) waar parasitiese weefsel kan oorwinter. Die volgende lente ontwikkel nuwe klawerdodderplante uit hierdie galle.

      In Noordwes Europa, Cuscuta epithymum floreer op heideveld wat 0-3 jaar oud is. Versteuring as gevolg van grassny, brand of sny van heide help die ontkieming van klawerdoddersade. Europese droëheide word gewoonlik op 'n rotasiebasis bestuur, wat 'n hoë vlak van biodiversiteit handhaaf. Klawer dodder sade kan dormant lê, wat die ontkiemingspotensiaal oor 'n paar jaar uitbrei, en dit is van kardinale belang vir die volharding van hierdie spesie. Op hierdie manier kan dit 'n 'saadbank' in die grond opbou om die dinamiese aard van bestuurde heide te hanteer. As 'n heide egter vir 'n lang tyd onbeheerd bly, of as die saadbanke te klein is of nie lank genoeg lewensvatbaar is vir suksesvolle herstel nie, kan plaaslike uitsterwing van klawerblaar voorkom.

      Klawerdodder word in tradisionele medisyne gebruik as 'n purgeermiddel en om siektes van die lewer, milt en urienweg te behandel. Daar is egter min wetenskaplike ondersoek na die werklike doeltreffendheid van die gebruik daarvan.

      Millennium Saadbank: Saadberging

      Die Millennium Seed Bank -vennootskap het ten doel om plantlewe wêreldwyd te red, met die fokus op plante wat bedreig word en dié wat in die toekoms die meeste gebruik sal word. Saad word in ons saadbankkluis gedroog, verpak en teen 'n temperatuur onder nul gestoor.

      Twee versamelings van Cuscuta epithymum sade word gehou in Kew's Millennium Seed Bank gebaseer by Wakehurst in Wes-Sussex.

      Sien Kew's Seed Information Database vir verdere inligting oor C. epithymum sade

      Klawerdodder word tans nie by Kew aangeteken nie, maar die verwante spesie Cuscuta europaea (groter dodder) kan gesien word hoe groei Scutellaria altissima (lang kopbeen) in die Plantfamiliebeddings by Kew.

      Gedroogde en geesbewaarde eksemplare van C. epithymum word in Kew's Herbarium gehou waar dit op afspraak vir navorsers beskikbaar is. Die besonderhede van sommige van hierdie eksemplare, insluitend beelde, kan aanlyn gesien word in Kew's Herbarium Catalog.

      Monsters van die blomme en sade van C. epithymum , sowel as eksemplare daarvan wat op heide groei, word in Kew's Economic Botany Collection in die Sir Joseph Banks-gebou gehou, waar dit op afspraak aan navorsers beskikbaar is.

      Britse virtuele herbariumprojek

      Cuscuta epithymum is een van 50 spesies op die lys van die Botanical Society of the British Isles (BSBI) Threatened Plants Project -lys. Die herbariummonsters van hierdie spesies word gedigitaliseer as deel van die UK Virtual Herbarium Project.

      Vind uit hoe jy in hierdie projek kan help deur die [email protected] te besoek

      Ekologie Algemeen in versteurde gebiede, veral versteurde heideveld ook in grasveld. Conservation Vulnerable (VU) in Groot -Brittanje volgens die IUCN Rooilys kriteria, maar wêreldwyd algemeen. Gevare


      Biologie van Amaranths.

      Amaranthus is 'n kosmopolitiese genus van eenjarige of kortlewende meerjarige plante (Dorling, 2008), insluitend mak en bedreigde spesies, beperkte endemies en wydverspreide onkruide (Sauer, 1950), wat algemeen na verwys word as 'Amaranths' of 'Pigweeds' (Bensch) et al., 2003). Die genusnaam, Amaranthus, kom van die Griekse woord "amarantos", ([frase weggelaat]) wat "onverwelk", "onsterflik", "ewig" of "nie-verwelkend" beteken, in die lig van die feit dat sy blomme n lang tyd.

      Daar is berig dat die genus Amaranthus uit 87 spesies bestaan, waarvan 14 in Australië, 17 in Europa en 56 in Amerika versprei word (Jacobsen et al, 2000). Weens minder studies oor Amaranthus-sistematiek is die aantal spesies egter steeds tentatief. Daar is 'n mate van meningsverskil oor die aantal spesies in hierdie genus met verskillende verslae soos 60 spesies (Uphof, 1968 Singh et al., 1983 Nasionale Navorsingsraad, 1984 Budin et al., 1996 Wiersema & Leon, 1999), 70 spesies (Pratt et al., 1999 Costea & amp; DeMason, 2001 Mosyakin & Robertson, 2003), meer as 75 spesies (Sauer, 1993), 86 spesies (USDA, ARS, 1999) en 100 spesies (Hanf, 1984) [Tabel 1- Aanhangsel],

      Tans word Amaranthus in baie dele van die wêreld versprei, insluitend Sentraal- en Suid-Amerika, Afrika, China, Indië en die Verenigde State (Budin et al, 1996). Ongeveer 25 spesies Amaranthus is in die Asiatiese streek aangemeld (Das, 2016). In Indië word die spesies van die genus Amaranthus hoofsaaklik in Himalajas aangetref—van Kasjmir tot Bhoetan—en in Suid-Indiese heuwels.

      Geslag Amaranthus word gekenmerk deur die volgende eienskappe: Jaarlikse of (selde) kortstondige meerjarige lewensgeskiedenis, kruidagtige gewoonte met uitgestrekte stingel. Blare is afwisselend, eiervormig tot lineêr en het 'n inkepende of gekerfde punt en gladde rande. Blomme is onvolmaak, in saamgestelde dichasia verpak in bloeiwyses. Die plante van Amaranthus is eenhuisig (A. albus, A. blitum, A. caudatus, A. hybridus, A. powellii, A. retroflexus en A. spinosus) of tweehuisig (A. tuberculatus, A. palmeri en A. rudis) . Die bloeiwyse is terminale en/of okselstandig met drie tot vyf kelkblare en meeldrade. Eenhuisige spesies is oor die algemeen selfbestuif, windbestuif. Vrugte is utricle of pyxidium. Sade is lensvormig en klein (0,9 tot 1,7 mm deursnee en 1000 saadgewigte van 0,6 tot 1 g) wat tipies deur wind, water of voëls versprei word, met lang ontkiemingsperiode met produktiewe saadproduksie en 'n basischromosoomgetal van 16 of 17 (Stevens, 1932 Sauer, 1967 Kigel, 1994 Pratt et al., 1999 Franssen et al., 2001b Costea & Tardif, 2003 Mosyakin & Robertson, 2003 Costea et al., 2004 Steckel, 20044). Boonop het hierdie genus [C. sub.4] fotosintese, anders as die naaste verwante geslagte (Weaver, 1984 Mitich, 1997 Bensch et al., 2003 Sage et al, 2007). Morfologiese terminologie in Amaranthus, soos gebruik in verskillende floristiese en taksonomiese behandelings, is taamlik verwarrend, veral met betrekking tot die ternis wat op blomme en bloeiwyses toegepas word. Binne elke Amaranthus-spesie is daar verskeie rasse wat gedefinieer word deur hul algemene vertakkingspatroon, hoogte, bloeiwyse en vorm, dae tot volwassenheid, saadgrootte en kleur, en ander morfologiese eienskappe (Espitia-Rangel, 1994 Brenner et al, 2000).

      Geslag Amaranthus is dikwels moeilik om taksonomies te karakteriseer, as gevolg van min onderskeidende karakters onder sy spesies, klein en moeilik om te sien diagnostiese dele, 'n breë geografiese verspreiding, 'n groot aantal hibriede vorms, wat die taksonomie bemoeilik en word dus algemeen deur sistemiste beskou 'n "moeilike" genus (Costea & DeMason, 2001). Die genus Amaranthus is die eerste keer deur Linnaeus (1753) gerapporteer. Verskeie spesies van die genus is op 'n tyd as aparte genera erken, veral die tweehuisige spesies en die eenhuisige spesies met losstaande of onlosmaaklike vrugte (Linnaeus, 1753 Kunth, 1838). Hierdie genera is later deur Sauer (1955) en Robertson (1981) in Amaranthus geplaas en word tans as subgenera erken. In die mees onlangse taksonomiese werk is die genus in drie subgenera verdeel: Acnida, Amaranthus en Albersia (Mosyakin & Robertson, 1996 Costea et al., 2001). Subgenus Acnida word oor die algemeen afgebaken om al die tweehuisige spesies van Amaranthus in te sluit, terwyl subgenus Amaranthus en subgenus Albersia die eenhuisige spesies verdeel deur kombinasie van bloeiwyseposisie, aantal blomblare en vrugafskeiding (Mosyakin & Robertson, 1996). Verskeie skrywers vermoed dat hierdie infrageneriese taksonomie nie goed ooreenstem met die evolusionêre geskiedenis nie (Eliasson, 1988 Mosyakin & Robertson, 2003), maar ten spyte van die wye geografiese verspreiding en noue assosiasie met menslike aktiwiteite, is daar tans geen goed bemonsterde, goed ondersteun filogenetiese studie van hierdie genus. Miiller en Borsch (2005) en Sage et al., (2007) het Amaranthus in die orde Caryophyllales, familie Amaranthaceae, subfamilie Amaranthoideae, stam Amarantheae, sub-stam Amaranthinae, genus Amaranthus geplaas en volgens Sauer (1967) in die afdeling Amaranthus.

      Die middelpunt van oorsprong van Amaranthus is vermoedelik Sentraal-Amerika, met bewyse van sy verbouing dateer terug so ver as 6700 vC (Myers & Putnam, 1988 Putnam et al., 1989 Sauer, 1993 Kigel, 1994 Mposi, 1999). Die Asteekse beskawing van sentraal-Meksiko verteenwoordig die eerste aangetekende geval van Amaranthus-gebruik, en die gewas het prominent in die Asteekse kultuur gedurende die 1400 tot 1500 nC gefigureer. Amaranthus, wat die Asteke 'huautli' genoem het, was hul hoofvoedsel en is opgeneem in hul godsdienstige seremonies. Sy sade is deur Azteekse vroue gemaal en gemeng met heuning, ander lekkers en soms met menslike bloed (National Research Council, 1984), waarna dit in verskillende vorme (insluitend diere, natuurlike kenmerke en gode) gevorm is vir gebruik by godsdienstige seremonies en ander geleenthede (Brenner et al, 2000). Ten spyte van die bekende Asteekse gewoonte om mense te offer, is die verband tussen menslike bloed en die syfers onduidelik (National Research Council 1984).

      Na die aankoms van die Spaanse veroweraars in Mexiko in die vroeë 1500 nC, het Spaans probeer om die Asteekse kultuur en godsdiens so te onderdruk met hul verowering van Amaranthus, aangesien 'n oes amper in Amerika verdwyn het (Sauer, 1950). Volgens Spaanse sendelinge het die gebruik van Amaranthus as voedsel en in tradisionele kulturele praktyke egter op 'n verlaagde vlak voortgeduur tot sowat 50 jaar na die Spaanse verowering, maar het daarna afgeneem (Early, 1992). Selfs vandag word Amaranthus in 'n beperkte hoeveelheid verbou in die gebied, waarvan die meeste met heuning gesny en gemeng word om 'n lekkergoed te maak, 'alegria', wat 'geluk' beteken.

      Sauer (1967) rapporteer die bekendstelling van Amaranthus in Spanje in die sestiende eeu, vanwaar dit deur die hele Europa versprei het. Omstreeks 1700 nC was dit bekend as 'n minderjarige graanplant in Sentraal-Europa en Rusland en teen die vroeë negentiende eeu het dit Afrika en Asië bereik. Tot middel 1990's was Suid-Asië die wêreld se enigste streek waar Amaranthus-produksie toegeneem het (Brenner et al., 2000). Dit is in die 1970's dat navorsing oor hierdie plant in die VSA begin is, eers nadat nuwe bewyse aan die lig gebring het dat graan -amarantproteïen van hoë gehalte is (Senft, 1980 Lehmann, 1996). Vandag het dit oor die wêreld versprei in verskillende streke van Europa, Asië en Afrika (Myers & Putnam, 1988 Putnam et al., 1989 Mposi, 1999). Amaranthus is dus 'n historiese sowel as 'n kontemporêre plant.

      Amaranthus het 'n hoë genetiese veranderlikheid, met diversiteit in plantvorm (regop tot neerwaarts), planthoogte, aantal bloeiwyses (een tot verskeie), saadkleur, proteïeninhoud, saadopbrengs, weerstand teen plae en siektes, en aanpassing by grondsoort, pH, klimaat, reënval en daglengte (Kulakow, 1990). Alhoewel Amaranthus op 'n wye verskeidenheid grondtipes en grondvogvlakke kan groei, is berig dat dit goed groei in leem- of sandleem- of slikleemgrond met goeie waterhouvermoë (Whitehead & Singh, 1993 Ghorbani et al., 1999 Palada & amp; Chang, 2003) met 'n pH-waarde tussen 4,5 en 8,0 (National Research Council, 1984 Stallknecht & Schulz-Schaeffer, 1993 Palada & amp; Chang. 2003).

      Amaranthus is uiters aanpasbaar by ongunstige groeitoestande en verdra droogte en lae vrugbaarheid (O'Brien & Price, 1983). Veldstudies het getoon dat dit goed groei op gronde wat baie wissel in die vlak van grondvoedingstowwe (National Research Council, 1984 Myers, 1998) en goed reageer op goeie vrugbaarheid van die grond en organiese materiaal (Schippers, 2000). Landbouvelde is 'n goeie habitat vir eenjarige plante soos Amaranthus, wat natuurlik in oop of versteurde gebiede groei en vol sonlig ontvang (Pratt et al, 1999). Dieleman et al, (2000) het daarop gewys dat die verspreiding van Amaranthus -spesies in landbouvelde verband hou met hoë nitraatvlakke en lae vlakke fosfaat en kalium.

      Fenologie is die studie van periodieke biologiese gebeure wat op verskillende vlakke plaasvind, byvoorbeeld in organe, weefsel of selle (Aim et al., 1991). Die ontleding van fenologiese stadiums maak dit moontlik om die onkruidkompetisie akkuraat te skat (Ghersa & amp; Holt, 1995). Fenologiese opnames is dus van groot belang in onkruidwetenskap (Brainard et al., 2005) en kan ons help met die ontwikkeling van 'n realistiese en praktiese model vir onkruidbestryding (Elmore, 1996 Swanton et al., 1999).

      Fenologie van verskillende Amaranthus -spesies is deur verskeie werkers aangemeld. Forcella et al. (1997) berig dat die opkoms van Amaranthus -spesies vroeg in April begin en tot einde Mei voortduur. Opkoms van A. tuberculatus begin vanaf laat Mei en duur tot vroeg in Augustus (Hartzler et al., 1999), terwyl blom en saadset voortduur tot die eerste ryp. Ontkieming van A. albus en A. blitoides vind plaas vanaf die middel van Mei tot die begin van Junie. Die eerste sade van A. blitum ontkiem aan die einde van Junie of begin Julie. Bloei van A. albus en A. blitoides begin einde Junie of begin Julie, en van A. blitum einde Julie of begin Augustus, en duur voort totdat veroudering veroorsaak word deur die eerste herfsvries (Stevens, 1924). Die storting van sade (A. albus en A. blitoides) en van vrugte wat die sade omhul (A. blitum) strek gedurende die res van die groeiseisoen, as gevolg van die onbepaalde groeipatroon van bloeiwyses en die voortdurende vorming van nuwe blomme (Costea & amp Tardif, 2003). A. retroflexus verskyn aan die einde van Mei en sy verouderingstadium is van November tot Februarie, maar sy fenologiese stadiums is effens uitfaseer vir verskillende breedtegrade, met korter ontwikkelingstadia op hoër breedtegrade (Huang et al., 2000 Iamonico, 2010). A. spinosus kom in Junie op, blom in Julie, vrugte ontwikkel in Augustus, gevolg deur saadverspreiding in September en toon uiteindelik veroudering in November (Chakravorty & Ghosh, 2012).

      Amaranthus is 'n tweesaadlobbige, kruidagtige mesofiet wat gespesialiseerde [C.sub.4]-koolstofbindingsweg vir fotosintese gebruik waarin die eerste fotosinteseproduk 'n vierkoolstofverbinding is (Nasionale Navorsingsraad, 1984 Stallknecht en SchulzSchaeffer, 19998 Myers, 19998, Myers, et al., 1999). Amaranthus behoort aan die groep NAD-appelagtige ensiem-tipe [C.sub.4]-metabolisme en dit vertoon die tipiese Kranz-anatomie ([C.sub.4]-anatomie) van blare, saadlobbe en skutblare (Wang et al., 1993 Costea & Tardif, 2003). Hulle fotosintetiese pad word gekenmerk deur die gebruik van die mitochondriale NAD-ME om malaat in die Kranz-bondelskedes te dekarboksileer (Long et al., 1994 Long & Berry, 1996).Die kombinasie van verskeie anatomiese eienskappe van Amaranthus, soos [C.sub.4] metabolisme, goed ontwikkelde wortelstelsel, stomatale geleiding en instandhouding van blaaroppervlakte (Spreeth et al, 2004), lei tot verhoogde doeltreffendheid van die gebruik van C[O .sub.2] onder 'n wye reeks temperature (van 25°C tot 40°C), met hoër ligintensiteit en vogstremmingsomgewings (Williams & Brenner, 1995) wat hierdie plant in staat stel om onder diverse geografiese aan te pas en omgewingstoestande (Kigel, 1994). Plante wat die [C. sub.4] koolstofbindingpad gebruik, is geneig om minder water te benodig as die meer algemene [C. sub.3] koolstofbinding-plante (National Research Council, 1984). Dit is die rede dat Amaranthus goed presteer onder ongunstige temperatuur- en vogtoestande in vergelyking met baie [C.sub.3] plante soos koring en sojabone (Stallknecht & Schulz-Schaeffer, 1993 Schippers. 2000 Spreeth et al., 2004), wat daarop dui dat Amaranthus verbou kan word in gebiede wat nie geskik is vir ander gewasse nie (Breene, 1991 Lehmann, 1996 Brenner et al., 2000 Rana et al., 2007). Vorige studies het getoon dat [C.sub.4] onkruidspesies soos A. palmen, A. retroflexus en A. nul positief reageer op verhoging in temperatuur (Guo & Al-Khatib, 2003), dus kan temperatuurverhoging as gevolg van klimaatsverandering bevorder die indringingspotensiaal van [C.sub.4] onkruidsoorte soos A. retroflexus deur hul groei en saadproduksie te verbeter (Hyvonen, 2011).

      Daar is na Amaranthus verwys as droogteverdraagsaam (Grubben & van Sloten, 1981 Liu & Stutzel, 2002) en hierdie droogtetoleransie is te danke aan sy [C.sub.4] fotosintetiese pad, 'n diep en uitgebreide wortelstelsel, vermoë om dormant te gaan. onder uiterste droogtetoestande (O'Brien & amp, Price, 1983) en die vermoë om transpirasie deur verwelking af te sluit en dan maklik te herstel wanneer vog beskikbaar is (Myers, 1996). Planthoogte, droëmateriaalproduksie en uitbreiding van blaaroppervlakte van Amaranthus -spesies reageer positief op die stygende gemiddelde dag/nag gemiddelde temperatuur (Flint & amp Patterson, 1983). Blominisiasie hang af van fotoperiode en die meeste van die Amaranthus-spesies blom wanneer die daglengte korter as 12 uur is (Fuller, 1949 Huang et al, 2000 Palada & Chang, 2003). Plante wat onder kortdagtoestande (8 uur) gekweek word, benodig 14 tot 16 dae om blom te begin, terwyl plante wat onder langdagtoestande (16 uur) gekweek word, ongeveer 45 dae benodig (Costea et al., 2004). O'Brien en Price (1983) het berig dat kort dae en waterstres blom in hierdie plant kan bevorder.

      Simbolon en Sutarno (1986) het reaksies van Amaranthus-spesies op verminderde ligintensiteit bestudeer en gevind dat hulle matig verdraagsaam teenoor skaduwee is. Vorige navorsing toon dat [C.sub.4] plante hoër ligversadigde fotosintetiese tempo's het en beter aangepas is vir hoë vlakke van bestraling in vergelyking met [C.sub.3] plante wat versadig teen relatief laer ligintensiteite (Stoller & Myers, 1989 Regnier en Harrison, 1993). Skadu beïnvloed die oorlewing en groei van plante deur hul fisiologiese en morfologiese reaksie op lig omgewing te verander. Onkruide soos Amaranthus toon fisiologiese en morfologiese aanpassings aan verminderde bestraling en die "aanpasbare plastisiteit" om aan te pas by 'n ligbeperkte omgewing (Stoller & Myers, 1989). Stoller en Myers (1989) het gerapporteer dat A. albus op skadu reageer deur ligversadigde fotosintese, donker respirasietempo en blaardikte te verminder, terwyl chlorofilinhoud per eenheid blaarvolume en spesifieke blaaroppervlakte verhoog word. A. powellii, A. retroflexus en A. tuberculatus reageer op skaduwee deur biomassa en blaar voorkomstempo's te verminder en deur spesifieke blaaroppervlakte en stamverlenging te verhoog (McLachlan et al., 1993a, b: Steckel et al., 2003 Brainard et al., 2005). Die karakterisering van hierdie fisiologiese en morfologiese reaksies van hierdie genus op skaduwee sal waarskynlik waardevolle inligting verskaf vir die verbetering van ons meganistiese modelle van gewas-onkruid-kompetisie en onkruidbevolkingsdinamika (Brainard et al., 2005).

      Die genus Amaranthus bied fassinerende materiaal vir genetici om mee te werk. Basiese genetiese studies van hierdie genus is aan die einde van die vyftigerjare begin met chromosomale tellings (Grant, 1959b Pal, 1964) en die identifisering van polyploids (Khoshoo en Pal 1972).

      Chromosoomgetal verskil tussen Amaranthus-spesies (Tabel 2). In A. albus, A. palmeri en A. retrojlexus chromosoomtellings van 2n = 34 (Grant 1959b Sharma en Banik, 1965 Weaver & McWilliams, 1980) en 2n = 32 (Heiser & Whitaker, 1948 Mulligan, 1948 Mulligan, Rayburn et al. 2005) is aangemeld. In A. spinosus is somatiese tellings van 2n = 34 (Baquar & Olusi 1988 Al-Turki et al., 2000) en die gametiese tellings van n = 17 (Koul et al., 1976 Behera & Patnaik, 1977 Behera 1982, 1982, 1982 ) aangemeld is. A. palmeri en A. spinosus kan 'n onlangse gemeenskaplike voorouer deel (Wassom & Tranel, 2005 Riggins et al., 2010), aangesien hulle dieselfde chromosoomgetal (2n = 34), stuifmeel morfologiese ooreenkomste het (Grant, 1959b Franssen et al. ., 2001b Gaines et al, 2012) en soortgelyke genoomgroottes (Rayburn et al., 2005). Pal et al. (1982) berig dat, binne die Amaranthus-genus, beide n = 16 en n = 17 soms in dieselfde spesie voorkom. Die chromosoomgetal van A. blitum en A. powellii is 2n = 34 (Weaver & McWilliams, 1980 Pal & Pandey, 1989 Greizerstein et al., 1997). Die chromosoomgetal vir A. caudatus, A. hypochondriacus, A. cruentus en A. hybridus is normaalweg 2n = 32, maar soms is dit 34 (National Research Council, 1989), maw hierdie spesies is diploïede met 'n basiese chromosoomgetal van 16 of 17. Daar is geen groot chromosomale verskille tussen die genome van A. hypochondriacus, A. caudatus en A. edulis nie (Ramesh & Kumar, 2009).

      Amaranthus is 'n oorwegend selfbestuifde plant (Murray, 1938), met wisselende hoeveelhede uitkruising (Hauptli & Jain, 1985 Liu et al., 2012). Hybridisering tussen verskillende spesies is wyd aangemeld binne die genus Amaranthus (Saue.r 1950 Trucco et al, 2005b). Die moontlikhede vir interspesifieke verbastering onder die meeste van die Amaranthus-spesies is gedokumenteer (Murray, 1938 Sauer, 1950 Pal & Khoshoo, 1973), en sommige het selfs na die genus as 'promiskue' verwys (Trucco et al., 2005b). Die identifisering van drie bronne van sitoplasmiese manlike steriliteit in Amaranthus baan die weg vir addisionele hibridisasietegnieke (Peters & amp; Jain, 1985, 1987 Gudu & amp; Gupta, 1988).

      A. retroflexus vorm soms natuurlike basters met ander spesies van dieselfde genus (Murray, 1938). Daar is gerapporteer dat hibridisasie tussen A. palmeri en A. tuberculatus na gekontroleerde bestuiwing feitlik geen vrugbare nageslag oplewer nie (Wetzel et al., 1999b Franssen et al., 2001a Steinau et al., 2003 Trucco et al., 2007). Hibridisering tussen A. hybridus en A. tuberculatus produseer sommige vrugbare F1-individue (Murray, 1940 Trucco et al., 2007 Trucco et al., 2009), hoewel genetiese introgressie tussen hierdie spesies slegs in een rigting plaasvind, van A. hybridus tot A. tuberculatus (Trucco et al., 2005a, b Trucco et al., 2009). Gebaseer op gerapporteerde interspesifieke hibridisasies in Amaranthus, is gelyke chromosoomgetal nie 'n voorvereiste vir hibridisasie nie, maar hibriede nageslag blyk meer lewensvatbaar en vrugbaar te wees wanneer hul ouerspesies dieselfde chromosoomgetal het, soos in die geval van hibridisasie tussen A. hybridus en A tuberculatus (Trucco et al., 2009).

      Daar is 'n kommer dat glifosaatweerstand as gevolg van EPSPS-geenamplifikasie van glifosaatbestande A. palmeri na ander onkruidagtige Amaranthus-spesies oorgedra kan word (Culpepper et al., 2006). Die potensiële interspesifieke oordrag van EPSPS geenamplifikasie en glifosaatweerstand binne die genus Amaranthus het aansienlike evolusionêre en agronomiese betekenis (Gaines et al., 2012).

      Die gedetailleerde begrip van saadbiologie help met die ontwikkeling van effektiewe geïntegreerde onkruidbestuurstelsels (Bhowmik, 1997). Kigel (1994) het baie van die beskikbare inligting oor saadbiologie van die genus Amaranthus saamgestel, insluitend navorsing oor die effekte van lig (Oladiran & Mumford, 1985 Gutterman et al., 1992 Gallagher & Cardina, 1998a, b), temperatuur (Baskin &. Baskin, 1977 Weaver, 1984 Oladiran & amp Mumford, 1985 Weaver & amp, Thomas, 1986 Ghorbani et al., 1999), beskikbaarheid van water, osmotiese potensiaal en soutgehalte (Ghorbani et al., 1999), hormone (Holm & Miller, 1972 Weaver, 1984) Kepczyriski et al., 1996), grondsoorte, begraafdiepte (Webb et al., 1987 Oryokot et al, 1997a Ghorbani et al., 1999), en ander omgewingsparameters (Bibbey, 1935 Siriwardana & Zimdahl, 1984 Habib & Morton, 1987 Wiese & amp Binning, 1987 Forcella et al., 1997) oor saadontkieming.

      Onkruidsaad-dormansie word dikwels geïnduseer en gereguleer deur 'n kompliment van genetiese, fisiologiese en omgewingsfaktore (Karssen, 1982 Baskin & Baskin, 1998), insluitend daglengte en plantouderdom (Gutterman & Genotypic, 1997 Castor et al, 2000), oes datum (Ghosh & amp; Bruin, 1997) en temperatuur (Marayama et al. 1997). Tydens saadontwikkeling word A. retrojlexus-saaddormansie beïnvloed deur verskeie omgewingstoestande soos ouerfotoperiode, temperatuuromgewings, bemesting van grond, kompetisie met ander plante (Kigel et al., 1977 Costea et al., 2004) en skadu van die moeder plant of eintlik met behulp van natuurlike infrarooi lig (Doroszeweski, 2001). Induksie van sekondêre rus (termodormansie) in sade weens hoër temperature is gerapporteer in A. retroflexus (Baskin & amp Baskin, 1977, 1985a, 1990 Egley, 1989), A. caudatus (Kepczynski & amp Bihun, 2002), A. quitensis ( Faccini & Vitta, 2005), en A. palmeri sade (Jha et al., 2010), wat aandui dat hierdie gedrag van sade wat in grond gehou word, kenmerkend is van die genus Amaranthus. Die voorkoms van sulke tydelike veranderinge in dormansie van begrawe Amaranthus-sade is geïnterpreteer as 'n aanpassing om oorlewing te verbeter wanneer sade in die grond is, veral wanneer hulle diep begrawe is (Omami et al., 1999).

      Die effek van temperatuur en lig op saadontkieming van Amaranthus -spesies is deur vorige navorsers bestudeer (Baskin & amp Baskin, 1977, 1998 Gallagher & amp Cardina, 1998a, b Leon & amp Owen, 2003 Steckel et al., 2004). Die hoë temperatuurvereiste vir ontkieming van Amaranthus-spesies is gerapporteer deur Bibbey (1935), Kadman-Zahavi (1960), McWilliams et al. (1968), Baskin en Baskin (1977), Washitani en Takenaka (1984), Habib en Morton (1987), Gutterman et al. (1992), Ghorbani et al. (1999), en Guo en Al-Khatib (2003) (Tabel 3).

      Volwasse Amaranthus sade bly gedurende die herfs en winter rustig (Baskin & amp Baskin. 1977, 1987 Jha et al., 2007, 2008c Norsworthy & Oliveira, 2007), aangesien die temperatuur gedurende die tydperk laer is as die wat nodig is vir ontkieming. Na die rypwording gedurende die winter benodig sade van Amaranthus-spesies, soos die meeste somer-eenjariges, hoë wisselende temperature vir ontkieming en ontkiem nie in die veld teen laer temperature tot laat in die somer nie (Baskin & amp Baskin, 1977, 1987 Karssen, 1982 Benech -Arnold et al., 1990 Bouwmeester & amp; Karssen, 1992 Faccini & amp; Vitta, 2005), terwyl 'n afname in die minimum temperatuurvereistes of 'n verbreding van die termiese bereik vir ontkieming van saad (Baskin & amp; Baskin, 1977, 1987 Benech-Arnold et al., 1990 Bouwmeester & amp; Karssen, 1992). Saad verkry dus die vermoë om ewe goed te ontkiem by temperature onder die optimum reeks van 25 tot 35°C (Wright et al, 1999 Guo & Al-Khatib, 2003).

      Daar is getoon dat temperatuurskommelinge soos wisselende temperatuurstelsels dormansie verminder, die tyd tot aanvang van ontkieming verminder en die ontkiemingstempo in verskillende Amaranthus -spesies verhoog, soos A. cruentus, A. gangeticus, A. hybridus, A. palmeri, A. paniculatus, A retroflexus, A. rudis, A. spinosus en A. viridis (Santelmann & amp Evetts, 1971 Weaver, 1984 Oladiran & amp Mumford, 1985 Guo & amp Al-Khatib, 2003 Leon et al., 2004, et al. 4, 207 Steckel. Thomas et al., 2006 Chauhan en Johnson 2009 Jha et al., 2010) omdat afwisselende temperature die meeste ooreenstem met daaglikse temperatuurreaksies en kan saadhuid-opgelegde fisiese dormansie van sade breek (McKeon & Mott, 1982).

      Minimum ontkiemingstemperatuur vir A. palmeri en A. retroflexus was >5°C, maar die optimale temperatuur vir maksimum ontkieming is na berig van 25 tot 40°C (Evans, 1922 McWilliams et al., 1968 Baskin &. Baskin, 1977 Habib & Morton, 1987 Wiese & Binning, 1987 Kcpczynski et al., 1996 Ghorbani et al., 1999 Wright et al., 1999 Kepczynski & Bihun, 2002 Guo & Al-Khatib, 2002). Dormante A. retroflexus-sade kan nie in duisternis by 25°C ontkiem nie en kan óf gedeeltelik by 35°C ontkiem (Schonbeck & Egley, 1981a, b Kcpczynski et al, 2003b), óf volledig by 35-40[grade] C (Kepczynski et al., 1996). Optimale ontkieming van A. caudatus en A. blitum is gerapporteer by 35 ° C, terwyl van A. hybridus sade tussen 32 en 34 ° C (Washitani & Takenaka, 1984 Teitz et al., 1990) was. Gutterman et al., 1992 Kcpczynski & Bihun, 2002). Oladiran en Mumford (1985) het optimum ontkieming tussen 30 en 35°C gerapporteer vir A. cruentus, A. hybridus, A. paniculatus en A. gangeticus. Hoë temperature ([groter as of gelyk aan] 25 [grade] C gemiddelde), termiese amplitudes ([groter as of gelyk aan] 7,5 [grade] C) en hoë grondvog bevorder ontkieming van A. palmeri en ander Amaranthus -spesies (Hartzler et al., 1999 Wright et al., 1999 Guo & Al-Khatib, 2003 Steckel et al. 2004 Jha et al., 2008b, c, 2010).

      A. spinosus-sade reageer positief onder 'n afwisselende temperatuurregime van 20, 25 en 30°C en nadelig by 35°C en geen ontkieming vind plaas by 15°C nie maar, wanneer die temperature konstant gehou is, beduidende ontkieming is aangeteken by 30 [grade] C en 35 [grade] C (Steckel et al., 2004). A. viridis sade ontkiem oor 'n reeks van 20 tot 40 [grade] C met 30 [C] as die optimale temperatuur vir ontkieming (Thomas et al., 2006), terwyl daar geen ontkieming by 10 [grade] C ( Cristaudo et al., 2007).

      Kigel (1994) het gerapporteer dat die meeste spesies Amaranthus op lig reageer, maar die reaksievlak wissel tussen die spesies (Gallagher & amp Cardina, 1998a, b Cristaudo et al., 2007), afhangende van die dormante vlak van sade, wat verder beïnvloed word deur faktore soos begrafnis en temperatuur (Gallagher & Cardina, 1998a Leon & Owen, 2003). Ligbehoefte vir ontkieming is aangemeld in verskeie Amaranthus spesies soos A. blitum, A. caudatus, A. hybridus, A. retroflexus, A. rudis, A. spinosus en A. viridis (Baskin & Baskin, 1977 Schonbeck & Egley, 1981a, b Teitz et al., 1990 Gallagher en Cardina, 1998a, b Leon & Owen, 2003 Cristaudo et al. 2007). Sade van A. spinosus, A. retroflexus en A. viridis ontkiem beter in lig as in duisternis, wat impliseer dat die begrawe sade sal ontkiem na grondversteuring (Baskin & Baskin, 1977, 1985b, 1998 Omami & Medd, 1992 Gallagher &. Cardina, 1998a, b Benvenuti et al., 2001 Cristaiido et al., 2007). Die ekologiese betekenis wat toegeskryf word aan die ligrespons by verskillende spesies Amaranthus, is dat lig dien as 'n "grondaanwyser", of diepte-waarnemingsmeganisme vir sade, wat groter ontkieming van oppervlaktesaad moontlik maak as sade wat in die grond begrawe is (Ghorbani et al., 1999 Schutz et al., 2002).

      Fytochroom-gereguleerde saadontkieming van verskillende Amaranthus-spesies soos A. arenicola, A. cauda tus, A. hybridus, A. palmeri, A. retroflexus en A. rudis is gedokumenteer (Hendricks et al., 1968 Kendrick & amp Frankland, 1969 Kendrick et al., 1969 Taylorson en Hendricks, 1969, 1971 Gallagher en Cardina, 1998a, b Leon en Owen, 2003 Jha et al., 2010). Blootstelling aan rooi (R) lig veroorsaak ontkieming in donnant sade (Jha et al., 2010), en hierdie effek word meer uitgespreek in verkoelde sade (klam stratifikasie by 4 [grade] C) in vergelyking met nie-verkoelde sade, wat dui op 'n interaksie van lae temperature met fitochroom in rusverligting (Taylorson & Hendricks, 1969 Gallagher & Cardina, 1997, 1998a, b Leon & Owen, 2003). Hoë temperature (30 ° C of hoër) gedurende die somer kan egter die fotosensitiwiteit van Amaranthus sade verminder en die fytochroom -gemedieerde rooi lig vereiste vir verbeterde ontkieming in verskillende Amaranthus spesies soos A. hybridus, A. retroflexus en A. rudis oorkom (Gallagher & amp Cardina. 1998a Hartzler et al, 1999 Leon & amp Owen, 2003). Aan die ander kant inhibeer FR-lig ontkieming en veroorsaak dormansie (Kendrick & Frankland. 1969 Taylorson & Hendricks, 1971 Gallagher & Cardina, 1998a Leon & Owen, 2003 Jha et al., 2010). Hierdie inhiberende effek van FR-lig is te wyte aan afname in Pfr/Pr van die fitochroom, wat dus foto-dormansie in sade veroorsaak (Hendricks et al., 1968 Kendrick & Frankland, 1969 Taylorson & Hendricks, 1969, 1971).

      Effek van grondtipes, saadbegraafdiepte en duur van saadbegrawe

      Persentasie opkoms van A. retroflexus is groter in ligter gronde (sand klei leem, leem sand en sand leem) as swaarder grond (slik klei en sanderige klei). Maksimum opkoms vind plaas op 0,5 cm diepte in die drie ligter gronde, tussen 0,5 en 2 cm in die sanderige klei en 3 cm diep in die siltige klei (Ghorbani et al., 1999), moontlik as gevolg van swak gaswisseling, swak lig, en laer temperatuur in swaarder gronde (Gallagher & Cardina, 1998a).

      Begrawe onkruidsade maak 'n belangrike deel van die grondsaadbank uit (Baskin & Baskin, 1985b, 1998 Benvenuti et al, 2001) en posisie, verspreiding en rusvlak van hierdie sade in die grond speel 'n belangrike rol in hul ontkieming en daaropvolgende opkoms ( Burnside et al., 1981 Benvenuti & Macchia, 1997 Benech-Arnold et al., 2000), wat verder beïnvloed word deur faktore soos grondtemperatuur, grondvog en ligbeskikbaarheid. Kleinsaadige onkruide soos Amaranthus-spesies kan slegs van vlak gronddieptes van 0,5 tot 2,5 cm ontkiem (Baskin & Baskin, 1977, 1998 Buhler et al., 1996 Oryokot et al., 1997a Gallagher & Cardina, b1998a, b1998a, et al. al., 1999 Benech-Arnold et al., 2000 Leon & Owen, 2003).

      Santelmann en Evetts (1971) het opkoms vir verskeie Amaranthus-spesies ondersoek en gevind dat ontkieming afneem op dieptes onder 1,9 cm. Toename in dormansie van sade wat op 'n diepte van 5 tot 10 cm vir 3 tot 12 maande begrawe is, is in ander Amaranthus-spesies aangemeld (Baskin & Baskin, 1977 Omami et al., 1999). Ghorbani et al. (1999) waargeneem in-situ opkomspatrone van A.retroflexus en tot die gevolgtrekking gekom dat die optimale begraafdiepte tussen 0.5 en 3 cm was, met geen opkoms by 5 cm nie. Onder veldtoestande het ook A. retroflexus sade 'n afname in ontkieming getoon met 'n toename in begraafdiepte van 0 tot 10 cm (Wiese & Davis, 1967 Omami et al., 1999). Benvenuti et al. (2001) het ook 'n afname in A. retroflexus saailingopkoms gerapporteer met 'n toename in begraafdiepte en die opkoms is minder as 10% gevind by 'n begrafnisdiepte van 8 cm. Verder het die sade van A. viridis op die grondoppervlak verminderde opkoms vergeleke met die sade wat net onder die oppervlak geplaas is, en ontkieming was optimaal vanaf vlak gronddieptes van 0,5 tot 2 cm, maar sommige saailinge het so diep as 6 cm gekom (Thomas et al., 2006). Beperk kontak met grond tot saad, ligstoestande op die oppervlak, en beskikbaarheid van water of 'n laer grondwaterpotensiaal naby die saad, is 'n paar omgewingstoestande wat die ontkieming van saad op die grondoppervlak kan beperk (Ghorbani et al., 1999). Die opkoms van saailinge op die grondoppervlak was laer as die ontkieming wat in Petri-skottels in die lig waargeneem is (Chauhan & Johnson, 2009). Hierdie verskil kan wees as gevolg van swak grond-saadkontak of meer beperkte beskikbaarheid van vog op die grondoppervlak as op die filtreerpapiere (Ghorbani et al, 1999).

      Saad van A. spinosus en A. viridis kom in dieselfde tempo van 0,5 cm tot 2 cm op, maar namate die begrafnisdiepte toeneem, neem die opkoms van A. spinosus vinniger af as dié van A. viridis, sonder dat daar 4 cm in die voormalige en slegs 6% opkoms in die latere, terwyl daar geen opkoms op 'n diepte van 6 cm in enige van die spesies waargeneem is nie (Chauhan & Johnson, 2009). Groter sade met groter koolhidraatreserwes het verhoogde vermoë om uit groter begraafdieptes te kom in vergelyking met dié met laer reserwes (Baskin & Baskin, 1998). Die groter saadmassa van A. viridis (meer as twee keer as dié van A. spinosus) kan sy vermoë verklaar om uit dieper in die grond te kom as A. spinosus (Chauhan & Johnson, 2009). Kleinsaad breëblaaronkruidspesies, soos A. retroflexus, A. spinosus, A. viridis en verskeie ander Amaranthus-spesies het 'n soortgelyke patroon van opkoms as gevolg van beperkte koolhidraatreserwes om ontkieming en saailingopkoms te ondersteun, en beperk dus die diepte waaruit hierdie saailinge kan opkom (Webb et al., 1987 Santelmann & Evetts, 1971 Ghorbani et al., 1999 Thomas et al., 2006 Chauhan & Johnson, 2009) (Tabel 4).

      Die verkryging van diepte-gemedieerde dormansie van onkruidsade (Milberg & Andersson, 1997 Benvenuti et al., 2001) is 'n belangrike strategie wat langlewendheid en voortbestaan ​​van onkruidsade in die grondsaadbank moontlik maak (Thompson, 1987 Benvenuti et al., 2001) ), en dit is bekend dat dit voorkom as gevolg van 'n gebrek aan ligoordrag, afname in termiese fluktuasie, afname in suurstof, toename in koolstofdioksied en lae tempo van gasdiffusie met toenemende gronddiepte (Holm, 1972 Woolley & Stoller, 1978 Baskin & Baskin. , 1985b Drew, 1990 Benvenuti & Macchia, 1997, 1998 Gallagher & Cardina, 1998a Benvenuti et al., 2001 Benvenuti, 2003).

      Verder, temperatuurskommelings, wat na berig word om 'n effek te hê op saaddormansie verligting van Amaranthus spesies (Baskin & Baskin, 1977, 1985b Omami et al., 1999 Guo & Al-Khatib, 2003 Leon & Owen, 2003 Steckel et al. 2004 Cristaudo et al., 2007), neem af met toenemende gronddiepte, en dien dus as 'n dieptewaarnemingsmeganisme vir onkruidsade (Ghersa et al., 1992 Baskin & Baskin, 1998 Kegode et al., 1998). Gutterman et al. (1992) en Kepczynski et al. (1996) berig dat die nie-dormante sade van Amaranthus ten minste 10% suurstof nodig het vir ontkieming. Maar met 'n toename in begraafdiepte is daar 'n afname in suurstofkonsentrasie, wat lei tot hipoksie en ontkiemingsinhibisie in sade van sommige onkruidspesies (Holm, 1972).

      Milberg en Andersson (1997) het berig dat begrawing in grond 'n ligte behoefte in sommige onkruidsaad veroorsaak het. Begrafnis-geïnduseerde rooiligbehoefte vir ontkieming het gelei tot 'n verskuiwing van lae fluensie reaksie (LFR) na baie lae fluensie reaksie (VLFR) van die fitochroom in A. retroflexus en A. hybridus sade (Scopel et al., 1991 Smith, 1995) Gallagher & Cardina, 1998a, b), wat ook in ander spesies van Amaranthus verwag kan word.

      Tydsduur van saadbegrawe speel ook 'n belangrike rol in dormansie en ontkieming van onkruidsade soos A.patulus (Baskin & Baskin, 1985b, 1998 Washitani, 1985) (Tabel 4). Washitani (1985) het gemeld dat slegs 'n geringe aantal begrawe sade van A. patulus hul ontkiembaarheid behou het na 3 jaar van begrafnis. Omami et al. (1999) het sikliese veranderinge in dormansie en ontkieming van A. retroflexus sade gedurende 'n 12 maande begrafnisperiode gerapporteer. Saadontkieming van A. retroflexus en A. palmeri het afgeneem na 1 tot 3 maande van saadbegrafnis. Piekontkieming het plaasgevind na 9 maande en het weer afgeneem op 12 maande na saadbegrafnis (Omami et al., 1999 Jha et al., 2010). Begrawe sade van A. retroflexus kan vir minstens 6-10 jaar lewensvatbaar bly (Chepil, 1946a Weaver & McWilliams, 1980 Burnside et al., 1981, 1996 Costea et al., 2004). In Beal se eksperiment in Michigan het 2% van die sade van A. retroflexus na 40 jaar van begrafnis ontkiem (Telewski & Zeevaart, 2002).

      Effek van skadu en bewerking

      Subtiele verskille in die grondmikroklimaat kan groot invloed hê op die ontkieming van saad van onkruide, insluitend Amaranthus -spesies (Mohler, 1993 Buhler et al., 1996 Oryokot et al., 1997a). Effekte van skadu en bewerking op opkomseienskappe van Amaranthus spesies soos A. retroflexus en A. rudis is voorheen bestudeer (Anderson & Nielsen, 1996 Oryokot et al, 1997a Hartzleret al., 1999 Cardina et al., 2002 Leon & Owen, 2006).

      Effek van scarifikasie en stratifikasie

      Santelmann en Evetts (1971) het waargeneem dat A. spinosus-sade die beste ontkiem wanneer dit met swaelsuur behandel is. Meganiese of chemiese littekens met swaelsuur vir 1 tot 5 minute het gelei tot ontkieming van die sekondêre dormante A. caudatus sade by 25 [C] (Kepczynski & Bihun, 2002). Behandeling met verskillende konsentrasies asetoon, etanol, etileen, waterstofperoksied, kaliumsianied, natriumazied en swaelsuur was baie effektief om Amaranthus -saad se dormansie te verbreek en ontkieming te bevorder (Taylorson & Hendricks, 1973 Mahmudzadeh et al., 2003). Soomarin et al. (2010) het die sade van A. retroflexus met swaelsuur behandel en gerapporteer dat met die toename in die duur van behandeling die ontkiemingstempo van Amaranthus-sade toegeneem het van 2% (in beheer) tot 78.5% (in 25-min voorbehandeling) . Radikellengte en gewig het egter afgeneem (Evans, 1922 Mahmudzadeh et al., 2003 Soomarin et al., 2010).

      Stratifikasie, 'n effektiewe manier om saaddormansie te verlig (Bewley & Black, 1994), stel A. retroflexus en A. rudis saaddormansie geleidelik oor tyd vry (Leon & Owen, 2003 Kepczynski & Sznigir, 2012) en verhoogde saadontkiemingspersentasie maar die tempo van ontkieming by 35°C was hoër as by 25°C na elke periode van stratifikasie (Taylorson & Hendricks, 1969 Kcpczynski & Sznigir, 2012). Sade van A. retroflexus wat onder 'n kortdaglengte gekweek is, het hoër ontkieming in reaksie op koue stratifikasie as dié wat onder langdaglengtes gekweek is (Kigel et al., 1977).

      Stratifikasie by 'n konstante temperatuur was minder effektief in die vrystelling van rus as herfs-winter begrawe van sade as gevolg van die rede dat sade in die grond nie net aan wisselende temperature blootgestel word nie, maar ook aan verskeie ander faktore soos verbindingsoplossings, gasse en grond. mikroörganismes, wat die rustoestand van Amaranthus-sade kan beïnvloed (Kcpczynski & Sznigir, 2012). Moore (1979) het daarop gewys dat verkoeling by 4°C endogene GA verhoog en ABA-konsentrasie verlaag, daarom is dit moontlik dat dormansieverligting in sade van sommige spesies deur stratifikasie of gedeeltelike begrawe geassosieer word met veranderinge in ABA/GA en etileen balans en/of sensitiwiteit vir hierdie hormone (Cadman et al., 2006 Rodriguez-Gacio et al., 2009).

      Ekonomiese Belang van Genus Amaranthus

      Samestelling en voedingswaarde van Amaranthus

      Die rol van Amaranthus as 'n onderontginde plant met belowende ekonomiese waarde is deur die National Academy of Sciences, VSA (NAS, 1975) erken, waarna die voedingswaarde daarvan omvattend bestudeer is (Becker et al., 1981 Teutonico & Knorr, 1985 Petr et al., 2003).

      Amaranthusblare toon beduidende energiewaarde wat wissel van 27 tot 53 kcal/100 g vars blare en 'n hoë voedingswaarde wat wissel van 4 tot 6 g proteïen, 0,2 tot 0,6 g vet en 4 tot 7 g koolhidrate per 100 g vars blare (Uusikua et al., 2010) en is bekend daarvoor dat dit ryk is aan mikrovoedingstowwe en vitamiene, veral chloor, koper, yster, mangaan, natrium, vitamien A, vitamien C en vitamien B-12 (Mnkeni, 2005). Amaranthusblare smaak baie soos spinasie, maar is voedingskundig beter aangesien dit 3 keer meer vitamien C, kalsium en niasien as spinasie bevat (Mnkeni, 2005). In vergelyking met blaarslaai, bevat Amaranthus-blare 18 keer meer vitamien A, 13 keer meer vitamien C, 20 keer meer kalsium en 7 keer meer yster (Mnkeni, 2005 Srivastava, 2011).

      Amaranthus-sade het proteïeninhoud van ongeveer 12,5 tot 17,6% (Becker et al., 1981 Teutonico & Knorr, 1985), met 'n aansienlik hoër inhoud van lisien (0,73 tot 0,84% van die totale proteïeninhoud) en die swaelbevattende aminosure ( metionien en sisteïen) as ander graankorrels (Becker et al., 1981 Saunders & Becker, 1984 Railey, 1993 Lehmann, 1996 Petr et al., 2003) behalwe sojabone (Petr et al. 2003), wat dus potensiaal het om wêreldvoedsel te verbeter situasie as 'n alternatiewe bron van proteïen (Oliveira & de Carvalho, 1975).

      Amaranthus-sade het 'n uitstekende aminosuurprofiel wat, wanneer dit met mielies of rys gekombineer word, die moderne standaardproteïen benader wat deur die FAO/WGO aanbeveel word (FAO, 1973 Senft, 1980 Teutonico & Knorr, 1985 Singhal & Kulkarni, 1988) en is nuttig in die aanvulling van voedingsvoedsel en die verbetering van proteïentekort streng in die vegetariese dieet mense (Downtown, 1973 Senft, 1980 Railey, 1993).

      Die lipiedinhoud van Amaranthus-saad is tipies 6 tot 20% (Lorenz & Hwang, 1985 Garcia et al, 1987a Budin et al.. 1996). Beide Amaranthus sade sowel as blare is 'n goeie bron van onversadigde vetsure soos palmitiet, oleïen, linoleïen. en linoleensure (Fernando & Bean, 1984 Jahaniaval et al., 2000 Leon-Camacho et al., 2001). Alhoewel Amaranthus-saad nie as 'n tipiese oliesaadgewas beskou word nie, is dit geïdentifiseer as 'n ryk bron (2,4 tot 8%) van squaleen (2,6,10,15,19,23-heksametiel-2,6,10,14, 18,22-tetracosahexaene) en tokotrienole ('n vorm van vitamien E) (Budin et al., 1996 Lehmann, 1996 Sun et al., 1997). Skwaleen is 'n duur terpenoïedverbinding, hoofsaaklik afkomstig van haailewer (Cantrophorus squamosus) en walvisolie (Physeter macrocephalus). As gevolg van die besorgdheid oor seedierbeskerming, is aandag gevestig op die identifisering van gewasbronne van squalene (Sun et al., 1997). Skwaleen is 'n belangrike bestanddeel in skoonheidsmiddels, farmaseutiese produkte en smeermiddels vir rekenaarskywe (Sun et al., 1997 Budin et al., 1996). Beide squaleen en tokotrienole kan 'n belangrike rol speel in die verlaging van LDL-cholesterol in bloed (Railey, 1993 Budin et al., 1996 Lehmann, 1996) en dien dus as beskermende faktore teen hartinfarksie wat deur isoproteronol veroorsaak word (Farvin et al., 2006).

      Amaranthus-sade is 'n ryk bron van kalsium (1300 tot 2850 mg/kg), yster (72 tot 174 mg/kg), magnesium (2300 tot 3360 mg/kg), natrium (160 tot 480 mg/kg) en sink (36.2) tot 40 mg/kg) sterole (0,27-0,32 mg/g) asook vitamien riboflavien (0,19-0,23 mg/100 g meel) en askorbiensuur (4,5 mg/100 g meel), niasien (1,17 tot 1,45 mg) /100 g meel), tiamien (0,07 tot 0,1 mg/100 g meel) en ander mikro-elemente (Becker et al, 1981 Plate and Areas, 2002).

      Dit is bekend dat sommige Amaranthus-spesies, wanneer hulle onder strestoestande gekweek word, toksiese vlakke van oksalaat en nitraat ophoop (Der Marderosian et al., 1980 Saunders & Becker, 1984 Wills et al., 1984) en hierdie nitrate kan by verbruik chemies verander word. in die spysverteringskanaal tot giftige/karsinogene nitrosamiene.

      Toepassings van Amaranthus

      Amaranthus is een van die min hoogs voedsame veeldoelige gewasse en word gebruik as groente, graan, medisinale plant, kleurstof plant, voer, brandstof en as 'n sierplant. (Sauer ,1950 Oke 1983 Saunders & Becker, 1984 Railey, 1993 Mlakar et al., 2009 Sheikh & Singh, 2013).

      Die rooi kleurstof van die blare van verskeie spesies Amaranthus word gebruik om voedsel, alkoholiese drankies en mieliedeeg te kleur (Sauer, 1950). In Mexiko word Amaranthus -sade hoofsaaklik gebruik vir die bereiding van alegria -snoepies uit gekapte sade en melasse (Early, 1977) en vir die bereiding van atole, 'n drankie uit geroosterde en poeierpitte gemeng met stroop en water (Oke, 1983). In Indië word A. hypochondriacus, algemeen bekend as "rajgeera" (die Koning se graan), op groot skaal verbou as hulpvoedselgewas van Kasjmir tot Arunachal Pradesh en word dikwels opgepak om gebruik te word in soetgoed wat "laddoos" genoem word (Vietmeyer, 1978). wat baie soortgelyk is aan Mexikaanse 'alegria'. In Nepal word Amaranthus-sade geëet as pap wat "sattoo" genoem word of tot 'n meel gemaal word om chappatis te maak (Vietmeyer, 1978 Singhal & Kulkami, 1988). Amaranthusblare word gebruik in vla, pasta, sop, bredies, slaai, gekook en gemeng met 'n grondboonsous (Oliveira & de Carvalho, 1975 Nasionale Navorsingsraad, 1984).

      Verskeie spesies Amaranthus (A. blitum, A. caudatus en A. spinosus) word as groente verbruik in Afrika, Karibiese Eilande, China, Griekeland, Indië, Italië, Nepal en Suid-Stille Oseaan-eilande (Stallknecht & Schulz-Schaeffer, 1993). Gebaseer op die benutting van gekweekte Amaranthus vir menslike gebruik, kan spesies verdeel word in graan en groente Amaranthus. Graan Amaranthus is nie 'n "ware graan" nie, maar dit behoort aan 'n groep graanagtige graangewasse of "pseudo-graangewasse" (O'Brien & Price, 1983). Pseudograne is tweesaadlobbige spesies wat nie nou verwant is aan mekaar of aan die eensaadlobbige ware graansoorte nie (Shewiy, 2002).

      Die Amaranthus-sade kan gemaal word en ingesluit word as 'n meelbestanddeel in verskillende mengsels vir beskuitjies, brood, koekies, beskuitjies, pannekoeke, bolletjies, muffins, noedels, pannekoeke, poedings en ander lekkergoed (National Research Council, 1984 Mlakar et al., 2009 Sanz-Penella et al., 2013) en ook die kombinasie van amarant en koringmeel verhoog die voedingswaarde van gebakte produkte (Saunders & Becker, 1984 Segura-Nieto et al., 1994 Mlakar et al., 2009).

      Amaranthus het antiallergiese, antikanker-, antihipertensiewe en antioksidante eienskappe (Conforti et al, 2005 Castelano-Sousa & Amaya-Farfan, 2012) en beskerm teen verskeie afwykings soos bloedingneigings, breinberoerte, coeliakie, gebrekkige visie, diabetes, spysverteringsteuring, funksionele steriliteit, bloeding, hartsiektes, MIV/VIGS, hipertensie, kwashiorkor, leukorree, lewersiekte, marasmus, voortydige veroudering, herhalende verkoues, respiratoriese infeksies, vertraagde groei, velsiektes, TB en wondgenesing (Thompson, 2001).

      Phytoremediation Potensiaal van Genus Amaranthus

      Die opname van swaar metale deur Amaranthus-spesies is onlangs bestudeer in grond by vullisstortingsterreine, diere-afvalstortingsterreine en ander vorme van besmette gronde (Adekunle et al, 2009 Adefila et al., 2010 Adefemi et al., 2012 Akubugwo et al. , 2012 Shagal et al., 2012). A. caudatus-plante wat op stortingsterreine gekweek word, bevat hoër konsentrasies swaar metale soos Fe, Cu, Pb, Zn, Mn, Cd (Adewuyi et al, 2010). A. hybridus wat op stortingsterreine gekweek is, het hoër konsentrasies swaar metale soos Fe, Zn, Cd, Cr, Cu, Ni, Pb, Mn en Hg besit (Akubugwo et al., 2012). Die assesserings van die swaarmetaalinhoud van plante wat op stortingsterreine gekweek word, verskaf waardevolle data oor die swaarmetale fitoakkumulasiepotensiaal van sulke plante (McIntyre & Lewis, 1997). A. retroflexus is geïdentifiseer as metaalakkumulator (Bigaliev et al., 2003 Mellem, 2008). A. spinosus is 'n potensiële middel vir akkumulasie en translokasie van swaar metaal soos Cu, Zn, Cr, Pb en Cd (Chinmayee et al., 2012). A. tricolor het 'n hoë kadmium-akkumulerende vermoë (Watanabe et al., 2009). A. viridis het 'n metode om swaar metale veral Pb en Cd in sy weefsels te konsentreer (Atayese et al., 2009). Dit dui daarop dat hierdie Amaranthus spesies kan dien as fitoakkumuleerders van swaar metale en gebruik kan word vir die doel van Phytoremediation.

      Geslag Amaranthus bestaan ​​uit sommige van die ergste [C. sub.4] onkruide ter wêreld (Holm et al., 1977), en die verskillende spesies daarvan is deurgaans onder die top 10 moeilikste onkruide in die suidooste van die Verenigde State (Dowler, 1995 Webster, 2009), wat sedert die middel-1990's probleme vir aanhangers veroorsaak het. Nege Amaranthus-spesies word as "indringer- of skadelike onkruide" in die USDA-plantedatabasis gelys, en 'n bykomende 20 spesies word as "landbou-onkruide" in die Global Compendium of Weeds (Randall, 2007 USDA, NRCS, 2010) gelys.

      Verskeie Amaranthus spesies soos A. retroflexus, A. spinosus en A. viridis (Yan et al., 2001), A. blitum (Costea & Tardif, 2003), A. albus, A. powellii en A. rudis (Ortiz Ribbing) & Williams, 2006) en A. palmeri (Kendig, 2009), is bekend daarvoor dat hulle meeding met baie ekonomiese gewasse, insluitend graan en groente in verskillende wêrelddele en groot opbrengsverliese veroorsaak (Holm et al., 1977 Menges, 1988 Monks & Oliver, 1988). Daar word na die onkruidagtige Amaranthus-spesies verwys as "opportuniste" (Sauer, 1955) vanweë die feit dat hulle in versteurde gronde floreer en geneig is om met landboupraktyke geassosieer te word. Hulle kan meeding met gewasse vir water, voedingstowwe en lig, wat ernstige opbrengste, kwaliteit en oesdoeltreffendheid verlaag (Vangessel & amp; Renner, 1990), en hul hoë mededingendheid hou moontlik verband met hul vrugbare saadproduksie, langdurige lewensvatbaarheid van saad, saadrus. , spoed en tydsberekening van ontkieming, lang ontkiemingsperiode, aggressiewe groei by hoër temperature as gevolg van sy uitgebreide wortelstelsel, termostabiliteit van die [C.sub.4] fotosintetiese meganisme, hoë waterverbruik doeltreffendheid en hoë digtheid van besmetting (Weaver & McWilliams , 1980 Knezevic & Horak, 1998 Horak & Loughin, 2000 Aguyoh & Masiunas, 2003 Massinga et al., 2003), wat verder verbeter word as gevolg van evolusie van onkruiddoder-weerstandige Amaranthus-biotipes (Heap 2014). Boonop wissel hul mededingendheid met spesie, digtheid en opkomstyd relatief tot die gewas (Klingaman & Oliver, 1994 Knezevic & Horak, 1998).Allelopatiese effekte kan ook interaksie hê met mededinging om hulpbronne tussen sommige Amaranthus-spesies en die gewas waarin hulle groei (Connick et al., 1987 Bradow & Connick, 1988 Menges, 1988).

      A. blitum word gelys as 'n ernstige of hoofonkruid in tien lande, hoofsaaklik regoor Europa en Asië (Holm et al., 1979 Takabayashi & Nakayama, 1981 Walter & Dobes, 2004) en kom in 'n wye verskeidenheid veld- en tuinbougewasse voor. , grasveld, boorde, plantasies en wingerde.

      A. palmeri is die lastigste onkruid in die suidooste van die Verenigde State (Dowler, 1995 Norsworthy, 2003), en dit is bekend dat dit ernstige inmenging en opbrengsverlies in verskeie agronomiese gewasse soos Arachis hypogaea veroorsaak (Horak & Loughin, 2000 Burke et al., 20007, 2000). ), Glycine max (Monks & Oliver, 1988 Klingaman en Oliver 1994 Dieleman et al., 1995 Bensch et al., 2003 Norsworthy, 2003), Gossypium hirsutum (Keeley & Thullen, 1989 Dowler19 et al., 9197 Roodland et al. al., 1999 Smith et al., 2000 Morgan et al., 2001), Ipomoea batatas (Meyers et al., 2010), Sorghum bicolor (Moore et al., 2004), en Zea mays (Massinga et al., 2001 Massinga & Currie, 2002 Massinga et al., 2003).

      A. retroflexus, een van die tien onkruidspesies van grootste ekonomiese belang in Europa (Schroeder et al., 1993) is 'n algemene onkruid van bewerkte landerye in baie landbougebiede van die wêreld (Weaver & McWilliams 1980 Horak & Loughin, 2000), wat in staat is om te besmet en opbrengste van gewasse soos Beta vulgaris, Brassica napus (Hendrick et al., 1974), Glycine max (Orwick & Schreiber, 1979 Dieleman et al., 1995 Cowan et al., 1998 Bensch et al. 2003), Gossypium hirsutum (Buchanan et al., 1980), Helianthus annus (Heidarian et al., 2012), Phaseolus sp. (Aguyoh & Masiunas, 2003), Solanum tuberosum (Vangessel & Renner, 1990), Zea mays (Knezevic et al., 1994). en ander groente (Weaver & McWilliams, 1980).

      A. spinosus is aangemeld as 'n onkruid in 28 gewasse en 44 lande in Indië, Suidoos-Asië en die weste en suide van Afrika (Waterhouse, 1994 Chauhan en Johnson 2009). Dit kom voor as 'n onkruid van verskillende betekenis in 'n verskeidenheid gewasse soos Ananas comosus, Arachis hypogaea, Celosia argentia, Corchorus olitorius, Glycine max, Gossypium hirsutum, Oryza sativa, Saccharum ofjicinamm, Soighum al bicolor, Zea yemi may0, Zea 200 ets. Ogunyemi et al., 2005 Chauhan & Johnson, 2009) en tuinbou-ondernemings (Waterhouse, 1994). ’n Merkwaardige voorbeeld van onlangse onkruid-indringing is dié van A. tuberculatus in com- en sojaboonlande in die sentrale Verenigde State oor die afgelope twee dekades (Steckel, 2007). A. tuberculatus is die eerste keer aangeteken as 'n landbou -onkruid in die koringlande in Illinois (Sauer, 1957) en het sedert die negentigerjare 'n groot onkruid geword (Trucco et al. 2009). Opbrengsverliese wat veroorsaak word deur inmenging van verskillende ander spesies Amaranthus is aangemeld vir talle gewasse (Moolani et al., 1964 Rushing et al., 1985 Bensch et al., 2003 Hartzler et al., 2004).

      Allelopatiese effekte van verskillende Amaranthus -spesies op verskillende plante is aangemeld (tabel 5). Droë oorblyfsels van die luggedeelte van A. retroflexus het die ontkieming van Beta vulgaris, Brassica oleracea, Brassica oleracea var verminder. brotrytis, Capsicum annuum, Carthamus tinctorius, Cucumis sativus, Cucurbita ovifera, Daucus carota. Glycine max, Gossypium hirsutum, Helianthus annus, Hordeum vulgare. Lactuca sativa, Lycopersicon lycopersici, Phaseolus vidgaris, Solanum melongena. Sorghum bicolor en Zea mays (Munger et al., 1983 Qasem, 1995a, b Alam et al., 2001 Aguyoh & Masiunas, 2003 Costea & Tardif, 2003 Dos Santos et al., 2004 Rezaie 1,209 et al.) .

      Lootreste van A. retroflexus het radikel- en hipokotielverlenging geïnhibeer, inmeng met fotosintese, verminderde groei, voedingstofopname en produktiwiteit van Zea mays (Bhowmik & Doll, 1980, 1982, 1984) en verlaagde respirasie, relatiewe groeitempo (RGR), netto assimilasie tempo (NAR), wortel vars gewig (FWR), stikstofbinding van knoppe, chlorofilinhoud en biomassaproduksie in Glycine max (Bhowmik & Doll, 1980, 1982, 1984 Chaniago et al., 2006) verminder groei en opbrengs in Nicotiana tabacum ( Lolas, 1981 Lolas, 1986) beïnvloed die groei en vestiging van gewone boontjies (Shimi & Termeh, 2004) en verminder die saffloeropbrengs (Williams et al., 2005) deur die vrystelling van allelochemikalieë, maar. die remming is nie merkbaar beïnvloed deur temperatuur of lig nie (Bhowmik & Doll, 1983). Gedroogde lootreste van A. retroflexus, A. blitoides en A. gracilis het ontkieming, koleoptiellengte, wortellengte, worteldroë gewig, planthoogte, graan- en strooiopbrengs van Triticum aestivum verminder (Qasem, 1995b Shahrokhi et al., 2012) en verminderde produktiwiteit van Hordeum vulgare veroorsaak (Qasem, 1994, 1995a).

      Allelopatiese effekte van A. palmeri is gerapporteer op saailingopkoms van verskeie spesies (Menges, 1987, 1988). Ekstrakte van A. palmeri het saadontkieming en groei van Daucus carrota en Allium cepa geïnhibeer (Altieri en Doll 1978 Bradow & Connick, 1987 Menges, 1987). Dampe van 2-heptanoon en 2-heptanol, geïsoleer van A. palmeri, het die ontkieming van uie-, wortel-, tamatie- en palmer-amarantsaad belemmer (Connick et al., 1987). Menges, (1988) het fitotoksisiteit van A. palmeri-reste gerapporteer op groei van verskeie gewasspesies, insluitend Sorghum bicolor, Brassica oleracea var. Capitata, Daucus carrota en Allium cepa. Wateroplosbare ekstrakte van A. palmeri was meer fitotoksies as ekstrakte van A. retroflexus (Hicks et al., 1986).

      Allelopatiese effekte van A. spinosus is gerapporteer (Shrefler et al., 1996). Uittreksel van blare en bloeiwyse van A. spinosus het die vegetatiewe en reproduktiewe fases van Sinapis alba en T. aestivum drasties verminder (Datta & Bandyopadhayay, 1981). Uitgelekte komponente van A. spinosus toon 'n sterk allelopatiese effek op die groei en vestiging van Parthenium hysterophorus (Chikkalingaiah & Mahadevappa, 1998) en ook op die groei van sommige kulture (Suma, 1998).

      Verbrande reste van A. viridis verminder die groei en produktiwiteit van Pennisetum americanum (Singhal & Sen. 1981). Die waterige ekstrakte van A. dubius is ook inhiberend gevind vir saailinge-opkoms en groei van verskeie plantspesies (Altieri & Doll, 1978). Droë lootekstrakte van A. hybridus het die totale chlorofil-inhoud, aantal ontwikkelde blare, stamlengte en totale plantdroëmateriaal van droëbone negatief beïnvloed (Amini et al., 2013).

      Daar is gevind dat allelochemikalieë soos aldehiede, alkaloïede, apokarotenoïede, flavonoïede, steroïede, xyloïede, klerogeniese suur en saponiene (Anaya et al., 1987 Aim et al., 2002), afgeskei deur lugorgane van Amaranthus-plante deur middel van reën vrygestel word. of besproeiingswater na die grond (Anaya et al., 1987 Al-Khatib, 1995 Khanh et al., 2005).

      Fischer en Quijano (1985) geïsoleer fitol, chondrillasterol, vanillien, 3-methoxy-4hydroxy nitrobenzeen, en 2, 6-dimethoxy-benzoquinone van A. palmeri. Kumariene is geïsoleer van A. retroflexus (Rezaie & Yarnia, 2009). Die belangrikste allelochemikalieë wat in A. spinosus teenwoordig was, was fenolzure, alkaloïede wat tot die kinolisidienklas behoort, steroïde-, indol- en sesquiterpeenlaktone (Narwall 1994 Qasem 1995a Velu & Ali, 1995 Suma, 1998). Die hoeveelheid fenolsure in A. spinosus was die grootste in plante wat groei in gronde wat besmet is met huishoudelike, industriële en voertuigreste (Suma, 1998), terwyl die konsentrasie van fenolsure in die plant die hoogste in die blare was, gevolg deur stingels, bloeiwyse en die laagste in die wortels (Souza et al., 2011).

      Onkruidagtige Amaranthus-spesies is moeilik om te beheer weens hul produktiewe saadproduksie (200 000 tot 600 000 sade/vroulike plant), klein saadgrootte, vermoë om suksesvol met ander Amaranthus-spesies te kruis, lang ontkiemingsperiode, hoë digtheid van besmetting, vermoë om vinnig onkruiddoder te ontwikkel weerstand en probleme met die korrekte identifisering (Stevens, 1932 Keeley et al., 1987 Dillon et al., 1989 Horak, 1997 Wetzel et al., 1999a, b Sellers et al., 2003 Vigueira et al., 2013). Alhoewel, behoorlike identifikasie van Amaranthus spesies moeilik kan wees, is dit belangrik as gevolg van wisselende reaksies op onkruiddoders en onkruidbestuurspraktyke (Pratt et al, 1999).

      Skadu kan 'n onderdrukkende effek hê op onkruidsaadgenerering, aangesien dit die grond se amplitude demp en die ligkwaliteit verander wat waargeneem word deur sade wat op die grondoppervlak lê (Fortin & Pierce, 1990 Batlla et al., 2000 Norsworthy, 2004). Onder 'n afdak, behalwe die vermindering van PAR, ervaar sade 'n afname in die verhouding rooi: verrooi (R: FR) as gevolg van 'n toename in verrooi (FR) oordraagbare lig (Taylorson & ampBorthwick, 1969 Thompson & Grime, 1983 Sattin et al. 1994 Norsworthy 2004), wat die ontkieming van verskillende Amaranthus -spesies, soos A. hybridus, A. palmeri, A. retroflexus en A. rudis, belemmer (Taylorson & Borthwick, 1969 Gallagher & Cardina, 1998a, 1998b Hartzler et al., 1999 Leon & Owen 2003 Jha et al., 2008c). Skadu van die moederplant in A. retroflexus het gelei tot verminderde saaddormansie onder kortdag (8 uur lig) en verhoogde saaddormansie onder langdag (16 uur lig) toestande (Kigel et al., 1977). Washitani (1985) en Brainard et al. (2005) het ook 'n blaarkap-effek op verhoogde saaddormansie van A. patulus gerapporteer. Die ontkiemingspersentasie van A. powellii-sade was 50% laer vir sade wat op plante wat onder skadu gegroei het, as in oop sonlig verouder (Brainard et al., 2005).

      Grondbewerking is 'n belangrike meganisme vir vertikale beweging van onkruidsade in grond (Buhler et al., 1997, 2001). In 'n geenbewerkingstelsel word onkruidsade in die boonste 5 cm van die grondprofiel gekonsentreer relatief tot konvensionele bewerkingstelsels (Cardina et al., 1991 Buhler, 1992 Clements et al., 1996), wat onkruide met klein sade toelaat as varkbosse om makliker uit vlak dieptes te kom (Webb et al., 1987 Buhler et al., 1996 Oryokot et al., 1997a Ghorbani et al., 1999). Stimulering van ontkieming en daaropvolgende opkoms na bewerking was moontlik te wyte aan verhoogde gronddeurlugting, verbeterde grond-saadkontak en verhoogde grondtemperature (Litch en Al-Kaisi 2005 Leon en Owen 2006 Norsworthy en Oliveira 2007). Alhoewel hoë vermindering van Amaranthus deur die bewerkingstelsel belowend is, is dit tog nie voldoende nie. 'n Beheer van ongeveer 90% is nie bevredigend nie, want in lae digthede produseer die oorlewende Amaranthus-plante meer sade per plant as in hoë digthede (Burki et al., 1997).

      Sny is ook nie 'n doeltreffende opsie vir beheer van verskeie Amaranthus-spesies nie, want sodra hulle gesny is, bons hulle terug en begin prostreer groei, produseer lewensvatbare saad en voltooi hul lewensiklus as maai nie volgehou word nie. Daarom kan onkruiddoders 'n meer effektiewe opsie wees om hierdie spesies te beheer, as om te sny.

      Onkruiddoders is koste-effektiewe en doeltreffende hulpmiddels vir onkruidbeheer in moderne landbou. 2,4-D (Szmedra, 1997), Aminocyclopyrachlor (DuPont, 2009), Aminopyralid (Burch et al., 2005), Dicamba (Senseman et al., 2007), Pendimethalin (Malefyt en Duke, 1984), is sommige van die algemeen gebruikte onkruiddoders vir breëblaaronkruidbeheer in die wêreld. Vroeg tot middelseisoen (vroeg Mei tot laat Junie) onkruiddodertoedienings (Dieleman et al. 1996) met 'n vroeë oesblaarsluiting sal 'n belowende strategie wees om verskillende Amaranthus-spesies te bestuur (Jha et al., 2008a, 2008b). Steckel (2004) het gerapporteer dat Amaranthus-spesies in verskeie rygewasse die beste bestuur kan word wanneer 'n vooraf-toegediende onkruiddoder gevolg word deur 'n na-toegediende onkruiddoder of wanneer 'n na-toegediende onkruiddoder gevolg word deur 'n ander na-toegediende onkruiddoder, wat 'n residuele produk bevat. Alhoewel baie tans geëtiketteerde grondtoegediende onkruiddoders soos 2,4-D, Banvel[R] of Clarity[R] (dicamba), Cimarron[R] (metsulfiiron), Cimarron Max[R] (metsulfixron +2,4-D+ dicamba) ), Distinct [R] (diflufenzopyr + dicamba), Grazon P + D [R] (picloram + 2,4-D), Milestone [R] (aminopyralid) or ForeFront R & ampP [R] (aminopyralid + 2,4-D ), Roundup [R] (glifosaat), Surmount [R] (picloram + fluroxypyr) en Weedmaster [R] (dicamba + 2,4-D) het goeie beheer oor verskillende Amaranthus-spesies verskaf, maar probleme met beheer is aangemeld (Fritz & Hartwig, 1986 Fuerst et al., 1986 Mayo et al., 1995 Grichar, 1997 Steckel, 2004 Green et al. 2006 Boyd, 2008). Met behoorlike onkruiddoderseleksie is 90% beheer van A. albus, A. palmeri, A. retroflexus en A. rudis moontlik (Sweat et al., 1998). Boonop mag dit nodig wees om twee tot drie onkruiddodertoedienings te maak om dit die hele seisoen effektief te beheer (Ferrell & Sellers, 2007).

      Onkruiddoderweerstand in Amaranthus-spesies

      Die enigste afhanklikheid van onkruiddoders het gelei tot die ontwikkeling van onkruiddoderweerstand by onkruide (Heap, 2014). Onkruiddoder-weerstandige biotipes van Amaranthus-spesies het in baie lande ontwikkel (Barralis & amp; Gasquez, 1987). Daar word gerapporteer dat ten minste een Amaranthus-onkruidspesie weerstandbiedend is teen een of meer onkruiddodergroepe in nege-en-twintig Amerikaanse state (Sellers et al., 2003). Die teenwoordigheid van onkruiddodertoleransie-eienskappe laat vrae ontstaan ​​oor hoe om bestuurskwessies op 'n produsente-, provinsie- en streekvlak aan te spreek (Cardina et al., 1999). Evolusie van weerstand teen glifosaat, die wêreld se mees gebruikte onkruiddoder met doeltreffende breëspektrum onkruidbeheer, is 'n beduidende probleem wat wêreldlandbou in die gesig staar (Powles, 2008 Webster & Sosnoskie, 2010).

      Onkruiddoder-weerstandige biotipes van A. blitum is gerapporteer uit Noord-Amerika, Europa en Asië wat weerstand ontwikkel het teen verskillende onkruiddoders insluitend ALS-inhibeerders, Atrazine en Paraquat (Itoh et al., 1992 Manley et al., 1996 Heap, 2014). A. palmeri het weerstand teen verskillende onkruiddoders ontwikkel, insluitend asetolaktaat sintase (ALS) inhibeerders, dinitroanilien, glifosaat, imidazolinoon, sulfonielureum en triasien (Gossett et al, 1992 Horak & Peterson, 1995 Sprague et al., 1997 Peterson, 1999 Franssen et al. 2001a Culpepper et al. 2006 Steckel et al., 2008 Vencill et al., 2008 Wise et al. 2009 Price et al., 2011 Heap, 2014). Ook A. rudis en A. retroflexus biotipes met weerstand teen glifosaat, triasien of asetolaktaat sintase-inhiberende onkruiddoders is aangemeld (Horak & Peterson, 1995 Peterson, 1999 Price et al, 2011). Voor die onlangse voorkoms van glifosaatweerstand by A. palmeri (Culpepper et al, 2006 Mueller et al., 2006 York et al., 2007 Culpepper et al., 2008 Norsworthy et al. 2008 Steckel et al., 2008 Gaines et al. ., 2010 Price et al., 2011), was glifosaat baie effektief in die bestryding van hierdie onkruid (Scott et al., 2002 Norsworthy, 2004, 2005 Bond et al., 2006), wat bygedra het tot die snelle aanvaarding van glifosaatbestande sojabone en katoen regdeur die suidelike Verenigde State. 'N Opname onder produsente in Georgië het aan die lig gebring dat die teenwoordigheid van glifosaatweerstandige A. palmeri in landerye die bestuurskoste met 58%verhoog het, van $ 81 ha21 tot $ 129 ha21 (Culpepper & Kichler, 2009).

      A. tuberculatus het weerstand ontwikkel teen vyf verskillende chemiese klasse onkruiddoders: Acetolactate sintase (ALS) inhibeerders (Horak & Peterson, 1995 Foes et al., 1998 Tranel & Wright, 2002 Patzoldt & Tranel, 2007 Nordby et al.), 2007 Nordby et al. glifosaat (Legleiter en Bradley 2008 Nandula et al. 2013), p-hydroxyphenylpyruvaat dioxygenase (HPPD) inhibeerders (Hausman et al. 2011), Photosystem II (PSII) inhibeerders, ook genoem triasiene (Anderson et al., Protoporphyrinogen en 1996), oksidase (PPO) inhibeerders (Shoup et al., 2003), verder het sommige populasies weerstand teen veelvuldige onkruiddoderklasse ontwikkel (Tranel et al., 2004 Falk et al., 2005 Patzoldt et al., 2005 Mcmullan & Green, 2011 Bell et al., 2013). Terselfdertyd blyk dit dat ALS-weerstand geen fiksheidskoste in onkruiddodervrye omgewings in sommige Amaranthus-spesies inhou nie (Sibony & Rubin, 2002 maar sien Tardif et al, 2006).

      Biologiese beheer van Amaranthus -spesies

      Oormatige gebruik van onkruiddoders het probleme tot gevolg gehad, insluitend besoedeling van oppervlak- en grondwaterbronne (Guzzella et al., 2006 Spalding et al., 2003), en verskeie menslike gesondheidsrisiko's (EPA, 2007). Die groeiende openbare kommer oor plaagdoderreste in ons voedsel en omgewing, en die toenemende openbare druk vir meer volhoubare gewasproduksiemetodes het gelei tot 'n toenemende belangstelling in geïntegreerde onkruidbeheerstrategieë vir Amaranthus -spesies (Burki et al., 1997), gebaseer op meganiese , fisiese of biologiese beheer. Talle onkruidagtige Amaranthus-spesies is gekies vir biologiese beheernavorsing binne die raamwerk van COST (European Cooperation in the Field of Scientific and Technical Research) Aksie (Muller-Scharer, 1993).

      Verskeie insekte wat as biologiese bestrydingsmiddels vir verskillende Amaranthus -spesies gepromoveer word (soos A. caudatus, A. hybridus, A. retroflexus, A. spinosus, A. viridis) is: Disonycha glabrata (Garman, 1892 Vogt & amp Cordo, 1976 Balsbaugh et al., 1981 Tisler, 1990), Chaetocnema tibialis (Cagan et al., 2000), Cassida nigriventris en Coleophora versurella (Khan et al., 1978), Hypolixus truncatidus (Napompeth, 1982, 1989, Julien2), 19 Hypolixus nubilosus (Kolaib et al., 1986 Lopez et al., 2011 Torres et al., 2011 Kagali et al., 2013), Haplopeodes minute (Spencer & Steyskal, 1986), Epicauta leopardina (Schuester, 1987 amar), Melanagromyza amar, 1987 Spencer & Havranek, 1989), Pellucidus Vittula (Cagan et al., 2000), en Hepertogramma bipunctalis (Lopez et al., 2011 Kagali et al., 2013).

      Erwinia carotovora var. rhapontici (Kataryan, 1975 Mendoza & Rodriguez, 1990), Gliocladium virens (Howell & Stipanovie, 1984) is 'n paar voorbeelde van bakterieë wat as biobeheermiddels vir verskeie Amaranthus spesies gebruik kan word. Belowende patogene wat as potensiële bio-onkruiddoder of miko-onkruiddoder vir Amaranthus gebruik kan word, sluit in: Aposphaeria amaranthi (Mintz & Weidemann, 1992) Microsphaeropsis amaranthi (Ortiz Ribbing & Williams, 2006), Phomopsis amaranthicola (Charudatan & amp; amp; 60, 1994, 1994, 1992) alternata (Ghorbani et al., 2000).

      Allelopatie kan ook 'n nuttige manier van biologiese onkruidbeheer wees, veral wanneer dit in plaagbestuurstelsels geïntegreer word, wat die afhanklikheid van sintetiese onkruiddoders verminder. 'n Onlangse sifting vir inhiberende aktiwiteit teen A. spinosus het verskeie plante met onkruiddodende aktiwiteit geïdentifiseer (Rizvi & Rizvi, 1992). Macharia en Peffiey (1995) het die allelopatiese effek van Allium fistidosum en A. cepa genotipes op plantgroei en saadontkieming van A. spinosus gerapporteer. Waterige ekstrakte van weefsels van sommige plante soos Artemisia annua, Cirsium arvense, Fagopyrum esculentum, Helianthus annuus, Rumex crispus en Sorghum halepense verminder die ontkieming van A.retroflexus (Costea et al, 2004 Haramoto & Gallandt, 2005). Hierdie plante kan dus as biologiese beheermiddels optree.

      Die moontlike botsing van belange tussen die behoefte aan effektiewe biologiese beheer van skadelike Amaranthus -spesies om groot gewasverliese te voorkom en onkruiddodertoediening in stelsels van volhoubare landbou te verminder, enersyds, en die potensiële ekonomiese waarde van sekere Amaranthus -spesies as gewasse, aan die ander kant , moet bespreek en opgelos word. Die belangrike punt is dat middels wat gebruik word in die oorweldigende biobeheer van skadelike Amaranthus spesies nie gewas Amaranthus in gevaar moet stel nie (Burki et al., 1997).

      Die hoë voedingswaarde van Amaranthus sade, funksionele potensiaal, kort lewensiklus, vinnige groei, aanpasbaarheid by ongunstige klimaat en grondtoestand, droogtetoleransie en die voedselgebruik van die hele plant, is die rede vir toenemende navorsingsbelangstelling in hierdie pseudocereal. Dit is 'n voedsel vir toekomstige gewas vir baie ontwikkelende lande, veral in droogte-geneigde gebiede van Afrika en Asië. Geslag Amaranthus bestaan ​​egter uit 'n paar van die lastige indringende of skadelike onkruide van die wêreld waarvan bekend is dat dit met baie ekonomiese gewasse in verskillende dele van die wêreld kan meeding, wat groot opbrengsverliese tot gevolg het. Daarom is uitgebreide navorsing nodig om tussen die goeie en slegte Amaranths te kies.

      Adefemi, O. S., O. A. Ibigbami & E. E. Awokunmi. 2012. Vlak van swaar metale in sommige eetbare plante versamel vanaf geselekteerde stortingsterreine in Ekiti-staat, Nigerië. Global Advanced Research Journal of Environmental Science and Toxicology 1: 132-136.

      Adefila, E. O., C. T. Onwordi & I. A. Ogunvvande. 2010. Vlak van die opname van swaar metale op groente wat op pluimvee -afval geplant word. Archives of Applied Science Research 2: 347-353.

      Adekunle, I. M., O. Olorundare & C. Nwange. 2009. Assesserings van loodvlakke en daaglikse inname van groen blaargroentes van suidwes Nigerië. Voeding en Voedselwetenskap 39: 413-422.

      Adewuyi, G. O., F. A. Davvodu & N. N. Jibiri. 2010. Studies oor die konsentrasievlakke van swaar metale in groente (Amaranthus caudattts) wat op stortterreine in Lagos Metropolis, Nigerië, gegroei het. Pacific Journal of Science and Technology 11: 616-620.

      Aguyoh, J. N. & J. B. Masiunas. 2003. Interferensie van herwortelvarkbos (Amaranthus retroflexus) met snapbone. Onkruidwetenskap 51: 202-207.

      Akubugwo, E. I., A. Obasi, G. C. Chinyere, E. Eze, O. Nwokeoji & E. A. Ugbogu. 2012. Phytoaccumulion effekte van Amaranthus hybridus L. gegroei op buwaya vullis stortingsterreine in Chikun, Nigerië op swaar metale. Tydskrif vir Biodiversiteit en Omgewingswetenskappe 2: 10-17.

      Alam, S. M., S. A. Ala, A. R. Azmi, M. A. Khan en R. Ansari. 2001. Allelopatie en die rol daarvan in die landbou. Tydskrif vir Biologiese Wetenskappe 1: 308-315.

      Al-Khatib, K. 1995. Onkruidbeheer in koring. Washington State University Cooperative Extension, pp. 244-364.

      Aim, D. M., M. E. Mcgiffcn & J. D. Hesketh. 1991. Onkruidfenologie. In: Hodges T, ed Voorspel gewasfonologie. Boca Raton: CRC Press 191-218.

      --, S. M. Khan, S. M. Mujtaba & A. Shereen. 2002. Invloed van waterige blaarekstrak van gewone lamsvleis en NaCl -soutgehalte op die ontkieming, groei en voedingsinhoud van koring. Acta Physiologiae Plantarum 24: 359-364.

      Altieri, M. A. & amp; J. D. Doll. 1978. Die potensiaal van allelopatie as 'n hulpmiddel vir onkruidbestuur in gewaslande. PANS 24: 495-502.

      Al-Turki, T. A., S. A. Fllfilan en S. F. Mehmood. 2000. 'n Sitologiese studie van blomplante uit Saoedi-Arabië. Willdenowia 30: 339-358.

      Amini, R., S. Ghanepour & F. Movahedpour. 2013. Morfofisiologiese en fenologiese veranderinge veroorsaak deur gladde amarant allelopatiese effekte in verskillende soorte droëbone. Internasionale Tydskrif vir Landbou en Gewaswetenskappe 5: 120-124.

      Anaya, L., L. Ramos, R. H. Cruz, J. G. Fernandez & V. Nava. 1987. Perspektiewe op allelopatie in Mexikaanse tradisionele agro -stelsels: 'n Gevallestudie in Taxcala. Tydskrif vir Chemiese Ekologie 13: 2083-2101.

      Anderson, R.L. & D.C. Nielsen. 1996. Opkomspatroon van vyf onkruide in die sentrale groot vlaktes. Onkruidtegnologie 10: 744-749.

      Anderson, D. D., F. W. Roeth en A. R. Martin. 1996. Voorkoms en beheer van triasienweerstandige gewone waterhennep (Amaranthus rudis) in veldmielies (Zea mays). Onkruid Tegnologie 10: 570-575.

      Atayese, M. O., A. I. Eigbadon, K. A. Oluwa & amp; J. K. Adesodunl. 2009. Swaarmetaalbesmetting van Amaranthus groei langs die groot snelweë in Lagos, Nigerië. African Crop Science Journal 16: 225-235.

      Balsbaugh, E. U., R. D. Frye Jr., C. G. Scholl en A. W. Anderson. 1981. Insekte vir onkruidbeheer: status in Noord -Dakota. Noord-Dakota Plaasnavorsing 39: 3-7.

      Baquar, S. R. & amp; O. O. Olusi. 1988. Sitomorfologiese en filogenetiese studies van die genus Amaranthus uit Nigerië. Kromosomo 51: 1665-1674.

      Barralis, G. & J. Gasquez. 1987. Ondersoeke oor onkruiddoderbestande onkruide. Nuusbrief van die European Weed Research Society 38: 5-10.

      Baskin, I. J. & amp C. C. Baskin. 1977. Rol van temperatuur in die ontkiemingsekologie van drie eenjarige someronkruide. Occologia 30: 377-382.

      Baskin, J. M. & amp C. C. Baskin. 1985a. Seisoenale veranderinge in die ontkiemingsreaksies van begrawe Witchgrass (Panicum capillare) sade. Onkruidwetenskap 34: 22-24.

      --&--. 1985b. Die jaarlikse rustydsiklus in begrawe onkruidsade: 'n kontinuum. Bioscience 35: 492-498.

      --&--. 1987. Temperatuurvereistes vir na-rypwording in begrawe sade van vier eenjarige someronkruide. Onkruidnavorsing 27: 385-389.

      --&--. 1990. Die rol van lig en afwisselende temperature by ontkieming van Polygonum aviculare sade wat op verskillende datums opgegrawe is. Onkruidnavorsing 30: 397-102.

      --&--. 1998. Saad: Ekologie, biogeografie en evolusie van rus en ontkieming. San Diego: Academic Press pp. 27-200.

      Batlla, D., B. C. Kruk & R. L. Benech-Arnold. 2000. Baie vroeë opsporing van blaredak teenwoordigheid deur sade deur persepsie van subtiele modifikasies in R: FR seine. Functional Ecology 14: 195-202.

      Becker, R., E. L. Wheeler, K. Lorenz, A. E. Stafford, O. K. Grosjean, A. A. Betschart & amp; R. M. Saunders. 1981. 'n Komposisiestudie van amarantgraan. Tydskrif vir Voedselwetenskap 46: 1175-1180.

      Behera, B. & amp; S. N. Patnaik. 1974. Sitotaksonomiese studies in die familie amaranthaceac. Cytologia 39: 121-131.

      --&--. 1977. Genoomanalise van Amaranthus dubius Mart, oud Thell. deur die studie van A. spinosus x A. dubius basters. Proceedings of Indian Science Congress Association 64: 144.

      --&--. 1982. Genoomanalise van Amaranthus dubius Mart, oud Thell. deur die studie van Amaranthus spinosus x A. dubius basters. Cytologia 47: 379-389.

      Bell, M. S., A. G. Hager & P. ​​J. Tranel. 2013. Veelvuldige weerstand teen onkruiddoders van vier plek-van-aksie groepe in waterhennep (Amaranthus tubereulatus). Onkruidwetenskap 61: 460-468.

      Benech-Arnold, R. L., C. M. Ghersa, R. A. Sanchez & P. ​​Insausti. 1990. Temperatuureffekte op dormansievrystelling en ontkiemingstempo in Sorghum halepense (L.) Pers. sade: 'n kwantitatiewe analise. Onkruidnavorsing 30: 81-89.

      --, R. A. Sanchez, F. Forcella, B. C. Kruk & C. M. Ghersa. 2000. Omgewingsbeheer van rus in onkruidsaadbanke in grond. Veldgewassenavorsing 67: 105-122.

      Bensch, C. N., M. J. Horak en D. Peterson. 2003. Inmenging van rooi wortelblaar (Amaranthus retroflexus), Palmer amarant (A. palmeri) en gewone watermelk (A. rudis) in sojabone. Onkruidwetenskap 51: 37-43.

      Benvenuti, S. 2003. Grondtekstuurbetrokkenheid by ontkieming en opkoms van begrawe onkruidsade. Agronomiejoernaal 95:191-198.

      --& M. Macchia. 1997. Ontkiemingsekofisiologie van boerbosluise (Bidens tripartite) soos aangetas deur lig en suurstof. Onkruidwetenskap 45: 696-700.

      --&--. 1998. Fitochroom-gemedieerde ontkiemingsbeheer van Datura stramonium L. sade na saadbegrafnis. Onkruidnavorsing 38: 199-206.

      -, M. Macchia & amp S. Miele. 2001. Kwantitatiewe ontleding van opkoms van saailinge uit begrawe onkruidsade met toenemende gronddiepte. Onkruidwetenskap 49: 528-535.

      Bewley, J.D. & M. Swart. 1994. Sade: fisiologie van ontwikkeling en ontkieming. Plenum. Berlyn.

      Bhowmik P. C. 1997. Onkruidbiologie: belangrikheid vir onkruidbestuur. Onkruidwetenskap 45: 349-356.

      --& J. D. Doll. 1980. Veldstudies oor allelopatiese effekte van onkruide en oesreste. In Proceedings North Central weed Control Conference 35: 82-83.

      --&--. 1982. Koring en sojabone reaksie op allelopatiese effekte van onkruid en oesreste. Agronomie Joernaal 74: 601-606.

      --&--. 1983. Groei-analise van mielie- en sorghumreaksie op allelopatiese effekte van onkruidreste by verskeie temperature en fotosintetiese fotonvloeddigthede. Tydskrif vir Chemiese Ekologie 9: 1263-1280.

      --&--. 1984. Allelopatiese effek van eenjarige onkruidreste op groei en voedingstofopname van mielies en sojabone. Agronomiejoernaal 76: 383-388.

      Bibbey, R. 0,1935. Die invloed van die omgewing op die voortplanting van onkruidsade. Scientia Agricola 16:141-150.

      Bigaliev, A., K. Boguspaev & E. Znanburshin. 2003. Fytoremediëringspotensiaal van Amaranthus sp. vir swaarmetale besmette grond van olieproduserende gebied. 10de Jaarlikse Internasionale Petroleum-omgewingskonferensie. Houston, al-Farabi Kazakh.

      Bonasora, M. G., L. Poggio en E. J. Greizerstein. 2013. Sitogenetiese studies in vier gekweekte Amaranthus (Amaranthaceae) spesies. Vergelykende sitogenetika 7: 53.

      Bond, J. A., L. R. Oliver en D. O. Stephenson. 2006. Reaksie van palmer amarant (Amaranthus palmeri) toetredings tot glifosaat, fomcsafcn en pyrithiobac. Onkruid Tegnologie 20: 885-892.

      Bouwmeester, H. J. & C. M. Karssen. 1992. Die dubbele rol van temperatuur in die regulering van die seisoenale veranderinge in rus en ontkieming van sade van Polygonum persicaria L. Oecologia 90: 88-94.

      Boyd, J. 2008. Weiding onkruid- en kwasbeheer. Universiteit van Arkansas.

      Bradow, J. M. en W. J. Connick. 1987. Allelochemikalieë van palmer amarant (Amaranthus palmeri S. Wats.). Tydskrif vir Chemiese Ekologie 13: 185-202.

      --&--. 1988. Saadontkiemingsinhibisie deur vlugtige alkohole en ander verbindings wat met Amaranthus palmeri-reste geassosieer word. Journal of Chemical Ecology 14: 1633-1648.

      Brainard, D. C., R. R. Bellinder en A. DiTommaso. 2005. Effekte van blaredakskadu op die morfologie, fenologie en saadkenmerke van Powell amarant (Amaranthus powelli). Onkruidwetenskap 53:175-186.

      Breene, W. M. 1991. Voedselgebruike van graan amarant. Cereal Foods World 36: 426-430.

      Brenner, D. M., D. D. Baltensperger, P. A. Kulakow, J. W. Lehmann, R. L. Myers, M. M. Slabbert & amp B. B. Sleugh. 2000. Genetiese hulpbronne en teling van Amaranthus. Plantteling Resensies 19: 227-285.

      Buchanan, G. A., R. H. Crowley, J. E. Street en J. A. McGuire. 1980. Kompetisie van sekelblom (Cassia obtusifolia) en wortelroos (Amaranthus retroflexus) met katoen (Gossypium hirsutum). Onkruidwetenskap 28: 258-262.

      Budin, J. T., W. M. Breen en D. H. Patnum. 1996. Enkele samestellende eienskappe van sade en olies van agt Amaranthus -spesies. Tydskrif van die American Oil Chemists 'Society 73: 475-481.

      Buhler, D. D. 1992. Bevolkingsdinamika en beheer van eenjarige onkruide in mielies (Zea mays) soos beïnvloed deur bewerking. Onkruidwetenskap 40: 241-248.

      --, T. C. Mester & K. A. Kohler. 1996. Die effek van mieliereste en bewerking op die opkoms van Setaria faberi, Abutilon theophrasti, Amaranthus retroflexus en Chenopodium album. Onkruidnavorsing 36: 153-165.

      --, R. G. Hartzler & F. Forcella. 1997. Implikasies van onkruid-sccdbank-dinamika op onkruidbestuur. Onkruidwetenskap 45: 329-336.

      -, K. A. Kohler & amp; R. L. Thompson. 2001. Onkruid saadbank dinamika tydens wisselbou van vyf jaar. Onkruidtegnologie 15: 170-176.

      Burch, P., R. Masters, E. S. Hagood, K. Bradley, W. W. Witt, K. Moore & amp; J. Breuninger. 2005. Aminopiralied: 'n Nuwe onkruiddoder vir geïntegreerde opknappingsprogramme.

      Burke, I. C., M. Schroeder, W. E. Thomas & J. W. Wilcut. 2007. Palmer amarant inmenging en saadproduksie in grondboontjiebotter. Onkruidtegnologie 21: 367-371.

      Burki, H. M., D. Schroeder, J. Lawrie, L. Cagan, M. Vrablova, M. E. Aydam, F. Szentkiralyi, R. Ghorbani, B. Jiittersonke & amp H. U. Ammon. 1997. Biologiese bestryding van varke (Amaranthus retroflexus L., A. Powellii S. Watson en A. bouchonii Thell.) Met fitofagiese insekte, swampatogene en gewasbestuur Geïntegreerde plaagbeheerbeoordelings 2: 51-59.

      Burnside, O. C., C. R. Fernster, L. L. Evertts en R. F. Mumm. 1981. Ontkieming van opgegrawe onkruidsaad in Nebraska. Onkruidwetenskap 29: 577-586.

      --, R. G. Wilson, S. Weisberg & K. G. Hubbard. 1996. Langsaadheid van saad van 41 onkruidsoorte wat 17 jaar in die oostelike en westelike Nebraska begrawe is. Onkruidwetenskap 44: 74-86.

      Cadman, C. S. C., P. E. Toorop, H. W. M. Hilhorst & W. E. Finch-Savage. 2006. Geenuitdrukkingprofiele van Arabidopsis cvi-sade tydens dormansiefietsry dui op 'n algemene onderliggende dormansiebeheermeganisme. The Plant Journal 46: 805-822.

      Cagan, L., M. Vrablova & P. ​​Toth. 2000. Vlooikewers (Chrysomelidae: Alticinae) spesies wat voorkom op Amaranthus spp. in Slowakye. Tydskrif vir Sentraal-Europese Landbou 1: 14-25.

      Cardina, J., E. Regnier en K. Harrison. 1991. Langtermynbewerkingseffekte op saadbanke in drie Ohio-gronde. Onkruidwetenskap 39: 186-194.

      --, T. M. Webster, C. P. Herms & E. E. Regnier. 1999. Ontwikkeling van onkruid-IPM: Vlakke van integrasie vir onkruidbestuur. Tydskrif vir gewasproduksie 2: 239-267.

      --, C. P. Herms en D. J. Doohan. 2002. Wisselbou- en bewerkingstelsel-effekte op onkruidsaadbanke. Onkruidwetenskap 50: 448-460.

      Castelano-Sousa, V. M. & J. Amaya-Farfan. 2012. Stand van kennis oor amarantgraan: 'n omvattende oorsig. Journal of Food Science 77: 93-104.

      Castor, R. D., A. A. M. Lammeren, S. P. C. Groot, G. Bino & W. M. Hilhorest. 2000. Seldeling en daaropvolgende radikale uitsteeksel in tamatiesaad word deur osmotiese stres geïnhibeer, maar DNS-sintese en vorming van mikrobuisvormige sitoskclton word nie. Plantfisiologie 122: 327-335.

      Chakravortv, A. & P. ​​D. Ghosh. 2012. Fenologie van 'n paar breëblaar -kharifonkruide uit die alluviumsone van Wes -Bengale. Internasionale Tydskrif vir Wetenskaplike en Navorsingspublikasies 2.

      Chaniago, I., A. Taji en R. Jessop. 2006. Onkruidinterferensie in sojabone (Glycine max). Die Australiese Vereniging van Agronomie. Verrigtinge van die Australiese Agronomie-konferensie.

      Charudattan, R. 1994. Statusverslag van die Universiteit van Florida, Departement Plantpatologie, Gainesville, FL, VSA. International Biohcrbicidc Group IBG News 3: 8-9.

      Chauhan, B. S. & D. E. Johnson. 2009. Ontkiemingsekologie van stekelrige (Amaranthus spinosus) en skraal amarant (A. viridis): lastige onkruid van rys met direkte sade. Onkruidwetenskap 57: 379-385.

      Chepil, W. S. 1946. Ontkieming van onkruidsade: 1. Langlewendheid, periodisiteit van ontkieming en lewenskragtigheid van sade in bewerkte grond. Wetenskaplike Landbou 26: 307-346.

      Chikkalingaiah, G. E. & M. Mahadevappa. 1998. Effek van verskillende plantspesies en plantlogings op Parthenium hysterophorus L. onkruid. Gewasnavorsing 15: 106-164.

      Chinmayee, M. D., B. Mahesh, S. Pradesh, I. Mini en T. S. Swapna. 2012. Die beoordeling van die fitorcmediasie potensiaal van indringende onkruid Amaranthus spinosus L. Applied Biochemistry and Biotechnology 167: 1550-1559.

      Clements, D. R., D. L. Benoit, S. D. Murphy en C. J. Swanton. 1996. Bewerkingseffekte van onkruidsaadopbrengs en saadbanksamestelling. Onkruidwetenskap 44: 314-322.

      Conforti, F., G. Statti, M. R. Loizzo, G. Sacchetti, F. Poli & F. Menichini. 2005. In vitro antioksidant effek en inhibisie van a-amilase van twee variëteite van Amaranthus caudatus sade. Biologiese en farmaseutiese bulletin 28: 1098-1102.

      Connick, W. J., J. M. Bradow, M. G. Legendre, S. L. Vail & R. M. Menges. 1987. Identifikasie van vlugtige allelochemikalieë van Amaranthus palmeri S. Wats. Journal of Chemical Ecology 13: 463-472.

      Costea, M. & D. DeMason. 2001. Stammorfologie en anatomie in Amaranthus L. (Amaranthaccae) Taksonomiese betekenis. Tydskrif van die Torrey Botanical Society 128: 254-281.

      --& F. J. Tardif. 2003. Die biologie van Kanadese onkruid. 126. Amaranthus albus L., A. blitoides S. Watson en A. blitum L. Canadian Journal of Plant Science 83: 1039-1066.

      --, A. Sanders & G. Waines. 2001. Voorlopige resultate vir 'n hersiening van die Amaranthus hybridus-kompleks (Amaranthaccae). SIDA 19: 931-974.

      --, S. E. Weaver & F. J. Tardif. 2004. Die biologie van Kanadese onkruide. 130. Amaranthus retroflexus L., A. powellii S. Watson en A. hybridus L. Canadian Journal of Plant Science 84: 631-668.

      Covas, G. & J. H. Hunziker. 1954. Estudies cariologicos en. Antofitas. Revista Invest Agriculture 8: 249-253.

      --& B. Schnack. 1946. Numero dc cromosomas en antofitas de la region de Cuyo (Republica Argentinië). Revista Argent. Agron 13: 153-166.

      Cowan, P., S. E. Weaver & C. J. Swanton. 1998. Inmenging tussen varkwiet (Amaranthus spp.), Blaargras (Echinochloa crus-galli) en sojaboon (Glycine max). Onkruidwetenskap 46: 533-539.

      Cristaudo, A., F. Cresta, F. Luciani & A. Restuccia. 2007. Effekte van na-oesperiode en omgewingsfaktore op saaddormansie van Amaranthus spesies. Onkruidnavorsing 47: 327-334.

      Culpepper, A. S. & amp; J. M. Kichler. 2009. Universiteit van Georgia onkruiddoderprogramme vir die beheer van glifosaatbestande palmer amarant in 2009 katoen. University of Georgia Colige of Agricultural and Environmental Sciences, Omsendbrief, 924 pp. 2.

      Culpepper, A. S., Gray, T. L., Vencill, W. K., Kichler, J. M., Webster, T. M. Brown & A. C. York. 2006. Glifosaat-weerstandige palmer amarant (Amaranthus palmeri) bevestig in Georgië. Onkruidwetenskap 54: 620-626.

      --, J.R. Whitaker, A.W. MacRae en A.C. York. 2008. Onkruidwetenskap: verspreiding van glifosaatbestande palmer amarant (Amaranthus palmeri) in Georgia en Noord-Carolina gedurende 2005 en 2006. Journal of Cotton Science 12: 306-310.

      Das, S. 2016. Amaranths: The Crop of Great Prospect. In Amaranthus: A Promising Crop of Future (bl. 13-48). Springer Singapoer.

      Datta, S.C. & A.K. Bandyopadhayay. 1981. Allelopatiese invloede van drie onkruide op twee gewasse. In: I Asian Pacific Weed Science Society Confcrcncc. APWSS: Tokio, pp. 391-399.

      Der Marderosian, A. D., J. Beutler, W. Pfendner, J. Chambers, R. Yoder, E. Weinsteiger & J. Senft.

      1980. Nitraat- en oksalaatinhoud van groente-amarant. In Proceedings of the Second Amaranth Conference pp. 31. Rodale Press. Emmaus. PA.

      Dieleman, A., A. S. Hamill, S. F. Weise & C. J. Swanton. 1995. Empiriese modelle van varkwiet (Amaranthus spp.) Inmenging in sojabone (Glycine max). Onkruidwetenskap 3: 612-618.

      --,--, G. C. Fox & C. J. Swanton. 1996. Besluitreëls vir die na -opkoms van varkwiet (Amaranthus spp.) In sojabone (Glycine max).Onkruidwetenskap 44: 126-132.

      --, D. A. Mortensen, D. D. Buhler & R. B. Ferguson. 2000. Identifisering van assosiasies tussen terreineienskappe en onkruidspesies oorvloed. II. Hipotese generering. Onkruidwetenskap 48: 576-587.

      Dillon, T. L., E. L. Baldwin en C. M. Becton. 1989. Palmer amarantbeheer in sanderige grond in die noordooste van Arkansas. Proceedings of the Southern Weed Science Society 42: 113.

      Dorling, K. 2008. RHS AZ Ensiklopedie van tuinplante. Verenigde Koninkryk 1136.

      Doroszeweski, A. 2001. Natuurlik vir rooi bestraling en saadbestendigheid in die grond. In: Ellis, R.H. en Black, M. (reds), Basiese en toegepaste aspekte van saadbiologie. Kluwer Akademiese Uitgewers, pp. 297-302.

      Dos Santos, C. C., D. F. De Oliviera, L. W. R. Alves en D. A. S. De Furtado. 2004. Effek van organiese ekstrakte geassosieer met oppervlakaktiewe middel Tween 80 op saadontkieming en saailinggroei van blaarslaai. Ciencia e Agrotecnologia 28: 296-299.

      Dowler, C. C. 1995. Onkruidopname-suidelike state: breëkafgewasse-onderafdeling. Southern Weed Science Society 48: 298-302.

      Downtown, W. J. S. 1973. Amaranthus edulis: 'n hoë lisiengraan amarant. Wêreldgewasse 25: 20-21.

      Drew, M. C. 1990. Sensing soil suurstof. Plantselomgewing 13: 681-693.

      DuPont Gewasbeskerming. 2009. DPX-MAT 28 Hcrbicidc Tegniese Bulletin.

      Early, D. K. 1977. Verbouing en gebruike van amarant in hedendaagse Mexiko. In: Proceedings of the First Amaranth Seminar: 39. Rodale Press: 39-60.

      Early, D. 1992. Die renaissance van amarant, pp. 15-33. In N. Foster en L. S. Cordell (reds.). Chiles tot sjokolade: kos wat die Amerikas die wêreld gegee het. Universiteit van Arizona Press, Tucson.

      Egley, G. H. 1989. Enkele effekte van nitratc-trcatcd grond op die sensitiwiteit van begrawe rooiwortelvarkbos (A. retroflexus L.) sade vir etileen, temperatuur, lig en koolstofdioksied. Plantsel en omgewing 12: 581-588.

      Eliasson, U. H. 1988. Blommorfologie en taksonomiese verhoudings tussen die geslagte van Amaranthaceae in die Nuwe Wêreld en die Hawaiiaanse Eilande. Botaniese Tydskrif van die Linnaean Society 96: 235-283.

      Elmore, C. L. 1996. 'n Herinleiding tot geïntegreerde onkruidbestuur. Onkruidwetenskap 44: 409-112,

      EPA (Environmental Protection Agency). 2007. Navorsing spreek potensiële risiko's van atrasink en verwante plaagdoders aan. Kantoor van Navorsing en Ontwikkeling.

      Espitia-Rangel, E. 1994. Teling van graan amarant. Amarant: biologie, chemie en tegnologie. CRC-pers, Boca Raton, VSA 23-38.

      Evans, C. R. 1922. Effek van temperatuur op ontkieming van Amaranthus retroflexus. Botaniese Koerant 73: 213-225.

      Faccini, D. & amp; J. I. Vitta. 2005. Ontkiemingseienskappe van A. quitensis soos beïnvloed deur saadproduksiedatum en duur van begrafnis. Onkruidnavorsing 45: 371-378.

      Falk, J. S., D. E. Slioup, K. Al-Khatib en D. E. Peterson. 2005. Oorsig van algemene reaksie op waterhamp (Amaranthus rudis) op protoks- en ALS-remmende onkruiddoders in die noordooste van Kansas. Onkruidtegnologie 19: 838-846.

      FAO. 1973. Energie- en proteïenvereistes. In: FAO Nutrition Meetings Report Series (No. 52).

      Farvin, K.S., R. Anandan, S.H.S. Kumar, K.S. Shiny, S. Mathew, T.V. Sankar en P.V. Nair. 2006. Kardio-beskermende effek van squalcne op lipiedprofiel in isoprenalien-geïnduseerde miokardiale infarksie by rotte. Journal of Medicinal Food 9: 531-536.

      Fernando, T. & G. Bean. 1984. Vetsure en sterole van Amaranthus tricolor L. Food Chemistry 15:233-237.

      Ferrell, J. & B. Verkopers. 2007. Stekelrige amarant (stekelvarkbos) beheer in weidings. Universiteit van Florida.

      Fischer, N. H. & L. Quijano. 1985. Allelopatiese middels van gewone onkruide: Amaranthus palmeri. Ambrosia artemisiijolia en verwante onkruide. In die ACS -simposiumreeks American Chemical Society.

      Flint, E.P. & D.T. Patterson. 1983. Interferensie en temperatuur -effekte op groei in sojabone en verwante [C. sub.3] en [C. sub.4] onkruid. Onkruidwetenskap 31: 191-195.

      Foes, M. J., P. J. Tranel, L. M. Wax en E. W. Stoller. 1998. 'n Biotipe gewone watermelk (Amaranthus rudis) wat bestand is teen triasien en ALS onkruiddoders. Onkruidwetenskap 46: 514-520.

      Forcella, F., R. G. Wilson & J. Dekker. 1997. Onkruid saadbank kom oor die mielieband. Onkruidwetenskap 45: 67-76.

      Fortin, M. C. & F. J. Pierce. 1990. Ontwikkeling en groei-effekte van oesreste op com. Agronomiejoernaal 82: 710-715.

      Franssen, A. S., D. Z. Skinner, K. Al-Khatib & M. J. Horak. 2001a. Stuifmeel morfologiese verskille in Amaranthus spesies en interspesifieke basters. Onkruidwetenskap 49: 732-737.

      -,-,-,-& amp P. A. Kulakow. 2001b. Interspesifieke hibridisasie en geenvloei van ALS-weerstand in Amaranthus spesies. Onkruidwetenskap 49: 598-606.

      Fritz, T. J. & N. L. Hartwig. 1986. Stekelrige amarantbeheer in weivelde. Proceedings of the Northeastern Weed Science Society 40: 20-23.

      Fuerst, E.P., M. Barrett en D. Penner. 1986. Beheer van triasien-weerstandige gewone lammerkwarte (Chenopodium album) en twee varkbosspesies (Amaranthus spp.) in mielies (Zea mays). Onkruidwetenskap 34: 440-443.

      Fuller, H. J. 1949. Fotoperiodiese reaksies van Chenopodium quinoa Willd. en Amaranthus caudatus L. American Journal of Botany 36:175-180.

      Gaines, T. A., W. Zhang, D. Wang, B. Bukun, S. T. Chisholm en D. L. Shaner. 2010. Geenamplifikasie verleen glifosaatweerstand in Amaranthus palmeri. Proceedings of the National Academy of Sciences 107: 1029-1034.

      --, S. M. Ward, B. Bukun, C. Preston, J. E. Leach & P. Westra. 2012. Interspesifieke hibridisasie dra 'n voorheen onbekende glifosaatweerstandsmeganisme in Amaranthus spesies oor. Evolusionêre toepassings. Blackwell Publishing Ltd. bl. 529-538.

      Gallagher, R. S. & J. Cardina. 1997. Grondwaterdrempels vir foto-induksie van herwortelvarkbos-ontkieming. Onkruidwetenskap 45: 414-418.

      --&--. 1998a. Fitochroom-gemedieerde Amaranthus-ontkieming I: Effek van saadbegrawe en ontkiemingstemperatuur. Onkruidwetenskap 46: 48-52.

      --&--. 1998b. Fitochroom-gemedieerde Amaranthus-ontkieming II: Ontwikkeling van baie lae vlotsensitiwiteit. Onkruidwetenskap 46: 53-58.

      Garcia, L. A., M. A. Alfaro & R. Bressani. 1987. Verteerbaarheid en voedingswaarde van ru-olie van drie amarantspesies. Tydskrif van die American Oil Chemists' Society 64: 371-375.

      Garman, H. 1892. Die varkbosvlooikewer. Tweedens. Ann. Rep. Kentucky Agr. Exp. Sta. 1889: 27-30.

      Ghersa, C. M. & J. S. Holt. 1995. Die gebruik van fenologievoorspelling in onkruidbestuur: 'n oorsig. Onkruidnavorsing 35: 461-470.

      --, R. L. Benech-Arnold & M. A. Martinez-Ghersa. 1992. Die rol van fluktuerende temperature in ontkieming en vestiging van Sorghum halepense. Regulering van ontkieming op toenemende dieptes. Funksionele ekologie 6: 460-468.

      Ghorbani, R., W. Seel & C. Leifert. 1999. Effekte van omgewingsfaktore op ontkieming en opkoms van Amaranthus retroflexus. Onkruidwetenskap 47: 505-510.

      --,--, A. Litterick & C. Leifert. 2000. Evaluering van Alternaria alternatiewe vir biologiese beheer van

      Amaranthus retroflexus. Onkruidwetenskap 48: 474-480.

      Ghosh, B. K. & N. K. Bruin. 1997. Slaap en lewensvatbaarheid van graan amarant sade. Indian Journal of Plant Physiology 2: 15-17.

      Gossett, B.J., E.C. Murdock en J.E. Toler. 1992. Weerstand van palmer amarant (Amaranthus palmeri) teen die dinitroanilinc onkruiddoders. Onkruidtegnologie 6: 587-591.

      Grant, W. F. 1959a. Sitogenetiese studies in Amaranthus. II. Natuurlike interspesifieke hibridisasie tussen A. dubius en A. spinosus. Kanadese Tydskrif vir Plantkunde 37: 1063-1070.

      -. 1959b. Sitogenetiese studies in Amaranthus. III. Chromosoomgetalle en filogenetiese aspekte. Canadian Journal of Genetics and Cytology 1: 313-328.

      Green, J.D., W.W. Witt en J.R. Martin. 2006. Onkruidbestuur in grasweidings, hooilande en ander plaaspersele. Universiteit van Kentucky. Ext. Kroeg. AGR-172.

      Greizerstein, E. J. & amp L. Poggio. 1992. Sitogenetiese studies in ses interspesifieke basters van Amaranthus (Amaranthaceae). Darwiniana 31: 159-165.

      -. 1995. Meiotiese studies van spontane basters van Amaranthus: genoomanalise. Plantteling 114: 448-150.

      --, C. A. Naranjo & L. Poggio. 1997. Kariologiese studies in vyf wilde spesies van Amaranthus. Cytologia 62: 115-120.

      Grichar, W. J. 1997. Beheer van palmer amarant (Amaranthus palmeri) in grondboontjies (Arachis hypogaea) met na-opkoms onkruiddoders. Onkruid Tegnologie 11: 739-743.

      Grubben, G. J. H. & amp; D. H. van Sloten. 1981. Genetiese hulpbronne van amarante. Intl. Raad vir Plantgenetiese Hulpbronne, Voedsel en Agrie. Org.. Rome.

      Gudu, S. & amp; V. K. Gupta. 1988. Man-steriliteit in die graan amarant (Amaranthus hypochondriacus ex-Nepal) variëteit Jumla. Euphytica 37: 23-26.

      Guo, P. & K. Al-Khatib. 2003. Temperatuur-effekte op ontkieming en groei van herwortelvarkbos (Amaranthus retroflexus). palmer amarant (Amaranthus palmeri), en gewone waterhennep (A. rudis). Onkruidwetenskap 51: 869-875.

      Gutterman, Y. & G. Genotipies. 1997. Fenotipiese en opportunistiese ontkiemingstrategieë van 'n paar algemene woestyn -eenjariges in vergelyking met ander saadverspreiding- en ontkiemingstrategieë In: Ellis. R.H. en Black, M. (reds), Basiese en toegepaste aspekte van saadbiologie. Kluwer Akademiese Uitgewers, pp. 611-622.

      --, F. Corbineau & D. Kom. 1992. Interverwante effekte van temperatuur, lig en suurstof op Amaranthus caudatus L. saadontkieming. Onkruidnavorsing 32: 111 117.

      Guzzella, L., F. Pozzoni en G. Giuliano. 2006. Onkruiddoderbesoedeling van oppervlakkige grondwater in Noord-Italië. Omgewingsbesoedeling 142: 344-353.

      Habib, S. A. & amp; H. L. Morton. 1987. Die gekombineerde effek van temperatuur en waterpotensiaal op die ontkieming van hawer by die hawer en die wortelwortelsaad. Iraqi Journal of Agricultural Science 5: 15-24.

      Hanf, M. 1984. Ackerunkra "titer Europas mit ihren Keimlingen, pp. 166-70. Ludwigshafcn: BASFAG.

      Haramoto, E. R. & E. R. Gallandt. 2005. Brassica-dekverbouing: II. Uitwerking op groei en inmenging van groenboontjies (Phaseolus vulgaris) en wortelroos (Amaranthus retroflexus). Onkruidwetenskap 53: 702-708.

      Hartzler, R. G., D. G. Buhler & D. E. Stoltenberg. 1999. Opkomskenmerke van vier eenjarige onkruidspesies. Onkruidwetenskap 47: 578-584.

      --, B. A. Battles & D. Nordby. 2004. Effek van gewone waterhennep (Amaranthus rudis) opkomsdatum op groei en vrugbaarheid in sojabone. Onkruidwetenskap 52: 242-245.

      Hauptli, H. & S. Jain. 1985. Genetiese variasie in uitkruisingstempo en gekorreleerde blomeienskappe in 'n populasie van graan amarant (Amaranthus cruentus L.). Genetika 66:21-27.

      Hausman, N. E., S. Singh, P. J. Tranel, D. E. Riechers, S. S. Kaundun, N. D. Polge, D. A. Thomas & amp A. G. Hager. 2011. Weerstand teen HPPD-remmende onkruiddoders in 'n bevolking van waterhemp (Amaranthus tuberculatus) uit Illinois, Verenigde State. Pest Management Science 67: 258-261.

      Heap, I. 2014. Die internasionale opname van onkruiddoderbestande onkruide. In die Western Society of Weed Science (VSA). Webblad http://www.weedscicncc.org/in.asp (Besoek op 2 Oktober 2014).

      Heidarian, H., M. R. Hadi, H. S. Mahmoodabadi & M. N. Kalateh. 2012. Mededingende effekte van rooiwortel (Amaranthus retroflexus) op drie sonneblomme (Helianthus annus) kultivars. Internasionale Tydskrif vir Agronomie en Plantproduksie 3: 84-88.

      Heiser Jr., C. B. en T. W. Whitaker. 1948. Chromosoomgetal, poliploïdie en groeiwyse in Kalifornië-onkruide. Amerikaanse Tydskrif vir Plantkunde 179-186.

      Hendrick, L.W., W.F. Meggitt en D. Penner. 1974. Basis vir selektiwiteit van fenmedifam en dcsmcdipham op wilde mosterd, herwortelvarkbos en suikerbeet. Onkruidwetenskap 22: 179-184.

      Hendricks, S. B., V. K. Toole en H. A. Borthwick. 1968. Opponerende aksies van lig in saadontkieming van Poa pratensis en Amaranthus arenicola. Plantfisiologie 43: 2023-2028.

      Hicks, S. K., P. H. Munger, J. R. Abernathy en C. W. Wendt. 1986. Effek van amarant allelopatiese verbindings op gewasse. In Proceedings of Southern Weed Science Society 411.

      Holm, R. E. 1972. Vlugtige metaboliete wat ontkieming in begrawe onkruidsade beheer. Plantfisiologie 50: 293-297.

      -& amp; M. R. Miller. 1972. Onkruidsaadontkiemingsreaksies op chemiese en fisiese behandelings. Onkruidwetenskap 20: 150-153.

      Holm, L. G., D. L. Plunkett, J. V. Pancho en J. P. Herberger. 1977. Die wêreld se ergste onkruidverspreiding en biologie. University Press of Hawaii 606.

      --, J.V. Pancho, J.P. Herberger en D.L. Plucknett. 1979. 'n Geografiese atlas van wêreldonkruid. New York, VSA: John Wiley and Sons.

      Horak, M. J. 1997. Die veranderende aard van palmer amarant: 'n gemakstudie. Proceedings of the North Central Weed Science Society 52: 161.

      --& T. M. Loughin. 2000. Groei -analise van vier Amaranthus -spesies. Onkruidwetenskap 48: 347-355.

      --& D. E. Peterson. 1995. Biotipes palmer amarant (Amaranthus palmeri) en gewone waterhennep (Amaranthus rudis) is bestand teen imazethapyr en thifensulfuron. Onkruidtegnologie 9: 192-195.

      Howell, C. R. & R. D. Stipanovic. 1984. Fitotoksisiteit vir gewasplante en onkruiddodende effekte op onkruide van viridiol wat deur Gliocladium virens geproduseer word. Fitopatologie 74: 1346-1349.

      Huang, J. Z., A. Shrestha, M. Tollenaar, W. Deen, H. Rahimian & C. J. Swanton. 2000. Effekte van fotoperiode op die fenologiese ontwikkeling van herwortelvarkbos (Amaranthus retroflexus L.). Kanadese Tydskrif vir Plantwetenskap 80: 929-938.

      Hyvonen, T. 2011. Impak van temperatuur en ontkiemingstyd op die sukses van 'n [C.sub.4] onkruid in 'n [C.sub.3] gewas: Amaranthus retroflexus en lentegars. Landbou en voedselwetenskap 20: 183-190.

      Iamonico, D. 2010. Biologie, lewensstrategie en indringendheid van Amaranthus retroflexus L. (Amaranthaceae) in Sentraal-Italië: voorlopige opmerkings. Botanica Serbica 34: 137-145.

      Itoh, K., M. Azmi en A. Ahmad. 1992. Parakwatweerstand in Solanum nigrum, Crassocephalum crepidioides. Amaranthus lividus en Conyza sumatrensis in Maleisië. 1ste Internasionale Onkruidbeheerkongres. Melbourne, Australië 2: 224-228.

      Jacobsen, S. E., A. Mujica & L. Guarino. 2000. Die genetiese hulpbronne van die Andes-graangewas amarant (Amaranthus caudatus L., A. cruentus L. en A. hipochondriacus L.). Verrigtinge van Internasionale Konferensie oor Wetenskap en Tegnologie vir die Bestuur van Plantgenetiese Diversiteit in die een-en-twintigste eeu. Kuala Lumpur, Maleisië, 12-16 Junie.

      Jahaniaval, F., Y. Kakuda & M. F. Marcone. 2000. Vetsuur en triasielglykrol samestelling van saadolies van vyf Amaranthus -toetredings en die vergelyking daarvan met ander olies. Tydskrif van die American Oil Chemists' Society 77: 847-852.

      Jha, P., J. K. Norsworthy & M. S. Malik. 2007. Effekte van bewerking en vorming van sojaboonblare op tydelike opkoms van palmer amarant uit 'n natuurlike saadbank. Onkruidwetenskapvereniging 60.

      --, --, M. B. Riley & W. Bridges Jr. 2008a. Akklimatisering van palmer amarant (Amaranthus palmeri) tot skaduwee. Onkruidwetenskap 56: 729-734.

      -,-,-, & amp. 2008b. Invloed van glifosaat-tydsberekening en rywydte op palmer amarant (Amaranthus palmeri) en pusley (Richardia spp.) Demografie in glifosaatbestande sojabone. Onkruidwetenskap 56: 408-115.

      --, --, --&--. 2008c. Temperatuur en lig vereistes vir ontkieming van palmer amarant oor 'n tydperk van 12 maande. Onkruidwetenskap 58: 426-432.

      --, --, --&--. 2010. Jaarlikse veranderinge in temperatuur en ligvereistes vir ontkieming van palmer amarant (A. palmeri) sade wat uit grond gehaal word. Onkruidwetenskap 58: 426-432.

      Julien, M. H. 1992. Biologiese beheer van onkruid. 'N Wêreldkatalogus van agente en hul onkruide. 3de uitgawe, pp. 186.

      Kadman-Zahavi, A. 1960. Effek van kort en deurlopende beligting op die ontkieming van Amaranthus retroflexus sade. Bulletin van die Navorsingsraad van Israel 9: 1-20.

      Kagali, R. N., E. N. Kioko, Z. Osiemo, S. Muya en C. Wachera. 2013. Insek oorvloed en diversiteit op gekweekte Amaranthus spp. (Amaranthacea) in Meru County, Kenia. American International Journal of Contemporary Research 3: 110-116.

      Karssen, C. M. 1982. Seisoenale patrone van dormansie in onkruidsade. In: Khan, A.A. (red) Die fisiologie en biochemie van saadontwikkeling, dormansie en ontkieming. Amsterdam: Elsevier Biomedical Press pp. 243-270.

      Kataryan, B. T. 1975. Die soektog na bakteriese kulture met onkruiddodende aktiwiteit. Doklady Akademii Nauk Armyanskoi SSR 61: 110-112.

      Keeley, P.E. & R.J. Thullen. 1989. Groei en mededinging van swart nastergal (Solanum nigrum) en palmamarant (Amaranthus palmeri) met katoen (Gossypium hirsutum). Onkruidwetenskap 37: 326-334.

      --, C. H. Carter & R. J. Thullen. 1987. Invloed van plantdatum op groei van palmer amarant (Amaranthus palmeri). Onkruidwetenskap 35: 199-204.

      Kegode, G. O., R. B. Pearce en T. B. Bailey. 1998. Die invloed van wisselende temperature op die opkoms van shattcrcanc (Sorghum bicolor) en reuse vossestert (Setaria faberi). Onkruidwetenskap 46: 330-335.

      Kendig, J. A. 2009. Palmer amarant (Amaranthus palmeri) bestuur. Beskikbaar by http: //ncc.confex. com/ncc/2006/techprogram/P4499.html.

      Kendrick, R. E., & amp; Frankland B. 1969. Fotokontrole van ontkieming in Amaranthus caudatus. Planta 85: 326-339.

      -, C. J. P. Spruit & amp B. Frankland. 1969. Fytochroom in sade van Amaranthus caudatus. Planta 88: 293-302.

      --& M. Bihun. 2002. Induksie van sekondêre dormansie in A. caudatus sade. Plantgroeiregulasie 38: 135-140.

      --& P. Sznigir. 2012. Reaksie van Amaranthus retroflexus L. sade op gibberelliensuur, etileen en absisiensuur afhangende van die duur van stratifikasie en begrafnis. Plantgroeiregulasie 70: 15-26.

      -, E. Corbineau & amp D. Kom. 1996. Reaksie van Amaranthus retroflexus sade op cthephon, 1 aminosiklopropaan 1-karboksielsuur en gibberelliensuur in verhouding tot temperatuur en dormansie. Plantgroeiregulasie 20: 259-265.

      -, E. Kepczynska & M. Bihun. 2003. Die betrokkenheid van etileen in die vrystelling van primêre dormansie in A. retroflexus sade. Plantgroeiregulasie 38: 57-62.

      Khan, A. G., Baloch, G. M. en M. A. Ghani. 1978. Natuurlike vyande van Abutilon, Amaranthus, Rumex en Sorghum. Statebond Instituut vir Biologiese Beheer. Werkverslag Januarie 1977 42-43.

      Khanh, T. D., I. M. Chung, T. D. Xuan & amp; S. Tawata. 2005. Die ontginning van gewasallelopatie in volhoubare landbouproduksie. Tydskrif vir Agronomie en Gewaskunde 191: 172-184.

      Khoshoo, T. N. & M. Pal. 1972. Sitogenetiese patrone in Amaranthus. Chromosome Vandag 3: 259-267.

      Kigel, J. 1994. Ontwikkeling en ccophysiology van Amaranths. Amaranth: Biologie, chemie en tegnologie 39-73.

      -, M. Ofir & amp D. Koller. 1977. Beheer van die ontkiemingsreaksies van Amaranthus retroflexus L. sade deur hul ouerlike fototermiese omgewing. Tydskrif vir Eksperimentele Plantkunde 28: 1125-1136.

      Klingaman, T. E. & L. R. Oliver. 1994.Palmer amarant (Amaranthus palmeri) inmenging in sojabone (Glycine max). Onkruidwetenskap 42: 523-527.

      Knezevic, S. Z. & M. J. Horak. 1998. Invloed van opkomstyd en -digtheid op herwortelvarkkruid (Amaranthus retroflexus). Onkruidwetenskap 46: 665-672.

      -, S. F. Weise & amp; J. J. Swanton. 1994. Interferensie van herwortelvarkbos (Amaranthus retroflexus) in mielies (Zea mays). Onkruidwetenskap 42: 568-573.

      Kolaib, M. O., M. F. W. Younes & E. T. E. Darwish. 1986. Hypolixus nubilosus as 'n faktor in biologiese beheer van Amaranthus-onkruide in Egipte. Annale van Landbouwetenskap 31: 767-776.

      Koul, A. K., A. K. Wakhlu & J. L. Karihaloo. 1976. Chromosoomgetalle van sommige blomplante van Jammu (Wes-Himalya) II. Chromosoominligtingsdiens 20: 32-33.

      Kulakow, P. A. 1990. Eenvoudig geërfde genetiese variasie in graan amarant. In: Janick, J. en Simon, J.E. (reds.) Advances in New Crops. Houtpers. Portland. OF. VSA.

      Kunth, K. S. 1838. Flora Bcrolinensis, Duncker en Humblot, Berlyn, Duitsland 2: 144-145.

      Lanta, V., P. Havranek & V. Ondrej. 2003. Morfometrie -analise en ontkieming van saad van Amaranthus cruentus, A. retroflexus en hul baster (A. x mricensis). Plantgrond en Omgewing 49: 364-369.

      Legleiter, T. R. & amp; K. W. Bradley. 2008. Glifosaat- en veelvuldige onkruiddoderweerstand in gewone waterhennep (Amaranthus rudis) bevolkings van Missouri. Onkruidwetenskap 56: 582-587.

      Lehmann, J. W. 1996. Gevallegeskiedenis van graan Amaranthus en alternatiewe gewas. Cereal Foods World 41: 399411.

      Leon, R. G. & M. D. K. Owen. 2003. Regulering van onkruidsaad-dormansie deur lig- en temperatuurinteraksies. Onkruidwetenskap 51: 752-758.

      --&--. 2006. Grondbewerkingstelsels en saadrus -effekte op die opkoms van saailinge van gewone watermang (Amaranthus tuberculatus). Onkruidwetenskap 54: 1037-1044.

      -, A. D. Knapp & amp; M. D. K. Owen. 2004. Effek van temperatuur op die ontkieming van gewone waterhennep (Amaranthus tuberculatus), reusagtige jakkalsstert (Setaria faberi) en velevetblaar (Abutilon theophrasti). Onkruidwetenskap 52: 67-73.

      -, D. C. Basshami & amp; M. D. K. Owen. 2007. Termiese en hormonale regulering van die oorgang tot ontkieming in Amaranthus tuberculatus sade. Onkruidnavorsing 47: 335-344.

      Leon-Camacho, M., D. L. Garcia-Gonzalez en R. Aparicio. 2001. 'n Gedetailleerde studie van amarant (Amaranthus cruentus L.) olievetprofiel. Europese voedselnavorsing en -tegnologie 213: 349-355.

      Linnaeus, C. 1753. Soort Plantarum, Laurcntius Salvius, Stockholm. Swede 2: pp. 989.

      Litch, M. A. & M. Al-Kaisi. 2005. Strookbewerking op saadbed grondtemperatuur en ander grond fisiese eienskappe. Grond- en Bewerkingsnavorsing 80: 233-249.

      Liu, F. & amp H. Stutzel. 2002. Blaarwaterretensie van plantaardige amarant (Amaranthus spp.) In reaksie op gronddroging. European Journal of Agronomy 16: 137-150.

      Liu, J., A. S. Davis en P. J. Tranel. 2012. Stuifmeelbiologie en verspreidingsdinamika in waterhennep (Amaranthus tuberculatus). Onkruidwetenskap 60: 416-422.

      Lolas, P. H. 1981. Onkruidbevolkingsinmenging in gars en tabak. In Panhellmic Congress of Geotechnical Research. Absrakte. 24 instelling kapnou, Drama. Griekeland.

      Lolas, P. C. 1986. Onkruidgemeenskapsinmenging in gars en tabak (Nicotiana tabacum L.). Onkruidnavorsing 26: 1-8.

      Long, J. J. & amp; J. O. Berry. 1996. Weefselspesifieke en lig-gemedieerde uitdrukking van die [C.sub.4] fotosintetiese NAD-dcpcndcnt maliese ensiem van amarant-mitochondria. Plant Fisiologie 112: 473-482.

      -, J. L. Wang & amp; J. O. Berry. 1994. Kloning en ontleding van die [C.sub.4] fotosintetiese NAD-afhanklike appel-ensiem van amaranth mitochondria. Tydskrif vir Biologiese Chemie 269: 2827-2833.

      Lopez, J. F. O., A. A. Garcia, M. A. D. Huato, M. H. Lara, F. J. Saenz-de-cabezon, I. Perez-Moreno & amp V. Marco-Mancebon. 2011. Insekvoorkoms en verliese as gevolg van fitofagiese spesies in die amarant (Amaranthus hypocondriacus L.) in Puebla, Mexiko. Afrikaanse Tydskrif vir Landbounavorsing 6: 5924-5929.

      Lorenz, K. & amp; Y. S. Hwang. 1985. Lipiede in amarante. Nutrition Reports International 31: 83-89.

      Macharia, C. en E. B. Peffley. 1995. Onderdrukking van Amaranthus spinosus en Kochia scoparia: bewyse van mededinging of allelopatie in Allium fistulosum. Gewasbeskerming 14: 155-158.

      Madhusoodanan, K. J. & M. A. Nazeer. 1983. Vergelykende morfologie van die somatiese kariotipes van plantaardige amarante en die filogenetiese betekenis daarvan. Cytologia 48: 237-244.

      Mahmudzadeh, A., M. Nojavan & Z. Bagheri. 2003. Studie van effek van verskillende behandelings op rusverbreking en ontkiemingstimulasie van sade van wilde amarant. Scientific Journal of Agriculture 26: 13-25.

      Malefyt, T. & W. B. Duke. 1984. Pendimethalin fitotoksisiteit vir velvetlcaf (Abutilon theophrasti) en powell amarant (Amaranthus powellii). Onkruidwetenskap 32: 520-524.

      Manley, B.S., H.P. Wilson en T.E. Hines. 1996. Gladde varkbos (Amaranthus hybridus) en lewendige amarant (A. lividus) reaksie op verskeie imidazolinone en sulfonielureum onkruiddoders. Onkruid Tegnologie 10: 835-841.

      Marayama, A., M. Yoshiyama & Y. Eashi. 1997. Moontlike deelname van beta cyanoalaninc sintase in die verhoging van die aminosuur peul van kakelsaad in reaksie op etileen gedurende die periode van ontkieming. Australian Journal of Plant Physiology 24: 751-757.

      Massinga, R. A. & amp; R. S. Currie. 2002. Impak van palmer amarant (Amaranthus palmeri) op ​​com (Zea mays) graanopbrengs en opbrengs en kwaliteit voer. Onkruidtegnologie 16: 532-536.

      -,-, M. J. Horak & amp; J. Boyer. 2001. Inmenging van palmer amarant in mielies. Onkruidwetenskap 49: 202-208.

      -,-, & amp T. P. Trooien. 2003. Watergebruik en ligte onderskepping onder palmer amarant (Amaranthus palmeri) en mieliekompetisie. Onkruidwetenskap 51: 523-531.

      Mayo, C. M., M. J. Horak, D. E. Peterson en J. E. Boyer. 1995. Differensiële beheer van vier Amaranthus -spesies deur ses onkruiddoders na opkoms in sojabone (Glycine max). Onkruidtegnologie 9: 141-147.

      McKeon, G. M. & J. J. Mott. 1982. Die effek van temperatuur op die veldversagting van harde saad van Stylosanthes humilus en S. hamata in 'n droë moessonklimaat. Australian Journal of Agricultural Research 33: 75-85.

      McLachlan, S. M., C. J. Swanton, S. F. Weise & M. Tollenaar. 1993a. Die effek van kom -geïnduseerde skaduwee en temperatuur op die blaarvoorkoms van die wortelrooi (Amaranthus retroflexus L.). Onkruidwetenskap 41: 590-593.

      -, M. Tollenaar, C. J. Swanton & amp; S. F. Weise. 1993b. Die effek van kom -geïnduseerde skaduwee op die ophoping, verspreiding en argitektuur van droë materiaal (Amaranthus retroflexus). Onkruidwetenskap 41: 568-573.

      McIntyre, T. & amp; G. M. Lewis. 1997. Die vordering van fitoremediëring as innoverende omgewingstegnologie vir stabilisering, herstel en herstel van besmette terreine. Journal of Soil Contamination 6: 227-231.

      Mcmullan, P. M. & amp; J. M. Green. 2011. Identifikasie van 'n hoë watermeng (Amaranthus tuberculatus) biotipe wat bestand is teen HPPD-remmende onkruiddoders, atrasien en thifensulfuron in Iowa. Onkruidtegnologie 25: 514-518.

      McWilliams, E. L., R. Q. Landers en J. P. Mahlstede. 1968. Variasie in saadgewig en ontkieming in populasie van Amaranthus retroflexus L. Ecology 49: 290-296.

      Mellem, J. J. 2008. Fitoremediëring van swaar metale in Amaranthus dubius. (Doktorale proefskrif).

      Mendoza, G. L. & M. M. Rodriguez. 1990. Aislamiento, identifier and patogenicidad de bacterias en quelite Amaranthus hybridus L. y su posibilidad en el control biologico. Revista Chapingo 15: 66-69.

      Menges, R M. 1987. Allelopatiese effekte van palmer amarant (Amaranthus palmeri) en ander plantreste in grond. Onkruidwetenskap 35: 339-347.

      -. 1988. Allelopatiese effekte van palmer amaranthus (Amaranthus palmeri) op ​​saailinggroei. Onkruidwetenskap 36: 325-328.

      Meyers, S. L., K. M. Jennings, J. R. Schultheis & D. W. Monks. 2010. Inmenging van palmer amarant (Amaranthus palmeri) in patats. Onkruidwetenskap 58: 199-203.

      Milan, P. R. 2008. Chromosoomgedrag en vrugbaarheid in geïnduseerde poliploïede van graan amarante. Caryologia 61: 199-205.

      Milberg, P. & L. Andersson. 1997. Seisoenale variasie in dormansie en ligsensitiwiteit in begrawe sade van agt eenjarige onkruidspesies. Kanadese Tydskrif vir Plantkunde 75: 1998-2004.

      Mintz, A. S. & G. J. Weidemann. 1992. Evaluering van Aposphaeria amaranthi as 'n potensiële bio-onkruiddoder vir Amaranthus. In Biologiese Bestryding van Onkruid, Agtste Internasionale Simposium pp. 68.

      Mitich, L. W. 1997. Herwortelvarkbos (Amaranthus retroflexus). Onkruidtegnologie 11: 199-202.

      Mlakar, S. G., M. Turinek, M. Jakop, M. Bavec & F. Bavec. 2009. Voedingswaarde en gebruik van graan amarant: moontlike toekomstige toepassing by broodmaak. Agricultura 6: 43-53.

      Mnkeni, A. P. 2005. Die onderbenutte plant met hoë voedingsgehalte en ekonomiese potensiaal. Landbou- en Landelike Ontwikkelingsnavorsingsinstituut, Nuusbrief, Universiteit van Fort Hare. Julie tot Desember 2005.

      Mohler, C. L. 1993. 'n Model van die uitwerking van bewerking op die opkoms van onkruidsaailinge. Ekologiese toepassings 3: 53-73.

      Monks, D. M. & L. R. Oliver. 1988. Interaksies tussen sojaboon (Glycine max) kultivars en geselekteerde onkruide. Onkruidwetenskap 36: 770-774.

      Moolani, M. K., E. L. Knake en F. W. Slife. 1964. Kompetisie van gladde varkbos met com en sojabone. Onkruid 12: 126-128.

      Moore, T. C. 1979. Biochemie en fisiologie van planthormone. New York: Springer-Verlag. pp. 199-201.

      Moore, J.W., D.S. Murray en R.B. Westerman. 2004. Palmer amarant (Amaranthuspalmeri) uitwerking op die oes en opbrengs van graansorghum (Sorghum bicolor). Onkruidtegnologie 18: 23-29.

      Morgan, G. D., P. A. Baumann en J. M. Chandler. 1997. Die effek van palmer amarant-kompetisie op katoengroei en opbrengs. Southern Weed Science Society 50: 149-150.

      --, --&--. 2001. Mededingende impak van palmer amarant (Amaranthus palmeri) op ​​die ontwikkeling en opbrengs van katoen (Gossypium hirsutum). Onkruidtegnologie 15: 408-412.

      Mosyakin, S. L. en K. R. Robertson. 1996. Nuwe infrageneriese taksa en kombinasies in Amaranthus L. (Amaranthaceae). Annales Botanici Fcnnici 33: 275-281.

      --&--. 2003. Amaranthus. In: Flora of North America, Oxford University Press, New York 1: 410-435.

      Mposi, M. S. 1999. Groente -amarantverbetering vir Suid -Afrika. Die Australiese New Crops Nuusbrief, uitgawe nr. 11.

      Mueller, T. C., L. E. Steckel, J. S. McElroy en T. C. Teuton. 2006. 'n Opdatering oor onkruiddoderweerstand in Tennessee. Proceedings of the Southern Weed Science Society 59: 133.

      Muller, K. & T. Borsch. 2005. Filogenetika van amaranthaceae gebaseer op matK / trnK volgorde data: Bewyse van parsimony, waarskynlikheid, en Bayesiaanse ontledings. Annale van die Missouri Botaniese Tuin 92: 66-102.

      Muller-Scharer, H. 1993. Biologiese beheer van onkruid in gewasse: 'n voorstel van 'n nuwe COST-aksie. In: Maitrise des adventises par voie non chimique. IFOAM-konferensie, Dijon 181-185.

      Mulligan, G. A. 1984. Chromosoomgetalle van sommige plante inheems en genaturaliseer in Kanada. Naturaliste Canadien 111: 447-149.

      Munger, P. H., J. R. Abernathy & J. R. Gipson. 1983. Die invloed van geselekteerde plantreste op katoen (Abstract). In Proceedings of the Southern Weed Science Society 36th Annual Meeting, pp. 37.

      Murray, M. J. 1938. Interspesifieke en intergeneriese kruisings in die familie Amaranthaceae. Ph.D. Proefskrif. Cornell Universiteit, Ithaca, New York.

      --1940. Die genetika van geslagsbepaling in die familie Amaranthaceae. Genetika 25: 409-431.

      Myers, R. L. 1996. Amaranth: Nuwe oesgeleentheid, pp. 207-220. In: J. Janick (red.). Vordering in nuwe gewasse. ASHS Press, Alexandria, VA.

      -. 1998. Stikstof kunsmis effek op graan amarant. Agronomie Joernaal 90: 597-602.

      --&--1988. Kweek graan amarant as 'n spesialiteitsgewas. Kommunikasie- en opvoedkundige tegnologiedienste, Universiteit van Minnesota Uitbreiding.

      Nandula, V. K., J. D. Ray, D. N. Ribeiro, Z. Pan & amp; K. N. Reddy. 2013. Glifosaatweerstand in langwaterhennep (Amaranthus tuberculatus) van Mississippi is te wyte aan beide veranderde teikenplek- en nieteikenplekmeganismes. Onkruidwetenskap 61: 374-383.

      Napompeth, B. 1982. Navorsing en ontwikkeling oor biologiese beheer in Thailand. In die verrigtinge van die Internasionale Konferensie oor Plantebeskermings -trope, Kuala Lumpur. Maleisië, pp. 301-323.

      -. 1989. Biologiese beheer van insekplae en onkruid in Thailand. Biologiese beheer van plae. BIOTROP spesiale publikasie 36: 51-68.

      -. 1992. Kort oorsig van biologiese beheeraktiwiteite in Thailand. Biologiese beheer in Suid- en Oos-Asië. Kyushu University Press. Japan, pp. 51-68.

      Narwall, S. S. 1994. Allelopatie in gewasproduksie. Wetenskaplike uitgewers: Jodhpur. bl. 288.

      Nasionale Akademie van Wetenskappe. 1975. Onderontginde tropiese plante met belowende ekonomiese waarde. Nasionale Akademie van Wetenskappe, Washington, DC.

      Nasionale Navorsingsraad. 1984. Amaranth: Moderne vooruitsigte vir 'n antieke oes. Nasionale Akademie Pers. Washington DC.

      Nasionale Navorsingsraad. 1989. Verlore gewasse van die Inkas. Nasionale Akademie Pers. Washington DC.

      Nordby, D., R. Hartzler en K. Bradley. 2010. Biologie en bestuur van waterhemp. Die reeks Glifosaat, Onkruid en Gewasse, deur die Groep Glifosaat, Onkruid en Gewasse (http: // www. Glyphosateweedscrops.org/). Gepubliseer deur Purdue Extension, Purdue Universiteit, Lafayette, Indiana. VSA.

      Norsworthy, J. K. 2003. Gebruik van sojaboonproduksie opnames om onkruidbestuursbehoeftes van Suid-Carolina boere te bepaal. Onkruidtegnologie 17: 195-201.

      -. 2004. Die vorming van sojabone op die ontbyt van die oggendglorie (Ipomoea lacunosa), gewone kakkerlak (Xanthium strumarium) en sekelpeul (Senna obtusifolia). Onkruidwetenskap 52: 954-960.

      --2005. Optimalisering van glifosaattydsberekening in 'n gemengde stand van glifosaatbestande konvensionele, boor-saad sojaboon. Onkruidtegnologie 19: 942-946.

      --& M. J. Oliveira. 2007. Grondbewerking en sojaboonblare-effekte op gewone kokkelboom (Xanthium strumarium) kom op. Onkruidwetenskap 55: 474-480.

      --, G. M. Griffith, R. C. Scott, K. L. Smith en L. R. Oliver. 2008. Bevestiging en beheer van glifosaatbestande palmer amarant (Amaranthuspalmeri) in Arkansas. Onkruidtegnologie 22: 108-113.

      O'Brien, G. K. & M. L. Price. 1983. Amarant: Graan- en groentetipe. Opvoedkundige bekommernisse vir Honger Organisasie (ECHO) Tegniese Nota. ECHO, Noord Fort Mycre, FL.

      Ogunyemi, S., R. O. Awodoyin en N. A. Otu. 2000. Chemiese beheer van Ageratum conyzoides, Amaranthus spinosus en Cyperus rotundus in sojabone [Glycine max (L.) Merril.]. Journal of Tropical Forest Resources 16: 143-151.

      --, S. E. Ibrahim, O. O. Koleowo & R. O. Awodoyin. 2005. Mededingende impak van Amaranthus spinosus in Celosia argentia en Corchorus olitorius produksie in Suidwes -Nigerië. African Crop Science Conference Proceedings 6: 53-57.

      Oke, O. L. 1983. Amaranth. In: Handboek van tropiese voedsel. Marcel Dekker, New York, 1.

      Oladiran, J.A. & P.M. Mumford. 1985. Die stimulering van saadontkieming deur temperatuur en lig in agronomiese Amaranthus-spesies. Biochcmie und Physiologic der Pflanzen 180: 45-54.

      Oliveira, J. S. & M. F. de Carvalho. 1975. Voedingswaarde van sommige eetbare blare wat in Mosambiek gebruik word. Ekonomiese plantkunde 29: 255-263.

      Omami, E. N. & R. W. Medd. 1992. Ontkieming en na-rypwordingsreaksies in Amaranthus retroflexus saad. Verrigtinge van die 1ste Internasionale Onkruidbeheerkongres 2: 372-374.

      --, A. M. Haigh, R. W. Medd & H. I. Nicol. 1999. Veranderinge in ontkiembaarheid, dormansie en lewensvatbaarheid van A. retroflexus soos beïnvloed deur die diepte en duur van begrafnis. Onkruidnavorsing 39: 345-354.

      Ortiz Ribbing, L. M. & M. Williams. 2006. Potensiaal van Phomopsis amaranthicola en Microsphaeropsis amaranthi as biohcrbicidcs vir verskeie onkruidagtige Amaranthus -spesies. Gewasbeskerming 25: 39-46.

      Orwick, P. L. & M. M. Schreiber. 1979. Inmenging van herwortelvarkbos (Amaranthus retroflexus) en robuuste jakkalsstert (Setaria viridis var. robusta-alba of var. robusta-purpurea) in sojabone (Glycine max). Onkruidwetenskap 27: 665-674.

      Oryokot, J. O. E., S. D. Murphy en C. J. Swanton. 1997. Uitwerking van bewerking en mielies op die opkoms en digtheid van die saailinge (Amaranthus spp.). Onkruidwetenskap 45: 120-126.

      Pal, M. 1964. Chromosoongetalle in sommige Indiese angiospems. Verrigtinge: Plantwetenskappe 60: 347-350.

      -. 1971. 'n Polyhaploid -plant van Amaranthus dubius. Indian Journal of Genetics and Plant Breeding 31: 397-402.

      -. 1972. Intraspesifieke ankuploïdie by Amaranthus graecizans. Current Science 41: 262-263.

      -& amp; T. N. Khoshoo. 1973. Evolusie en verbetering van gekweekte amarante. VI. Sitogene verwantskappe in graansoorte. Teoretiese en toegepaste genetika 43: 242-251.

      --& T. N. Khoshoo. 1974. Graan amarante. Evolusionêre studies in wêreldgewasse. Cambridge University Press. Cambridge. 129.

      --& R. M. Pandey. 1989. Sitogenetika en evolusie van graan amarante. Aspekte van Plantkunde 11:323 336.

      --, R. M. Pandey & T. N. Kashoo. 1982. Evolusie en verbetering van gekweekte amarante. IX.

      Sitogenetiese verwantskap tussen die twee basiese chromosoomgetalle. Tydskrif vir Erflikheid 73: 353-356.

      --, D. Ohri & G. V. Subrahmanyam. 2000. 'n Nuwe basiese chromosoomgetal vir Amaranthus (Amaranthaccae). Cytologia 65: 13-16.

      Palada, M.C. en L.C. Chang. 2003. Voorgestelde kultuurpraktyke vir groente -amarant: Gids vir internasionale samewerkers.

      Patzoldt, W. L. & P. ​​J. Tranel. 2007. Veelvuldige ALS-mutasies verleen onkruiddoderweerstand by waterhennep (Amaranthus tuberculatus). Onkruidwetenskap 55: 421-428.

      -,-& amp A. G. Hager. 2005. 'n Waterhennep (Amaranthus tuberculatus) biotipe met veelvuldige weerstand oor drie onkruiddoderplekke van werking. Onkruidwetenskap 53: 30-36.

      Peters, I. & amp; S. Jain. 1985. Genetiese variasie van geslagsuitdrukking het Amaranthus spp. gekweek - oplossing vir baie raaisels. Amerikaanse tydskrif vir Botany 72: 878.

      --&--. 1987. Genetika van graanamarante III. 3. Gen-sitoplasmiese manlike steriliteit. Journal of Heredity 78: 251-256.

      Peterson, D. E. 1999. Die impak van onkruiddoderbestande onkruide in Kansas. Onkruidtegnologie 13: 632-635.

      Petr, J., I. Michalik, H. Tlaskalova, 1. Capouchova, O. Famera, D. Urminska, L. Tukova & H. Knoblochova. 2003. Uitbreiding van die spektra van plantprodukte vir die dieet in coeliakie. Tsjeggiese tydskrif vir voedselwetenskappe 21: 59-70.

      Plaat, A. V. A. & J. A. G. Areas. 2002. Cholesterolverlagende effek van geëxtrudeerde amarant (Amaranthus caudatus L.) in hipercholesterolemiese hase. Food Chemistry 76: 1-6.

      Powles, S. B. 2008. Ontwikkelde glifosaatbestande onkruide regoor die wêreld: lesse om te leer. Pest Management Science 64: 360-365.

      Pratt, D. B., M. D. K. Owen, L. G. Clark & ​​A. Gardner. 1999. Identifikasie van die onkruidvarkgewasse en waterhennep van Iowa.Iowa State University, Universiteitsuitbreiding.

      Price, A. J., K. S. Balkcom, S. A. Culpepper, J. A. Kelton, R. L. Nichols en H. Schomberg. 2011. Glifosaatbestande palmer amarant: 'n bedreiging vir bewaringsbewerking. Tydskrif vir Grond- en Waterbewaring 66: 265-275.

      Putnam, D. H., E. S. Oplinger en E. M. Schulte. 1989. Amaranth: Altcnative field crops manual. Sentrum vir alternatiewe plant- en diereprodukte. Minnesota Uitbreidingsdiens, Universiteit van Minnesota, St. Paul, MN 55108.

      Qasem, J. R. 1994. Allelopatiese effekte van varkwiet (Amaranthus spp.) Op gars (Hordeum vulgare). Dirasat 21: 101-120.

      -. 1995a. Allelopatiese effekte van Amaranthus retroflexus en Chenopodium murale op groentegewasse. Allelopatiejoernaal 2: 49-66.

      -. 1995b. Allelopatiese effekte van drie Amaranthus spp. (varkkruid) op koring (Triticum durum). Onkruidnavorsing 35: 41-49.

      Railey, K. 1993. Amarant: 'n Gesonde graan vir vegetariese resepte. Health & Beyond Online.

      Ramesh, B. & amp Kumar. 2009. Meiotiese chromosoomanalise in interspesifieke fl-basters van graan-amarante. Tydskrif vir Biologiese Wetenskappe 1: 105-112.

      Rana, J. C., K. Pradheep, S. K. Yadav, V. D. Verma & P. ​​C. Sharma. 2007. Durga: 'n Nuwe variëteit graanamarant vir verbouing in heuwelstreke. Indian Farming 57: 27-28.

      Randall, R. P. 2007. The global compendium of weeds (http://www.hear.org/gcw/). AgWest en die Hawaiian Ecosystems at Risk (HEAR) -projek.

      Rayburn, A. L., R. McCloskey, T. C. Tatum, G. A. Bollero, M. R. Jeschke en P. J. Tranel. 2005. Genoomgrootte-analise van onkruidagtige Amaranthus-spesies. Gewaswetenskap 45: 2557-2562.

      Regnier, E. E. & Harrison, S. K. 1993. Kompenserende reaksies van gewone kokkelboom (Xanthium strumarium) en fluweelblaar (Abutilon theophrasti) op ​​gedeeltelike skaduwee. Onkruidwetenskap 41: 541-547.

      Rezaie, F. & amp Yarnia. 2009. Allelopatiese effekte van Chenopodium album, Amaranthus retroflexus en Cynodon dactylon op ontkieming en groei van saffloer. Journal of Food. Landbou en Omgewing 7: 516-521.

      Riggins, C. W., Y. H. Peng, C. N. Stewart en P. J. Tranel. 2010. Karakterisering van de novo transkriptoom vir waterhennep (Amaranthus tuberculatus) deur gebruik te maak van GS-FLX 454 pyrosequencing en die toepassing daarvan vir studies van onkruiddoder teikenplek-gene. Pest Management Science 66: 1042-1052.

      Rizvi, S. J. H. & amp V. Rizvi. 1992. Allelopatie: Basiese en toegepaste aspekte. Eerste uitgawe. Chapman en Hall.

      Robertson, K. 1981. Die genera van Amaranthaccac in die Suidoostelike Verenigde State. Tydskrif van die Arnold Arboretum 62: 267-314.

      Rodriguez-Gacio, M. C., M. A. Matilla-Vazquez & A. J. Matilla. 2009. Saad-dormansie en ABA-sein: die deurbraak gaan voort. Plant sein en gedrag 4: 1035-1049.

      Rowland, M. W., D. S. Murray & amp; L. M. Verhalen. 1999. Volseisoen palmer amarant (Amaranthus palmeri) inmenging met katoen (Gossypium hirsutum). Onkruidwetenskap 47: 305-309.

      Rushing, D. W., D. S. Murray & amp; L. M. Verhalen. 1985. Onkruidstoring met katoen (Gossypium hirsutum). II. Tuimelvarkbos (Amaranthus albus). Onkruidwetenskap 33: 815-818.

      Sage, R. F., T. L. Sage, R. W. Pearcy en T. Borsch. 2007. Die taksonomiese verspreiding van [C.sub.4]-fotosintese in Amaranthaceae sensu stricto. American Journal of Botany 94: 1992-2003.

      Santelmann, P. W. & amp L. Evetts. 1971. Ontkieming en onkruiddoder vatbaarheid van ses varkeweersoorte. Onkruidwetenskap 19: 51-54.

      Sanz-Penella, J. M., M. Wronkowska, M. Soral-Smietana & M. Haros. 2013. Uitwerking van heel amarantli meel op brood eienskappe en voedingswaarde. Voedselwetenskap en -tegnologie 50: 679-685.

      Sattin, M., M. C. Zuin en I. Sartorato. 1994. Ligte kwaliteit onder veldmielies, sojabone en koringrokke: verrooi variasies. Physiologia Plantarum. 91: 322-328.

      Sauer, J. D. 1950. Die graan amaranths: 'n oorsig van hul geskiedenis en klassifikasie. Annale van die Missouri Botaniese Tuin 37: 561-632.

      -. 1955. Hersiening van die tweehuisige amarante. Madrono 13: 5-46.

      -. 1957. Onlangse migrasie en evolusie van die tweehuisige amarante. Evolusie 11: 11-31.

      -. 1967. Die graan-amarante en hul familielede: 'n hersiene taksonomiese en geografiese opname. Annale van die Missouri Botaniese Tuin 103-137.

      -. 1993. Amaranthaceaes: Amaranth-familie. In Historical Geography of Crop Plants: a Select Roster: CRC Press: Boca Raton, FL pp. 9-14.

      Saunders, R. M. & amp; R. Becker. 1984. Amaranthus: 'n Potensiële voedsel- en voerhulpbron. Advances in Cereal Science and Technology 6: 357-396.

      Schippers, R. R. 2000. Inheemse Afrika-groente: 'n Oorsig van die gekweekte spesies. Chatham UK. Natuurlike Hulpbroninstituut/ACP-EU Tegniese Sentrum vir Landbouhulpbronne en Landelike Samewerking.

      Schonbeck, M. W. & amp; G. H. Egley. 1981a. Fase-volgorde van herwortel varkbos saad ontkieming reaksies op etileen en ander stimuli.I. Plant Fisiologie 68: 175-179.

      --&--. 1981b. Veranderinge in sensitiwiteit van A. retroflexus L sade vir etileen tydens voorinkubasie. II.

      Effekte van wisselende temperatuur en begrawe in grond. Plantsel en Omgewing 4: 237-242.

      Schroeder, D., H. Miiller-Scharer & C. S. A. Stinson. 1993. 'n Europese onkruidopname in 10 hoofgewasstelsels om teikens vir biologiese beheer te identifiseer. Onkruid Navorsing 33: 449-458.

      Schuester, M. 1987. Blaaskewer in Paraguay - 'n potensiële biologiese beheermiddel. Tropiese Plaagbestuur 33: 241.

      Schutz, W., P. Milberg & B. B. Lamont. 2002. Saadrus, na-rypwording en ligvereistes van vier jaarlikse Asteraceae in die suidweste van Australië. Annale van Plantkunde 90: 707-714.

      Scopel, A. L., C. L. Bailare en R. A. Sanchez. 1991. Induksie van uiterste ligsensitiwiteit in begrawe onkruidsade en die rol daarvan in die persepsie van grondbewerkings. Plantselomgewing 14: 501-508.

      Scott, G. H., Askew, S. D. & Wilcut, J. W. 2002. Glifosaatstelsels vir onkruidbestryding in glifosaat-verdraagsame katoen (Gossypium hirsutum). Onkruidtegnologie 16: 191-198.

      Segura-Nieto, M., A. P. Barba de la Rosa & O. Peredes-Lopez. 1994. Biochemie van amarantproteïene. Amaranth: Biologie, chemie en tegnologie 75-106.

      Sellers, B. A., R. J. Smeda, W. G. Johnson, J. A. Kendig & M. R. Ellersieck. 2003. Vergelykende groei van ses Amaranthus -spesies in Missouri. Onkruidwetenskap 51: 329-333.

      Senft, J. P. 1980. Proteïenkwaliteit van amarantgraan, pp. 43-47. In: Proceedings of the Second Amaranth Conference. Rodale Navorsingsverslag (3).

      Sintuig. S. A., H. G. Hancock, R. D. Wauchope, K. L. Armburst, T. J. Peters, J. H. Massey, D. H. Johnson, J. Reynolds, F. Lichtner, G. E. MacDonald, D. W. Rushing, D. Kitner, H. S. McLean & W. Venc. 2007. Onkruiddoderhandboek 9de uitgawe. Weed Science Society of America Lawrence, KS. bl. 458.

      Shagal, M. H., H. M. Maina, R. B. Donatus en K. Tadzabia. 2012. Bioakkumulasie van spoormetaalkonsentrasie in sommige groente verbou naby vullis- en afvalterrein langs Rumude-Doubeli by-pass in Yola North, Adamawa State. Global Advanced Research Journal of Environmental Science and Toxicology 1: 18-22.

      Shahrokhi, S., M. Darvishzadeh, M. Mehrpoovan & M. Farboodi. 2012. Vergelyking van allelopatiese effekte van Amaranthus retroflexus L. verskillende organe -ekstrakte op ontkieming en aanvanklike groei van Alvand- en Zarrin -koringkultivar. Internasionale tydskrif vir Agronomie en Plantproduksie 3: 489-494.

      Sharma, A. K. & M. Banik. 1965. Sitologiese ondersoek van verskillende geslagte van Amaranthaceae met die oog op die onderlinge verwantskappe daarvan. Bulletin van die Botaniese Vereniging van Bengale 19: 40-50.

      Sheidai, M. & Z. Mohammadzadeh. 2008. Sitogenetiese studie van Amaranthus L. spesies in Iran. Sitologia 73: 1-7.

      Sheikh, S. M. & O. Singh. 2013. Pscudoccrcals en giers: die verlore oeste van Kasjmir. Genetiese Hulpbronne en Gewas-evolusie 60: 1191-1199.

      Shewry, P. R. 2002. Die belangrikste saadbergingsproteïene van speltkoring, sorghum, giers en pseudocereale. In: Belton P, Taylor J tes.), Pseudocereals en minder algemene graan, graan eienskappe en benuttingspotensiaal. Springer-Verlag: 1-24.

      Shimi, P. & F. Termeh. 2004. Onkruid van Iran. Organisasie vir Landbounavorsing, Onderwys en Voorligting. Teheran, Iran. bl. 36.

      Shoup, D. E., K. Al-Khatib en D. E. Peterson. 2003. Gewone waterhennep (Amaranthus rudis) weerstand teen protoporfirinogeen-oksidase-inhiberende onkruiddoders. Onkruidwetenskap 51: 145-150.

      Shrefler, J. W., W. M. Stall en J. A. Dusky. 1996. Stekelrige amarant (Amaranthus spinosus L.), 'n ernstige mededinger vir broskopslaai (Lactuca sativa L.). Tuinboukunde 31: 347-348.

      Sibony, M. & B. Rubin. 2002. Die ekologiese fiksheid van ALS-weerstandbiedende Amaranthus retroflexus en meervoudige weerstandbiedende Amaranthus blitoides. Onkruidnavorsing 43: 40-47.

      Simbolon, H. & H. Sutarno. 1986. Reaksie van Amaranthus-spesies op verskeie ligintensiteite. Buletin Penelitian Hortikultura 13: 33-42.

      Singh, U. O., A. M. O. Wadhwani en B.M. Johri. 1983. Woordeboek van ekonomiese plante van Indië. Woordeboek van ekonomiese plante in Indië, (red. 2).

      Singhal, R. S. & P. ​​R. Kulkarni. 1988. Resensie: Amaranths - 'n onderbenutte hulpbron. International Journal of Food Science & Technology 23: 125-139.

      Singhal, B. K. & D. N. Sen. 1981. Allelopatiese potensiaal van varkbos (Amaranthus viridis Linn.) op reën gevoer gewasse van die Indiese woestyn. Geobios 21: 213-221.

      Siriwardana, G. D. & amp; R. L. Zimdahl. 1984. Kompetisie tussen skuurgras (Echinochloa crus-galli) en rooi wortelrooi (Amaranthus retroflexus). Onkruidwetenskap 32: 218-222.

      Smith, H. 1995. Fisiologiese en ekologiese funksie binne die fitochroomfamilie. Jaarlikse oorsig van plantbiologie 46: 289-315.

      Smith, D. T., R. V. Baker & G. L. Steele. 2000. Palmer amarant (Amaranthus palmeri) impakteer op opbrengs, oes en egrenering in droëlandkatoen (Gossypium hirsutum). Onkruidtegnologie 14: 122-126.

      Song, B., X. Zhang, F. Li & amp; P. Wan. 2002. Chromosoomgetalle van 14 spesies in Amaranthus uit China. Acta Phytotaxonomica Sinica 40: 428-432.

      Soomarin, S. J., S. Alipoor en R. Z. Mahmoodabad. 2010. Evaluering van swaelsuur-toediening om die rustyd van gansvoet- en rooiwortel-amarantsaad te onderbreek. Plant Ecophysiology 2: 127-131.

      Souza, M. C. D., L. B. D. Carvalho, P. L. D. C. A. Alves & P. ​​R. F. Giancotti. 2011. Allelopatie by varkbos ('n resensie). Kommunikasie in Plantwetenskappe 1: 5-12.

      Spalding, R. F., D. G. Watts, D. D. Snow, D. A. Cassada, M. E. Exner & J. S. Schepers. 2003. Onkruiddoderlaai na vlak grondwater onder Nabraska se bestuurstelselevalueringsgebied. Journal of omgewingsgehalte 32: 84-91.

      Spencer, K. A. & D. Havranek. 1989. 'n Nuwe spesie Agromyzidae (Diptera) van Venezuela. Florida Entomoloog 72: 441-444.

      --& G. C. Steyskal. 1986. Handleiding van die Agromyzidae (Diptera) van die Verenigde State. Departement van Landbou van die Verenigde State. Landbou Handboek, USDA 638.

      Sprague, L. C., E. W. Stroller, L. M. Wax en M. J. Horak. 1997. Palmer amarant (Amaranthus palmeri) en gewone waterhemp (Amaranthus rudis) weerstand teen geselekteerde ALS-remmende onkruiddoders. Onkruidwetenskap 45: 192-197.

      Spreeth, M. H., M. M. Slabbert, J. A. De Ronde, E. Van Den Heever & amp A. Ndou. 2004. Sifting van cowpca, bambara grondboon en Amaranthus gcrmplasm vir droogtetoleransie en toetsing van geselekteerde plantmateriaal in deelname met geteikende gemeenskappe. WRC Verslag No 944/1/04.

      Srivastava, R. 2011. Voedingskwaliteit van sommige gekweekte en wilde spesies van Amaranthus L. International Journal of Phamaceutical Science and Research 2: 3152-3156.

      Srivastava, R. & amp; B. K. Roy. 2012. Sitogenetiese studies: kariotipiese en evolusionêre aspekte van sommige gekweekte en wilde spesies van Amaranthus L. International Journal of Innovations in Bio-Sciences 2: 154-156.

      Stallknecht, G. F. & J. R. Schulz-Schaeffer. 1993 amarant herontdek. Nuwe gewasse. Wiley. New York: 211-218.

      Steckel, L. E. 2004. Pigweeds in Tennessee. Universiteit van Tennesse.

      -. 2007. Die tweehuisige Amaranthus spp.: hier om te bly. Onkruid Tegnologie 21: 567-570.

      --, C. L. Sprague, A. G. Hager, F. W. Simmons & G. A. Bollero. 2003. Effekte van skaduwee op gewone waterhennep (Amaranthus rudis) groei en ontwikkeling. Onkruidwetenskap 51: 898-903.

      -, C. L. Sprague, E. W. Stoller & amp; L. M. Wax. 2004. Temperatuur-effekte op ontkieming van nege Amaranthus-spesies. Onkruidwetenskap 52: 217-221.

      -, C. L. Main, A. T. Ellis & T. C. Mueller. 2008. Palmer amarant (Amaranthus palmeri) in Tennessee het lae vlak glifosaat weerstand. Onkruidtegnologie 22: 119-123.

      Steinau, A. N., D. Z. Skinner & amp; M. Steinau. 2003. Meganisme van uiterste genetiese rekombinasie in onkruidagtige Amaranthus-basters. Onkruidwetenskap 51: 696-701.

      Stevens, O. A. 1924. Enkele gevolge van die eerste vriesvries. Amerikaanse Midland Naturalis 9: 14-17.

      -. 1932. Die aantal en gewig van sade wat deur onkruid geproduseer word. Amerikaanse Tydskrif vir Plantkunde 19: 784-794.

      Stoller, E.W. & R.A. Myers. 1989. Reaksie van sojabone (Glycine max) en vier breëblaaronkruide op verminderde bestraling. Onkruidwetenskap 37: 570-574.

      Suma, S. 1998. 'n Kort studie oor die omgewingsfisiologie van Amaranthus spinosus L. Proefskrif, doktorsgraad, Bangalore Universiteit. Bangalore.

      Sun, H., D. Wiesenborn, K. Tostenson, J. Gillespie & P. ​​Rayas-Duarte. 1997. Fraksionering van squaleen uit amarant-saadolie. Journal of the American Oil Chemists 'Socicty 74: 413-418.

      Swanton, C. J., J. Z. Huang, W. Deen, M. Tollenaar, A. Shrestha & H. Rahimian. 1999. Effekte van temperatuur en fotoperiode op die fenologiese ontwikkeling van Setaria viridis. Onkruidwetenskap 47: 446-453.

      Sweat, J. K., M. J. Horak, D. E. Peterson, R. W. Lloyd en J. E. Boyer. 1998. Onkruiddoder doeltreffendheid op vier Amaranthus spesies in sojabone (Glycine max). Onkruidtegnologie 12: 315-321.

      Szmedra, P. 1997. Verbod op 2,4-D en die fenoksie onkruiddoders: potensiële ekonomiese impak. Onkruidwetenskap 45: 592-598.

      Takabayashi, M. & K. Nakayama. 1981. Die seisoenale verandering in saaddormansie van hoofbolandse onkruide. Onkruidnavorsing 26: 249-253.

      Takagi, F. 1933. Uber die Chromosomen-Zahlen bei einigen Amaranthus. Arten. Botaniese Tydskrif 47: 556-557.

      Tardif, F. J., I. Rajcan en M. Costea. 2006. 'n Mutasie in die onkruiddoder -teikenplek acetohydroxyacid synthase produseer morfologiese en strukturele veranderinge en verminder fiksheid by Amaranthus powellii. Nuwe fitoloog 169: 251-264.

      Taylorson, R. B. & H.A. Borthwick. 1969. Ligte filtrasie deur blaarafdakke: betekenis vir ligbeheerde onkruidsaadontkieming. Onkruidwetenskap 17: 48-51.

      --& S. B. Hendricks. 1969. Werking van fitochromc tydens voorverkoeling van Amaranthus retroflexus L. sade. Plant Fisiologie 44: 821-825.

      --& S. B. Hendricks. 1971. Veranderinge in fitochroom uitgedruk deur ontkieming van Amaranthus retroflexus L. sade. Plantfisiologie 47: 619-622.

      --& S. B. Hendricks. 1973. Bevordering van saadontkieming deur sianied. Plantfisiologie 52: 23-27.

      Teitz, A. Y., S. F. Gorski en M. B. McDonald. 1990. Die dormansie van lewende amarant Amaranthus lividus L. sade. Saadwetenskap en Tegnologie 18: 781-989.

      Telewski, F. W. & J. A. D. Zeevaart. 2002. Die 120-ycars tydperk vir Dr Beal se saad lewensvatbaarheid eksperiment. American journal of Botany 89: 264-270.

      Teutonico, R. A. & D. Knorr. 1985. Amarant: Samestelling, eienskappe en toepassings van 'n herontdekte voedselgewas. Voedseltegnologie 39: 49-60.

      Thomas, W. E., 1. C. Burke, J. F. Spears en J. W. Wilcut. 2006. Invloed van omgewingsfaktore op slanke amarant (Amaranthus viridis) ontkieming. Onkruidwetenskap 54: 316-320.

      Thompson, K. 1987. Saad en saadbank. Nuwe Phytologist 106: 23-34.

      Thompson, T. 2001. Gevalprobleem: Vraag rakende die aanvaarbaarheid van bokwiet, amarant, quinoa en outs van 'n pasiënt met coeliakie. Tydskrif van die American Dietetic Association 101: 586-587.

      Thompson, K. & amp J. P. Grime. 1983. 'n Vergelykende studie van ontkieming in reaksie op daagliks-fluktuerende temperature. Tydskrif vir Toegepaste Ekologie 20: 141-156.

      Tisler, A. M. 1990. Voeding in die varkbosvlooikewer. Disonycha glabrata Fab. (Coleoptera: Chrysomelidae), op Amaranthus retroflexus. Virginia Journal of Science 41: 243-245.

      Torres, P. C. B., A. A. Garcia, R. P. Aviles, L. R. Hernandez & amp; J. F. L. Olguin. 2011. Entomofaunastiese studie van die verbouing van Amaranth (Amaranthus hypochondriacus L.) in Puebla, Mexiko, Revesta Mexicana de Ciencias agricolas 2: 359-371.

      Tranel, P. J. & amp; T. R. Wright. 2002. Weerstand van onkruide teen ALS-inhiberende onkruiddoders: wat het ons geleer? Onkruidwetenskap 50: 700-712.

      --, W. Jiang, W. L. Patzoldt en T. R. Wright. 2004. Intraspesifieke veranderlikheid van die asetolaktaat-sintase-geen. Onkruidwetenskap 52: 236-241.

      Trucco, F., M. R. Jeschke, A. L. Rayburn & P. ​​J. Tranel. 2005a. Amaranthus hybridus kan onder veldtoestande gereeld deur A. tuberculatus bestuif word. Oorerflikheid 94: 64-70.

      -, M. R. Jeschke, A. L. Rayburn & amp; P. J. Tranel. 2005b. Promiskuïteit by onkruidagtige amarante: hoë frekwensie van vroulike langwaterhemp (Amaranthus tuberculatus) x gladde varkeblom (A. hybridus) verbastering onder veldtoestande. Onkruidwetenskap 53: 46-54.

      --, D. Zheng, A. J. Woodyard, J. R. Walter, T. C. Tatum, A. L. Rayburn & P. ​​J. Tranel. 2007. Niehibriede nageslag uit kruisings van tweeledige amarante: implikasies vir gene-vloei-navorsing. Onkruidwetenskap 55: 119-122.

      -, T. Tatum, A. L. Rayburn & P. ​​J. Tranel. 2009. Uit die moeras: Eenrigting verbastering met onkruidagtige spesies kan die voorkoms van Amaranthus tuberculatus as 'n onkruid verklaar. Nuwe Phytologist 184: 819-827.

      Uphof, J. C. 1968. Woordeboek van ekonomiese plante. Cramer: New York, bl. 545.

      USDA, ARS. 1999. Nasionale Genetiese Hulpbronne Program. Germplasma Hulpbronne.

      USDA, NRCS. 2010. Die plantedatabasis (http://plants.usda.gov). Nasionale aanlegdatasentrum. Baton Rouge: 70,874-4490.

      Uusikua, N. P., A. Oelofsea, K. G. Duodub, M. J. Besterc & M. Faberd. 2010. Voedingswaarde van blaargroentes van Afrika suid van die Sahara en hul potensiële bydrae tot menslike gesondheid: 'n Oorsig. In: Journal of Food Composition and Analysis 23: 499-509.

      Vangessel, M. J. & amp; K. A. Renner. 1990. Rcdroot-varkwiet (Amaranthus retroflexus) en gras (Echinochloa crus-galli) inmenging by aartappels (Solatium tuberosum). Onkruidwetenskap 38: 338-343.

      Velu, G. & A. M. Ali. 1995. Allelopatiese effek van varkbos en perdepostelein op Boerhaavia diffusa. Gewas Navorsing 10: 103-106.

      Vencill, W. K., Gray, T. L., Culpepper, A. S., Gaines, C. & Westra, R. 2008. Onkruiddoderweerstand in die Amaranthaccae. Tydskrif vir Plant Siektes en beskerming 41-44.

      Vietmeyer, N. 1978. Arm mense se oeste. Amerikaanse agentskap vir internasionale ontwikkeling (VSA) 1:12.

      Vigueira, C. C., K. M. Olsen en A. L.Caicedo. 2013. Die rooi koningin in die com: Landbouonkruide as modelle van vinnige aanpasbare evolusie. Oorerflikheid 110: 303-311.

      Vogt, G. B. & H. A. Cordo. 1976. Onlangse Suid-Amerikaanse veldstudies van voornemende biobeheermiddels van onkruid. In Proceedings of the Research Planning Conference on the Aquatic Plant Control Program, Charleston pp. 36-55.

      Walter, J. & C. Dobes. 2004. Morfologiese karakters, geografiese verspreiding en ekologie van neofitiese Amaranthus blitum L. subsp. emarginatus in Oostenryk. Annale van die Natuurhistoriese Museum, Wene, 105(B). Wene, Oostenryk: Annale van die Natuurhistoriese Museum 645-672.

      Wang, J. L., J. J. Long, T. E. Hotehkiss en J. O. Berry. 1993. [C.sub.4] fotosintetiese geenuitdrukking in lig- en donkergegroeide amarantsaadlobbe. Plant Fisiologie 102: 1085-1093.

      Wang, Y., Y. L. Meng, H. Ishikawa, T. Hibino, Y. Tanaka, N. Nii & T. Takabe. 1999. Fotosintetiese aanpassing by soutstres in driekleur blare van 'n [C.sub.4] plant Amaranthus tricolor. Plant- en Selfisiologie 40: 668-674.

      Wyk, D. E. & R. W. Spellenberg. 1986. Chromosoomtellings van angiosperme van Wes-Noord-Amerika. Phytologia 61: 119-125.

      Washitani, I. 1985. Veldlot van Amaranthus patulus-sade wat onderworpe is aan blaarblaar-inhibisie van ontkieming. Occologia 66: 338-342.

      --& A. Takenaka. 1984. Ontkiemingsreaksies van 'n nie-dormante saadpopulasie van Amaranthus patulus Bertol. tot konstante temperature in die sub-optimale reeks. Plantsel en omgewing 47: 353-358.

      Wassom, J. J. & P. ​​J. Tranel. 2005. Geamplifiseerde fragmentlengte polimorfisme-gebaseerde genetiese verwantskappe tussen onkruidagtige Amaranthus-spesies. Tydskrif vir Erflikheid 96: 410-416.

      Watanabe, T., Y. Murata en M. Osaki. 2009. Amaranthus tricolor het die potensiaal vir fitoremediëring van kadmium-besmette gronde. Kommunikasie in grondkunde en plantanalise 40: 3158-3169.

      Waterhouse, D. F. 1994. Biologiese beheer van onkruide: Suidoos-Asiatiese vooruitsigte. Australiese Sentrum vir Internasionale Landbounavorsing 125.

      Weaver, S. E. 1984. Differensiële groei en mededingende vermoë van Amaranthus retroflexus. A. powellii en A. hybridus. Canadian Journal of Plant Science 64: 715-724.

      --& E. L. McWilliams. 1980. Die biologie van Kanadese onkruid. 44. Amaranthus retroflexus L, Amaranthus powelli S. Wats en Amaranthus hybridus L. Canadian Journal of Plant Science 60: 1215-1234.

      --& A. G. Thomas. 1986. Ontkiemingsreaksies op temperatuur van atrazink-weerstandige en -vatbare biotipes van twee varkbos (Amaranthus) spesies. Onkruidwetenskap 34: 865-870.

      Webb, D.M., C.W. Smith en J. Schulz-Schaeffer. 1987. Amarant-saailing-opkoms soos beïnvloed deur saaidiepte en temperatuur op 'n termogradiëntplaat. Agronomiejoernaal 79: 23-26.

      Webster, T. M. 2009. Onkruidopname-Suidelike state. Proceedings of the Southern Weed Science Society 62: 509-524.

      --& L. M. Sosnoskie. 2010. Verlies van glifosaat-doeltreffendheid: 'n Veranderende onkruidspektrum in Georgia-katoen. Onkruidwetenskap 58: 73-79.

      Wetzel, D. K., M. J. Horak en D. Z. Skinner. 1999a. Gebruik van PCR-gebaseerde molekulêre merkers om onkruidagtige Amaranthus spesies te identifiseer. Onkruidwetenskap 47: 518-523.

      --, --, --& P. A. Kulakow. 1999b. Oordrag van onkruiddoderweerstandseienskappe vanaf Amaranthus palmeri na Amaranthus rudis. Onkruidwetenskap 47: 538-543.

      Whitehead, W. F. & B. P. Singh. 1993. Bevolkingsdigtheid en grond-pH-effekte op groente-amarantproduksie. In: Janick, J. en Simon, J.E. (reds.), New crops. Wiley, New York: 562-564.

      Wiersema, J. H. & B. Leon. 1999. Wêreld ekonomiese aanlegte CRC Press: Boca Raton, pp. 32-34.

      Wiese, A. M. & L. K. Binning. 1987. Berekening van die drempeltemperatuur van ontwikkeling vir onkruid. Onkruidwetenskap 35: 177-179.

      Wiese, A. E. & R. G. Davis. 1967. Onkruid-opkoms uit twee gronde op verskillende vog, temperature en dieptes. Onkruid 15: 118-121.

      Williams, J. T. & D. Brenner. 1995. Graan amarant (Amaranthus spesie). Graankosse en pseudocereale.

      Williams, R., L. Peal en P. Bartholomew. 2005. Saadhidrasie/dehidrasie in 'n allelochemiese (kumarien) verander ontkieming en saailinggroei. Allelopatiejoernaal 15: 183-196.

      Wills, R.B.H., A.W.K. Wong, F.M. Scriven en H. Greenfield. 1984. Voedingsamestelling van Chinese groente. Tydskrif vir Landbou- en Voedselchemie 32: 413-416.

      Wise, A. M., T. L. Gray, E. P. Prostko, W. K. Vencill & T. M. Webster. 2009. Vaststelling van die geografiese verspreidingsvlak van asetolaktaat sintases weerstand van palmer amarant (Amaranthus palmeri) toetredings in Georgië. Onkruidtegnologie 23: 214-220.

      Woolley, J. T. & E. Stoller. 1978. Ligte penetrasie en liggeïnduseerde saadontkieming in grond. Plant Fisiologie 61: 597-600.

      Wright S. W., H. D. Coble, C. D. Verkragter en T. W. Rufty. 1999. Vergelykende reaksies van sojaboon (Glycine max), sekelpeul (Senna obtusifolia) en palmer amarant (Amaranthus palmeri) op ​​wortelsone en lugtemperatuur. Onkruidwetenskap 47: 167-174.

      Yan, X., L. Zhenyu, W. P. Gregg en L. Dianmo. 2001. Indringerspesies in China - 'n oorsig. Biodiversiteit en Bewaring 10: 1317-1341.

      York, A. C., J. R. Whitaker, A. S. Culpepper en C. L. Main. 2007. Glifosaat-weerstandige palmer amarant in die suidoostelike Verenigde State. Proceedings of the Southern Weed Science Society 60: 225.

      Rezwana Assad (1) * Zafar A. Reshi (1) * Snober Jan (1) * Irfan Rashid (1,2)

      (1) Departement Plantkunde, Universiteit van Kasjmir, Srinagar. J&K 190 006, Indië