Inligting

Kan Euchromatien omskep in Heterochromatien?

Kan Euchromatien omskep in Heterochromatien?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

ek weet dit Heterochromatien kan omskep in Euchromatien maar is die omgekeerde moontlik? Indien wel, hoe dan?


Ek stel voor dat u in die toekoms 'n klein hoeveelheid navorsing doen voordat u dit vra. Die Wikipedia -bladsy vir euchromatin sê byvoorbeeld:

Euchromatin neem deel aan die aktiewe transkripsie van DNA na mRNA -produkte. Die ontvoude struktuur laat gene -regulerende proteïene en RNA -polimerase komplekse toe om aan die DNA -volgorde te bind, wat dan die transkripsieproses kan begin. Nie alle euchromatien word noodwendig getranskribeer nie, maar in die algemeen word dit wat nie in heterochromatien is, omskep in heterochromatien om die gene te beskerm terwyl dit nie in gebruik is nie. Daar is dus 'n direkte skakel na hoe aktief produktief 'n sel is en die hoeveelheid euchromatien wat in die kern daarvan voorkom. Daar word vermoed dat die sel transformasie van euchromatine in heterochromatien gebruik as 'n metode om gene -uitdrukking en replikasie te beheer, aangesien sulke prosesse anders optree op dig gekompakteerde chromatien, bekend as die 'toeganklikheidshypotese'. Een voorbeeld van konstitutiewe euchromatien wat 'altyd aangeskakel' is, is huishoudelike gene, wat kodeer vir die proteïene wat nodig is vir basiese funksies van seloorlewing.

Fakultatiewe heterochromatien is chromatien wat heen en weer omskakel na gelang van omstandighede. Dit vind plaas deur (de)"kondensasie" of (de)"verdigting" van chromatien:

Onder die molekulêre komponente wat blykbaar die verspreiding van heterochromatien reguleer, is die Polycomb-groepproteïene en nie-koderende gene soos Xist. Die meganisme vir sulke verspreiding is steeds 'n kwessie van kontroversie.[19] Die polycomb-onderdrukkende komplekse PRC1 en PRC2 reguleer chromatienverdigting en geenuitdrukking en speel 'n fundamentele rol in ontwikkelingsprosesse.

Ek raai u aan om die bladsye 'n bietjie te lees en 'n meer spesifieke vraag te stel as hulle dit nie beantwoord nie.


Verskil tussen Euchromatin en Heterochromatin

Ons liggaam bestaan ​​uit miljarde selle. 'N Tipiese sel bevat 'n kern, en die kern bevat chromatien. Volgens biochemici is die operasionele definisie van chromatien die DNA-, proteïen-, RNA-kompleks wat uit eukariotiese gelyseerde interfasekerne onttrek word. Volgens hulle is die chromatien die produk wat gevorm word uit die verpakte spesiale proteïene wat algemeen bekend staan ​​as histone. Om dit eenvoudig te stel, die chromatien is hoofsaaklik die kombinasie van deoksiribonukleïensuur of bloot DNA en ander soorte proteïene. Chromatien is die een wat verantwoordelik is om DNS in kleiner volumes te verpak sodat dit binne die sel kan pas. Dit is ook verantwoordelik vir die versterking van die DNA vir mitose en meiose om plaas te vind. Chromatien voorkom ook dat die DNA beskadig word en beheer die geenuitdrukking en replikasie van die DNA.

Daar is twee soorte chromatien. Dit is euchromatin en heterochromatin. Hierdie twee vorme word op 'n sitologiese manier onderskei oor die intensiteit van elke vorm. Die euchromatien is minder intens as heterochromatien. Dit dui slegs aan dat heterochromatien strenger DNA -verpakking het. Om meer uit te vind oor die verskil tussen euchromatien en heterochromatien, sal hierdie artikel u 'n vinnige blik gee oor hierdie twee chromatienvorme.

Die lig verpakte materiaal word euchromatien genoem. Alhoewel dit lig verpak is in die vorm van DNA, RNA en proteïen, is dit beslis ryk aan geenkonsentrasie en is dit gewoonlik onder aktiewe transkripsie. As jy eukariote en prokariote gaan ondersoek, sal jy die teenwoordigheid van eukromatien vind. Heterochromatien word slegs in eukariote aangetref. Wanneer euchromatien gekleur en onder 'n optiese mikroskoop waargeneem word, lyk dit soos ligkleurige bande terwyl heterochromatien donker gekleur is. Die standaardstruktuur van euchromatien is ontvou, verleng en net omtrent so groot soos 'n 10 nanometer mikrofibril. Hierdie minuut chromatien funksioneer in die transkripsie van DNA na mRNA produkte. Die gene -regulerende proteïene, insluitend die RNA -polimerase -komplekse, kan bind met die DNA -volgorde as gevolg van die ontvoude struktuur van die euchromatien. As hierdie stowwe reeds gebind is, begin die transkripsieproses. Die aktiwiteite van die euchromatin help met die oorlewing van selle.

Aan die ander kant is heterochromatien 'n dig verpakte vorm van DNA. Dit word algemeen op die perifere gebiede van die kern aangetref. Volgens sommige studies is daar waarskynlik twee of meer toestande van heterochromatien. Onaktiewe satellietreekse is die belangrikste bestanddele van heterochromatien. Die heterochromatien is verantwoordelik vir geenregulering en beskerming van chromosomale integriteit. Hierdie rolle word moontlik gemaak as gevolg van die digte DNS-verpakking. Wanneer twee dogterselle van 'n enkelouersel verdeel word, word heterochromatien gewoonlik geërf, wat beteken dat die nuutgekloonde heterochromatien dieselfde DNA-streke bevat wat epigenetiese oorerwing tot gevolg het. As gevolg van die grensdomeine kan transkribeerbare materiaal onderdruk word. Hierdie voorkoms kan lei tot die ontwikkeling van verskillende vlakke van geenuitdrukking.

Die volgende opsomming gee u 'n duideliker begrip van die twee vorme van chromatien: euchromatin en heterochromatin.

Chromatien vorm die kern. Dit bestaan ​​uit DNA en proteïen.

Chromatien het twee vorme: euchromatin en heterochromatin.

Wanneer dit onder 'n optiese mikroskoop gekleur en waargeneem word, is euchromatiene die ligkleurige bande terwyl heterochromatiene die donkerkleurige bande is.

Donker vlekke dui op strenger DNA -verpakking. Heterochromatiene het dus stywer DNA-verpakking as euchromatiene.

Heterochromatiene is kompak opgerolde streke terwyl euchromatiene los opgerolde streke is.

Euchromatin bevat minder DNA terwyl heterochromatien meer DNA bevat.

Euchromatien is vroeg replikatief terwyl heterochromatien laat replikatief is.

Euchromatien word gevind in eukariote, selle met kerne, en prokariote, selle sonder kerne.

Heterochromatien word slegs in eukariote aangetref.

Die funksies van euchromatien en heterochromatien is geenuitdrukking, geenonderdrukking en DNA-transkripsie.


Heterochromatienstruktuur: lesse van die ontluikende gis

Die eukariotiese genoom kan rofweg verdeel word in eukromatien- en heterochromatien -domeine wat struktureel en funksioneel van mekaar verskil. Heterochromatien word gekenmerk deur die hoë kompaktheid en die remmende effek daarvan op DNA -transaksies, soos gene -uitdrukking. Vorming van heterochromatien behels spesiale histoon modifikasies en die werwing en verspreiding van stilmaak komplekse en veroorsaak veranderinge in die primêre en hoër orde strukture van chromatien. Die afgelope twee dekades het dramatiese vordering plaasgevind in die ontleding van die molekulêre aspekte van heterochromatien as gevolg van die identifisering van die histoonkode vir heterochromatien sowel as sy skrywers en uitveërs (histoonveranderende ensieme) en lesers (stiltefaktore wat histoonveranderings herken). Daar is begin verstaan ​​hoe heterochromatiese histoonveranderings en stilstellende faktore bydra tot die spesiale primêre en hoër orde strukture van heterochromatien. Die ontluikende gis Saccharomyces cerevisiae word al lank gebruik as 'n modelorganisme vir heterochromatienstudies. Resultate van hierdie studies het aansienlik bygedra tot die toeligting van die algemene beginsels wat die vorming, instandhouding en funksie van heterochromatien beheer. Hierdie oorsig is gefokus op ondersoeke na die strukturele aspekte van heterochromatien in S. cerevisiae. Huidige begrip van ander aspekte van heterochromatien, insluitend hoe dit geenstilstelling bevorder en die epigenetiese oorerwing daarvan, word kortliks opgesom.

Sleutelwoorde: Saccharomyces cerevisiae Sir proteïene heterochromatien hoër orde chromatien struktuur transkripsie stilte.


Belangrike verskille tussen heterochromatien en euchromatien

Hier volg die belangrikste punte om te onderskei tussen heterochromatien en euchromatin:

  1. Die dig verpakte vorm van DNA in die chromosoom word genoem heterochromatien, terwyl die los verpakte vorm van DNA in die chromosoom genoem word euchromatien.
  2. In heterochromatien, die digtheid van DNA is hoog en is donker gevlekterwyl die eichromatien die digtheid van DNA is min en is liggiesbevlek.
  3. Heterochromatien is gevind slegs aan die periferie van die kern in eukariotiese selle, en Euchromatin is geleë in die binneste liggaam van die kern van prokariotiese sowel as in eukariotiese selle.
  4. Heterochromatien toon min of geen transkripsionele aktiwiteit nie so goed is hulle geneties onaktief, aan die ander kant, Euchromatien aktief neem deel aan die proses van transkripsie en is geneties aktief ook.
  5. Heterochromatien is kompak opgerol en is laat herhaling, terwyl Euchromatin is los gerol en vroeë herhaling.
  6. Streke van heterochromatien is taai, maar die areas van Euchromatien is nie-klewerig.
  7. In Heterochromatien deel, die fenotipe bly onveranderd van 'n organisme, alhoewel variasie gesien kan word, as gevolg van die effek in DNA tydens die genetiese proses in die Euchromatien.
  8. Heterochromatien laat die geen-uitdrukking regulasie en behou ook die strukturele integriteit van die sel alhoewel Euchromatien tot gevolg het genetiese variasies, en laat die genetiese transkripsie toe.

Afsluiting

Uit bogenoemde inligting rakende chromatien en hul struktuur en tipes. Ons kan sê dat slegs Euchromatin kragtig betrokke is by die transkripsieproses, hoewel heterochromatien en die tipes daarvan nie so 'n belangrike rol speel nie.

Konstitutiewe heterochromatien bevat die satelliet-DNS, en dit omring die sentromeer, en fakultatiewe heterochromatien word ontbind. Daar kan dus blykbaar gesê word dat die eukariotiese selle en hul binnestruktuur relatief kompleks is.


Aanhaling: Hughes SE, Hawley RS (2009) Heterochromatien: 'n vinnig ontwikkelende spesieversperring. PLoS Biol 7(10): e1000233. https://doi.org/10.1371/journal.pbio.1000233

Gepubliseer: 27 Oktober 2009

Kopiereg: © 2009 Hughes, Hawley. Dit is 'n oop toegangsartikel wat versprei word onder die voorwaardes van die Creative Commons Erkenningslisensie, wat onbeperk gebruik, verspreiding en reproduksie in enige medium moontlik maak, mits die oorspronklike outeur en bron erken word.

Mededingende belange: Die skrywers het verklaar dat daar geen mededingende belange bestaan ​​nie.

Byna 100 jaar gelede het bioloë streke van chromosome in twee tipes verdeel, eukromatien en heterochromatien, op grond van hul voorkoms (hersien in [1]). Die aanvanklike klassifikasie van DNA was gebaseer op die waarneming dat euchromatiese streke hul kondensgraad tydens die seldelingsiklus verander het, terwyl heterochromatiese streke gedurende die grootste deel van die selsiklus sterk gekondenseer gebly het. Alhoewel die biologiese betekenis van heterochromatien vir baie jare onduidelik gebly het, is dit nou duidelik dat heterochromatien 'n aantal biologiese rolle speel, waaronder 'n onlangs geïdentifiseerde rol in spesiasie. Benewens die verskille in die tydsberekening van chromosoomkondensasie, is talle ander verskille tussen euchromatien en heterochromatien geïdentifiseer. Euchromatien word verryk met unieke koderingsvolgordes, en die gene binne die euchromatien word tipies aktief getranskribeer. Heterochromatien, aan die ander kant, word as geenarm beskou, omdat dit hoofsaaklik saamgestel is uit skikkings van hoogs herhalende eenvoudige rye, soos satellietreekse en/of transponeerbare elemente. Heterochromatien word verryk by die sentromere (sien Figuur 1) en telomere van chromosome.

Getoon word 'n verteenwoordigende akrosentriese chromosoom wat beide gekondenseerde heterochromatiese (donkergrys) en minder gekondenseerde euchromatiese streke (liggrys) bevat. Langs elke streek is kenmerke tipies vir elke tipe chromatien.

'n Aantal chromatienmodifikasies word spesifiek met óf heterochromatien óf euchromatien geassosieer, soos spesifieke metileringspatrone op die histone. Proteïene wat betrokke is by die skep van die histoon-metileringspatrone wat met heterochromatien geassosieer word, sowel as proteïene, soos heterochromatien proteïen 1 (HP1) wat betrokke is by heterochromatienvorming en geenstilstelling, word verkieslik gelokaliseer tot heterochromatiese DNA gevind. Laastens blyk dit dat heterochromatien vinnig ontwikkel, sodat die volgordesamestelling van heterochromatiese streke van selfs nouverwante spesies dikwels onderskei word. Die tekort aan gene in heterochromatien, sowel as die vinnige evolusie daarvan, het daartoe gelei dat baie wetenskaplikes in die twintigste eeu heterochromatien as 'n "rommel" -DNA beskou het met 'n klein biologiese belang, behalwe om die sentromere en telomere te bevat en moontlik te beskerm.

Die vrugtevlieg Drosophila melanogaster en sy naaste familielede was gewilde modelle vir die bestudering van die aard en vorming van heterochromatien (hersien in [1]). In hierdie spesies kan euchromatien maklik onderskei word van perisentriese heterochromatien, wat die sentromere van mitotiese chromosome omring, deur sitologie as gevolg van die verskille in die kondensasie van die twee tipes DNA. Boonop slaag heterochromatiese streke nie in die politeenchromosome nie, wat hoogs gerepliseerde chromosome is wat styf in die speekselkliere geassosieer bly. Dit maak 'n redelike presiese afbakening van die aansluiting tussen euchromatien en heterochromatien moontlik. Daarbenewens, D. melanogaster is 'n hoogs oordraagbare stelsel vir die uitvoering van genetiese skerms en vir die uitvoer van voorwaartse genetiese manipulasies. Omdat heterochromatien en euchromatien maklik geneties ontleed kan word D. melanogaster, is die biologie van heterochromatien intens bestudeer met behulp van hierdie organisme.

Werk inderdaad in D. melanogaster het die siening van heterochromatien as "rommel"-DNS begin uitdaag en gedemonstreer dat heterochromatien 'n aantal belangrike sellulêre funksies speel. Die eerste aanduidings van 'n 'funksie' vir heterochromatien kom uit studies oor die veelvuldige rolle van heterochromatien in die bemiddeling van rekombinasie tydens meiose [2], [3]. Miskien meer krities, die plasing van normaalweg euchromatiese gene naby heterochromatien veroorsaak die veranderlike stilte van hierdie gene, 'n effek wat bekend staan ​​as posisie-effek variegasie, of PEV (hersien in [1]). Hierdie stilte -effek en die feit dat sommige gene in heterochromatien moet wees om behoorlik getranskribeer te word, dui daarop dat heterochromatien 'n kritieke rol kan speel in die globale beheer van geenregulering [4] - [6].

Verder het eksperimente deur Karpen, Dernburg, Hawley en hul medewerkers getoon dat paring van heterochromatiese streke nodig is vir die behoorlike segregasie van chromosome wat nie rekombinasie ondergaan tydens vroulike meiose nie [7]-[9]. Daaropvolgende werk het getoon dat chromosome wat nie rekombinasie ondergaan nie (die X en 4 de ) word verbind deur heterochromatiese drade tydens prometafase I in oösiete en dat hierdie drade waarskynlik deel is van die meganisme waardeur heterochromatien nierekombinante chromosoomsegregasie fasiliteer [10].

Bewyse vir drade wat chromosome verbind tydens meiose in die sperms van albei D. melanogaster en kraanvoëls dui op 'n bewaarde funksie vir draadagtige strukture in die segregasie van chromosome tydens meiose [11],[12]. Alhoewel dit nog nie vasgestel is of hierdie drade uit heterochromatien saamgestel is nie, is die herhalende intergeniese spasieerdergebied van rDNA, wat in heterochromatien woon, nodig vir die behoorlike paring van die Y chromosoom met die X chromosoom tydens manlike meiose in D. melanogaster [13]. Laastens is soortgelyke tipes drade waargeneem wat voortspruit uit die heterochromatiese sentromeerstreke van chromosome tydens mitose in soogdierselle, wat daarop dui dat heterochromatiese drade ook 'n belangrike rol speel in chromosoomsegregasie tydens mitose [14], [15].

Gegewe die kritieke funksies van heterochromatiese rye in beide meiose en mitose en die vinnige verandering in volgorde gedurende evolusie, is dit miskien nie verbasend as verskille in heterochromatiese rye of die proteïene wat dit handhaaf inderdaad 'n rol kan speel in isolasie van spesies nie [16]. Paring van verwante spesies lei soms tot die dood of steriliteit van een of albei geslagte van die nageslag, wat bekend staan ​​as hibriedonversoenbaarheid. Alhoewel hibridiese onverenigbaarheid al dekades lank bestudeer is, was daar slegs 'n paar insigte oor die molekulêre meganismes wat dit onderlê, en in die gevalle bekend vir die Drosophila spesies, het die hibriede onverenigbaarheid proteïenkoderende gene behels [17], [18]. In hierdie uitgawe van PLoS Biologie Ferree en Barbash demonstreer dat die vinnige divergensie van heterochromatien ook 'n belangrike rol speel in die handhawing van die reproduktiewe isolasie van D. melanogaster van die sustersoort Drosophila simulans [16]. Die kruising tussen D. simulans wyfies en D. melanogaster mannetjies is ongewoon deurdat manlike nageslag lewensvatbaar is, maar wyfies sterf tydens embroniese ontwikkeling [19]. (Gewoonlik in gevalle van hibriede onverenigbaarheid is die heterogametiese mannetjies die aangetaste geslag as slegs een geslag steriel of dodelik is.)

Ferree en Barbash het gevind dat die dodelikheid in hibriede vroulike embrio's die gevolg was van mislukkings tydens mitotiese afdelings 10-13 [16]. By hierdie wyfies het chromosomale streke gereeld tydens 'n anafase van hierdie mitotiese afdelings baie sterk gespan en agter die ander chromosome agtergebly [16]. Die agtergeblewe DNA kon tydens mitose nie behoorlik van sy suster geskei word nie, wat lei tot onbehoorlike chromosoomsegregasie, afwykende mitotiese afdelings en uiteindelik die dood van vroulike embrio's.

Deur gebruik te maak van fluorescerende in situ-hibridisering, het die skrywers vasgestel dat die agterblywende chromatien hoofsaaklik bestaan ​​uit die heterochromatiese en hoogs herhalende 359 bp herhaling op die X chromosoom uit die D. melanogaster pa [16]. Hierdie spesifieke heterochromatiese herhalingstipe het 'n ander volgordesamestelling en is baie minder volop in D. simulans. Die 359-bp herhalingsbevattende gebied op die D. melanogaster X chromosoom oorvleuel ook die Zhr locus, 'n genetiese streek wat geïdentifiseer is omdat dit uit die D. melanogaster X chromosoom toegelaat D. melanogaster mans om lewensvatbare basterdogters te produseer wanneer daar oorgesteek word D. simulans wyfies [19].

Die ontdekking dat dodelikheid by hibriede wyfies die gevolg is van 'n versuim om die integriteit van 'n heterochromatiese gebied van die D. melanogaster X chromosoom wat die herhalingsvolgorde van 359 bp bevat, dui op 'n interessante moontlikheid, naamlik dat die chromosoom agteruitgaan en die dodelikheid van die D. melanogaster X chromosomale heterochromatien in vroulike basters kom voor omdat die D. simulans moeder versuim om 'n proteïen- of RNA-molekule te verskaf wat nodig is vir behoorlike instandhouding en/of skeiding tydens mitose van die 359-bp-herhalingsgebied wat deur die D. melanogaster vader (sien figuur 2). 'N Mens kan selfs dink dat die mislukking in mitotiese segregasie wat hier waargeneem word, weerspieël dat die heterochromatiese drade waargeneem is om die pericentromeric heterochromatine in beide mitotiese en meiotiese selle nie behoorlik op te los nie (sien hierbo).

Hierdie model is gebaseer op die resultate van die artikel gepubliseer deur Ferree en Barbash in hierdie uitgawe van PLoS Biologie [16]. 'n Kruising tussen D. melanogaster mans en D. simulans wyfies, wat lei tot basterwyfies wat vroeg in embriogenese sterf, word regs gewys. Die tekening aan die linkerkant beeld 'n kruising tussen D. melanogaster mans aan D. melanogaster wyfies ter vergelyking. Vir die eenvoud, slegs die X chromosome word getoon en die heterochromatiese gebied word met 'n donkerder kleur gespesifiseer. In beide kruisings lei die samesmelting van die sperm en eiersel tot sigote wat 'n paar dra X chromosome. Die kruis met die D. melanogaster wyfies lei tot normale chromosoomsegregasie tydens anafase van mitotiese afdelings 10-13 in vroulike embrio's. In die kruis met D. simulans vroulike mitose word nie normaalweg voltooi in die baster vroulike embrio's nie. Terwyl die moeder X chromosome skei normaalweg na teenoorgestelde spilpale, die skeidende sentromere van die paternaal afgeleide X chromosome is verbind deur 'n brug van chromatien. Hierdie brug, wat heterochromaties is en bestaan ​​uit 'n gebied wat ryk is aan die 359 bp herhaling, veroorsaak onbehoorlike skeiding van die susterchromatiede van die X chromosoom, 'n gebeurtenis wat uiteindelik lei tot afwykende mitotiese afdelings en uiteindelik die dood van vroulike hibriede embrio's. Die agterstand of oorbrugging van die 359-bp-streek is waarskynlik te wyte aan 'n afwesigheid van 'n moeder-gelaaide faktor in die D. simulans eier (getoon as geel diamante in die D. melanogaster eier). Ons stel ons voor dat hierdie faktor betrokke kan wees by die oplossing van heterochromatiese drade wat getoon is om die perisentromeriese streke van beide mitotiese en meiotiese chromosome in normale selle te verbind (sien teks vir 'n beskrywing). Die afwesigheid van hierdie faktor verhoed die behoorlike vorming of instandhouding van chromatienstruktuur in die 359-bp herhalingsgebied in vroulike baster embrio's.

Die skrywers het dit vermoed D. simulans ontbreek 'n faktor wat nodig is om heterochromatiese stabiliteit te handhaaf of om heterochromatiese skakeling op te los D. melanogaster X chromosomale heterochromatien tydens embrioniese mitotiese afdelings. Hulle het inderdaad bevind dat topoisomerase II, 'n ensiem wat nodig is vir behoorlike mitose, afwykende lokalisering toon aan die agterblywende DNA in hibriede embrio's. Verdere werk sal nodig wees om te bepaal of ander proteïene of RNA -molekules afwesig is of afwykend gelokaliseer is uit die D. simulans sitoplasma van die moeder, en as die afwesigheid daarvan voldoende is om die gebreke in die 359 bp herhalingsgebied in hibriede vroulike embrio's te veroorsaak.

Alhoewel dit die eerste voorbeeld is van 'n heterochromatiese volgorde wat hibriede onverenigbaarheid veroorsaak, sal ander gevalle waarskynlik in die natuur voorkom. Inderdaad, ons kan nie anders as om 'n parallel tussen hierdie voorbeeld van hibriede onlewensvatbaarheid en 'n genetiese verskynsel bekend as segregasievervorming, wat ook goed bestudeer is in D. melanogaster [20]. In hierdie stelsel 'n nuwe mutant bekend as SD, wat in die euchromatine van Chromosome geleë is 2, verhoed die meiotiese oordrag van homoloë 2 e chromosome wat hoë kopiegetalle dra van 'n heterochromatiese element bekend as Reageer (Rsp) [21]. Die genetiese basis van hierdie verskynsel, wat veroorsaak dat onbehoorlike kondensasie en funksie van Rsp-draende spermatiede, word goed verstaan, en 'n volle molekulêre begrip van hierdie proses is binne bereik. Terwyl segregasievervorming inderdaad 'n voorbeeld van "meiotiese dryfkrag" is en nie 'n spesie-isolasiemeganisme nie, word dit hier genoem omdat dit 'n tweede geval illustreer waarin 'n mutant in een stam die funksie van 'n heterochromatiese element in 'n ander benadeel en sodoende die meganismes illustreer van "heterochromatiese onverenigbaarheid" is meer algemeen as wat 'n mens sou verwag het.

Aangesien heterochromatien vinnig verander, kan die meganismes wat dit in stand hou, heel moontlik verskil soos populasies deur verskeie meganismes geïsoleer word. As daardie meganismes so verander dat die heterochromatien van populasie A nie meer deur die onderhoudsproteïene in populasie B in stand gehou kan word nie, dan word die heterochromatien self 'n versperring tussen daardie populasies soos spesievorming voortgaan. Baie meer vrae wag op ondersoek, sowel in terme van die stelsel van hibriede onwrikbaarheid wat hierbo beskryf is, en in terme van die beoordeling van die mate waartoe die veilige bewaring van heterochromatiese integriteit ander voorbeelde van spesiasie lê. Maar een ding is duidelik: as enige deel van heterochromatien inderdaad "rommel" is, dan is dit "rommel" waarna beide goed versorg moet word en "rommel" wat een spesie van sy bure onderskei.


Transkripsie organiseer euchromatin soortgelyk aan 'n aktiewe mikroemulsie

Chromatien is georganiseer in heterochromatien, wat transkripsioneel onaktief is, en euchromatien, wat kan wissel tussen transkripsioneel aktiewe en onaktiewe toestande. Hierdie verandering in euchromatien -aktiwiteit gaan gepaard met veranderinge in die ruimtelike verspreiding daarvan. Hoe euchromatien-herrangskikkings vasgestel word, is onbekend. Hier gebruik ons ​​superresolusie en lewendige selmikroskopie om aan te toon dat transkripsioneel onaktiewe euchromatien wegbeweeg van transkripsioneel aktiewe euchromatien. Hierdie beweging word aangedryf deur die vorming van RNA-verrykte mikro-omgewings wat onaktiewe euchromatien uitsluit. Deur teorie te gebruik, toon ons aan dat die segregasie in RNA-verrykte mikro-omgewings en euchromatien-domeine as 'n aktiewe mikro-emulsie beskou kan word. Die binding van transkripsies aan chromatien via RNA-polimerase II vorm effektiewe amfifiele wat die twee gesegregeerde fases afwissel. Tesame met vorige eksperimente dui ons data daarop dat chromatien op die volgende manier georganiseer word: heterochromatien skei van euchromatien deur faseskeiding, terwyl transkripsie euchromatien organiseer soortgelyk aan 'n aktiewe mikro-emulsie.


Abstrak

Heterochromatien is 'n sleutel argitektoniese kenmerk van eukariotiese chromosome, wat spesifieke genomiese domeine met spesifieke funksionele eienskappe toeken. Die vermoë van heterochromatien om die aktiwiteit van mobiele elemente te beperk, DNA-herstel in herhalende streke te isoleer en akkurate chromosoomsegregasie te verseker, is noodsaaklik vir die handhawing van genomiese stabiliteit. Nukleosome in heterochromatienstreke vertoon histoon post-translationele modifikasies wat bydra tot ontwikkelingsregulering deur die afstamming van spesifieke afstamming van die afstamming te beperk. Die meganismes vir die oprigting van heterochromatien en die instandhouding van heterochromatien is skeibaar en behels die vermoë van sekwenspesifieke faktore wat aan ontluikende transkripsies gebind is om chromatien-veranderende ensieme te werf. Heterochromatien kan langs die chromatien versprei vanaf nukleeerplekke. Die geneigdheid van heterochromatien om sy eie verspreiding en erfenis te bevorder, word deur inhiberende faktore teengewerk. Vanweë die belangrikheid daarvan vir die chromosoomfunksie, speel heterochromatien 'n belangrike rol in die patogenese van verskillende menslike siektes. In hierdie oorsig bespreek ons ​​bewaarde beginsels van heterochromatienvorming en funksie deur gebruik te maak van geselekteerde voorbeelde uit studies van 'n reeks eukariote, van gis tot mens, met die klem op insigte verkry uit eensellige modelorganismes.


Organisering van chromosome

Natella I. Enukashvily, Nikita V. Ponomartsev, in Advances in Protein Chemistry and Structural Biology, 2013

1. Inleiding

In 1928 stel Heitz die terme euchromatin en heterochromatin (HC) voor vir verskille wat met geskikte chromosomale vlekke opgespoor kan word (Heitz, 1928). Hy het selle van verskillende soorte mos met karmyn -asynsuur gevlek en 'n tipe chromatien in die kern waargeneem wat gedurende die selsiklus gekondenseer bly. Heitz beskryf die gedeelte van die kernchromatien as heterochromatien, wat 'n gekondenseerde toestand behou (dws donker gevlek verskyn) dwarsdeur die selinterfase, terwyl die res van die kernchromatien strek tot wat hy die euchromatientoestand noem. Cooper (1959) kon die data van Drosophila opsom en stel voor dat heterochromatien en euchromatien verskil in hul biofisiese konformasies en in metaboliese uitdrukking van hul gene, maar nie in hul basiese struktuur van DNA wat binne chromosome gerangskik is nie. Die konsep van 'n eukaryotiese genoom wat bestaan ​​uit twee tipes chromatien met verskillende verpakkings, word algemeen aanvaar en word in skoolhandboeke in biologie opgeneem. Alhoewel die term heterochromatien oorspronklik sitologies gedefinieer is as streke van mitotiese chromosome wat in die interfase gekondenseer bly, word dit nou meer losweg toegepas om streke van chromosome in te sluit wat kenmerkende eienskappe toon soos byvoorbeeld geenonderdrukking en stilswye (hersien deur Craig, 2005 Lohe & Hilliker, 1995).

Dit word algemeen aanvaar dat daar twee tipes heterochromatien is - konstitutief en fakultatief. Daar word gemeen dat die konstitutiewe HK deur die hele selsiklus gekondenseer word, anders as die fakultatiewe HK wat ontwikkelingsgereguleer word. In mitotiese chromosome word konstitutiewe heterochromatiese streke meestal in sentromere en perisentromere streke sowel as naby telomere geposisioneer. Chromosome 1, 9, 16 en Y bevat groot blokke heterochromatien. Die fakultatiewe HC kan op verskillende gebiede van chromosome gevorm word. By wyfies by soogdiere word een X-chromosoom (maternaal of paternaal afgelei) lukraak in die vroeë embrionale selle geïnaktiveer, met vaste inaktivering in alle afstammelinge (Lyon, 1961). Fakultatiewe HC kan gevorm word in die promotorstreke van nie-getranskribeerde gene (Rand & Cedar, 2003). Sommige van die neosentromere (streke van euchromatiese DNA wat eienskappe van sentromere verkry het) wat tot dusver bekend is, kan heterochromatiseer, alhoewel dit binne euchromatiese streke gevorm word (Amor & amp Choo, 2002 Saffery et al., 2003).


Euchromatin funksie

Ten spyte daarvan dat dit aktief nagevors word, word die struktuur van chromatien steeds swak verstaan, hoewel dit blyk dat die siklus waarin die sel op 'n sekere tydstip is, die struktuur van chromatien bepaal. Nie verrassend nie, die struktuur van euchromatin gee wenke oor die funksie daarvan en waarom dit in transkripsie -aktiewe selle voorkom. Soos hierbo genoem, word euchromatine ook krale-op-'n-string genoem as gevolg van die ooreenkoms tussen 'n halssnoer van krale wat deur 'n tou verbind is en die nukleosome wat deur die linker-DNA verbind is. In hierdie konformasie is euchromatien los en laat gevolglik die linker-DNS blootgestel sodat dit op hierdie manier getranskribeer kan word, RNA en DNA-polimerases asook ander proteïene kan toegang tot die DNA kry. As gevolg van sy los struktuur is euchromatien moeilik om onder 'n mikroskoop te sien en kom dit vaag voor as dit gekleur word—in teenstelling met die maklik sigbare heterochromatien, wat dig verpak is.


MATERIAAL EN METODES

OI-DIC beeldingstelsel vir biologiese monsters

Die hoofskema van die OI-DIC mikroskopiestelsel word in Figuur 1A getoon. Die mikroskoop bevat 'n ligbron met 'n banddeurlaatfilter, gekruiste lineêre polarisator en ontleder, faseverskuiwing, kondensor- en objektiewe lense, buislens en ladinggekoppelde toestel (CCD) digitale kamera. Om die beperkings van konvensionele DIC-beelding te oorkom, bevat die mikroskoop twee balkskeersamestellings (Shribak, 2014). Elke samestelling bestaan ​​uit twee identiese DIC -prisma's en 'n 90 ° polarisasie rotator. Deur roterende ligpolarisasie deur die rotators kan die skuifrigtings vinnig met 90 ° verander word sonder om die monsters (bv. Lewende selle) of die prisma's meganies te draai. Ons het ses rou beelde geneem met behulp van OI-DIC mikroskopie, met twee loodregte skuifrigtings en drie vooroordele ± 0.15λ en 0, waar λ die golflengte is. Die vasgelegde OI-DIC-beelde is verwerk tot OPD-beelde (kaarte) waarvan die intensiteit lineêr ooreenstem met die OPD-waarde. Beeldverwerking is uitgevoer met behulp van tuisgeboude sagteware (OIDIC.exe). Hierdie en ander verwerkingsalgoritmes is voorheen beskryf (Shribak en Inoue, 2006 Shribak, 2013 Shribak et al., 2017).

Om OI-DIC te vergelyk met die CellVista SLIM Pro fase-kartering mikroskoop, vervaardig deur Phi Optics (Champaign, IL), het ons 7-μm-deursnee glasstawe ingebed, wat as spasieerders in vloeibare kristalskerms gebruik word, in Fisher Permount montering medium (Fisher Scientific, https://www.fishersci.com). Die RI's van die glasstawe en die Permount-medium by golflengte 546 nm is onderskeidelik 1,56 en 1,524. Die beelde is verkry deur gebruik te maak van 100 ×/1.4 NA olie-onderdompelingsobjektieflense. Die CellVista SLIM het vier fase-kontrasbeelde geneem en verwerk by die verskillende vooroordele.

Skatting van digtheid van sellulêre inhoud

Om kalibrasiekurwes van die RI's van proteïene en nukleïensure (aanvullende figuur S3) te verkry, is bees serumalbumien (BSA Sigma A-9418) en salm sperm DNA (Fisher Scientific BP-2514) opgelos in selkweekmedium by konsentrasies van 0 –200 en 0–30 mg/ml, onderskeidelik. Die RI's van die bereide standaardoplossings is gemeet met 'n refraktometer, Abbé-3L (Bausch & amp Lomb). The measured RIs and solution densities were plotted and fitted with linear functions to obtain calibration curves.

We estimated intracellular density distribution from obtained OPD maps using the following two steps (Figure 1B). First, we calculated the RI from the OPD. Because the OPD is proportional to the thickness of a sample and the difference in RI between the sample and the surrounding solution, as shown in Figure 1B, we calculated the RI of samples on the basis of the RI of the surrounding solution and sample thickness. Second, we obtained the dry mass density (“density” for short) of the sample from its RI, because the RI of a sample is proportional to its density. For proteins and nucleic acids, which are the dominant materials in mammalian cells (>60% of dry mass) (Alberts et al., 2007), our calibration curves (Supplemental Figure S3 see above) of RI versus dry mass density using BSA and salmon sperm DNA showed that both were well fitted to linear functions and were almost identical (RI = 1.3375 + 1.4 × 10 –4 × C, waar C is dry mass density). Therefore, dry mass density in live cells, which consists mainly of proteins and nucleic acids, was calculated from their RI using a single calibration curve (Supplemental Figure S3). To estimate the densities of the total cell contents, we measured the average thickness of the cytoplasm and nucleus in each cell line (Supplemental Figure S1, A and B). The pericentric foci were assumed to be spherical (Supplemental Figure S1C). To obtain the RI of cytoplasm (RIcy), we used the RI of the surrounding culture medium (RImed, 1.3375) (Supplemental Figure S2). For the RIs of the nucleus and the pericentric foci, we used our calculated values of RIcy and RInuc, respectively (Supplemental Figure S2). These estimates were created using ImageJ software.

EGFP-MeCP2 construction

A plasmid containing MeCP2-EGFP was kindly provided by M.C. Cardoso (Brero et al., 2005). The moiety of MeCP2-EGFP was cut by XhoEk en XbaI enzymes and blunted. The blunted fragment was inserted into the EkoRV site of the pEF5/FRT/VS-DEST Gateway Vector (Invitrogen) to generate pEF5-MeCP2-EGFP-FRT.

EGFP-mH3.1p-H3.1 construction

A mouse histone H3.1 promoter (∼840 base pairs)-H3.1 fragment was amplified from mouse embryonic stem (ES) cell genomic DNA by PCR using the following primer set:

5′-AGCCCTCTCCCCGCGGATGCGGCGGGCCAGCTGGATG­TCC-3′. The amplified fragment was cloned into an EGFP vector to obtain pmH3.1p-H3.1-EGFP. Then two more insert sequences were prepared. One was the H3.1promoter-H3.1-EGFP amplified from the pmH3.1p-H3.1-EGFP vector using the following primer set:

and 5′-TTACTTGTACAGCTCGTCCATGCCGAGAGT-3′. The other was the 3′ untranslated region of H3.1 (∼500 base pairs) amplified from the mouse ES genome using the primer pair: 5′-TGGACGAGC­TGTACAAGTAAAGTTCGTCTTTCTGTGTTTTTCAAA­GGCTC-3′

For backbone vector preparation, the region from the EF1α-promoter to the BGH polyadenylation signal sequence was removed from pEF5/V5-FRT Gateway (Invitrogen) to create the pFRT-Hygromycin vector. The pFRT-Hygromycin vector, H3.1promoter-H3.1-EGFP sequence, and 3′ untranslated region sequence were ligated by SLIC (Li and Elledge, 2007) to prepare the pmH3.1p-H3.1-EGFP-3′UTR-FRT plasmid. In addition, upstream of the H3.1 promoter, an insulator fragment (tandem cHS4 kindly provided by G. Felsenfeld) was inserted to obtain pIx2-mH3.1p-H3.1-EGFP-3′UTR-FRT.

EGFP-fibrillarin construction

To clone the fibrillarin gene, total RNA was isolated from NIH3T3 cells using the RNeasy Mini Kit (Qiagen), and first-strand cDNA was synthesized using the SuperScript III First-Strand Synthesis System (Thermo) with oligo(dT). The coding region of fibrillarin was amplified from the first-strand cDNA using the following primer pair: 5′-GGGGTACCATGAAGCCAGGTTTCAGCCC-3′ and 5′-GCGGGA­TCCTCAGTTCTTCACCTTGGGAG-3′. The amplified fragment was digested with KpnEk en BamHI and ligated into KpnI/BamHI-digested pEGFP-C1 (Clontech, Palo Alto, CA). EGFP-fibrillarin fragments were excised, blunt-ended using T4 DNA polymerase (Takara, Japan), and inserted into EkoRV-precut pEF1-FRT to generate pEF1-EGFP-fibrillarin-FRT.

Cell culture and stable cell lines

We used RPE1, a human cell line, and NIH3T3, a mouse cell line. All of the cell lines were maintained in DMEM (Lonza) supplemented with 10% (vol/vol) fetal bovine serum (FBS) and 0.584 g/l l -glutamine (Sigma) at 37°C with 5% CO2 in air in a humidified incubator. To establish NIH3T3 cells expressing MeCP2-EGFP, EGFP-fibrillarin, or H3.1-EGFP, we used the Flp-In system (Invitrogen) as previously described (Maeshima et al., 2010 Hihara et al., 2012).

OI-DIC microscopy system

Details of the microcopy system are provided in the Supplemental Material.

Live-cell OI-DIC microscopy imaging

Cells were seeded on 24 mm × 24 mm square glass coverslips coated with poly d -lysine (Sigma) and cultured for 1–2 d. Then 30 min before imaging, 500 ng/ml Hoechst 33342 was added into the media and incubated further. The cells were mounted on a glass slide with a thin silicone spacer. We observed the mounted cells by OI-DIC and fluorescence imaging.

OI-DIC imaging of glass rods

A small number of glass rods 4 µm in diameter were suspended in two types of mineral oil with refractive indices of 1.54 and 1.58. Approximately 2 µl of the suspended solution was sandwiched between a glass slide and a coverslip, and then sealed with nail polish. The glass rods in the mineral oil were analyzed by OI-DIC microscopy using the same procedure as the live cell imaging.

Fiksasie

For formaldehyde fixation, cells on the square glass coverslips were washed once with phosphate-buffered saline (PBS), and then fixed in 4% formaldehyde at room temperature for 15 min. The fixed cells were washed with 10 mM HEPES-KOH, pH 7.5, 100 mM KCl, and 1 mM MgCl2 (HMK) (Maeshima et al., 2006) and permeabilized with 0.5% Triton X-100 in HMK at room temperature for 5 min. The treated cells were washed with HMK, stained with 500 ng/ml Hoechst 33342 in HMK at room temperature for 10 min, and then washed again with HMK. For MeOH fixation, cells on coverslips were fixed in ice-cold MeOH at –20°C for 30 min. Then the fixed cells were washed with HMK at room temperature for 15 min, stained with 500 ng/ml Hoechst 33342 in HMK for 10 min, and washed again with HMK. Finally, the cells were mounted on a glass slide and observed as described above.

Immunostaining of histone H3K9me3

Immunostaining was performed as previously described (Maeshima et al., 2010 Hihara et al., 2012). Cells were fixed in 2% formaldehyde (Wako) and permeabilized with Triton X-100. The primary and secondary antibodies were mouse anti-H3K9me3 (a generous gift from Hiroshi Kimura) and Alexa-Fluor-594-conjugated goat anti-mouse immunoglobulin G (Invitrogen) used at dilutions of 1:500 and 1:1000, respectively. Then DAPI (500 ng/ml) was added to the cells for 5 min, followed by washing with PBS prior to DNA staining. Images were obtained using a DeltaVision microscopy imaging system (Applied Precision) or a FLUOVIEW FV1000 confocal laser scanning microscope (OLYMPUS).

Measurements of cell thicknesses

Live RPE1 and NIH3T3 cells were seeded on 35 mm glass-bottom dishes. To fluorescently label DNA and cytoplasm, cells were incubated in culture medium containing 0.5 µg/ml Hoechst 33342 (Dojindo) and 5 µg/ml Calcein-AM (Dojindo) for 30 min. After washing out excess fluorescent dye, the stained cells were observed under an OLYMPUS FLUOVIEW FV1000 confocal laser scanning microscope equipped with a 60 ×/1.2 NA water objective. Hoechst 33342 and Calcein-AM fluorescence signals were acquired as three-dimensional image stacks (500 nm × 32 sections). The thicknesses of three regions (nucleus, cytoplasm, entire cell see Supplemental Figure S1) were measured in each cell line from the acquired stack images by ImageJ software.

Measurement of nuclear volume of live cells

Image stacks of live NIH3T3 and RPE1 cells acquired to measure cell thickness (described above) were used. The images were converted into binary images by auto thresholding in ImageJ software. Then the volumes of binary image stacks were analyzed using the 3D Objects Counter ImageJ plugin (Bolte and Cordelieres, 2006).

Quantification of fluorescence from Hoechst-stained DNA, MeCP2-EGFP, and α-H3K9me3

Image stacks of live or immunostained NIH3T3 cells (described above) were used. The middle sections of Hoechst-stained nuclei were selected from the z-stack images. The highest intensity of a focal plane of heterochromatin and the mean intensity of the surrounding low-intensity region in a nucleus were taken as the intensities of heterochromatin and the surrounding euchromatin. These values were adjusted to account for the background intensity.

Composition estimation of euchromatin and heterochromatin in live cells

The genome size of diploid mouse cells is 5.6 × 10 9 base pairs. Because 1 pg of DNA is 978 × 10 6 base pairs (978 × 10 6 base pairs/pg), the mass of the whole mouse genome is 5.73 pg. If we assume that nucleosomes (core histones + DNA) form every 200 base pairs of the genome and that the mass ratio of core histones to DNA is around 1:1, the mass of the nucleosomes in a mouse nucleus is 11.5 pg (5.73 × 2). The average mouse nuclear volume was calculated to be ∼1000 µm 3 (Supplemental Figure S6B), and the density of nucleosomes in mouse euchromatin was calculated to be 11.5 mg/ml. Further estimates are described under Resultate.

Monte Carlo simulation

Monte Carlo simulation is a computational algorithm that performs a numerical integration by making a random movement and evaluating whether the movement is acceptable based on the change in potential energy (Hibino et al., 2017). All of the molecules in the simulations were treated as hard spherical bodies. We employed a Metropolis Monte Carlo method without long-range potential or hydrodynamic interactions to determine the diffusive motion of molecules (Morelli and ten Wolde, 2008). The diameters and diffusion coefficients (Ds) of the crowding agents used in the simulations were 9.6 nm and 9 µm 2 s −1 , respectively, which are comparable to those of a single nucleosome molecule. Die Ds of tracers (spheres with diameters of 5, 10, 15, and 20 nm) were 18, 9, 6, and 4.5 µm 2 s −1 , respectively. Hierdie Ds were determined by the Stokes–Einstein relationship based on parameters from the EGFP monomer, the diameter and D of which were 3.8 nm and 23.5 µm 2 s −1 , respectively (Hihara et al., 2012). Simulations were conducted in a 210-nm cubic box with two compartments (left and right halves) with periodic boundaries to avoid problems caused by finite space, and make the system more like an infinite one. For the “nucleosomes only” scenario, which corresponds to 11.5 mg/ml (euchromatin) and 85.9 mg/ml (heterochromatin), 134 and 968 copies of 9.6 nm spheres (crowding agents) were randomly placed in the left and right halves of the box, respectively. These crowding agents mimicked nucleosomes displaced less than 5 nm from their initial positions at t = 0 s (the “dog on a leash” model see also Hihara et al., 2012, and Maeshima et al., 2015). Then 50 tracers that could diffuse freely were placed in the left (euchromatin) region. The motion of the molecules was iteratively simulated following previously described procedures (Hihara et al., 2012 Maeshima et al., 2015). For the second simulation (nucleosomes + nonnucleosomal materials), 1578 and 1578–3945 9.6 nm spheres (crowding agents) were randomly placed in the left and right regions of the box, respectively, to represent euchromatin and heterochromatin (1.53–2.5-fold density differences). To represent nucleosomes, 134- and 968 9.6-nm spheres were randomly placed in the left and right regions, with their behavior following the “dog on a leash” model. The rest of the spheres moved freely only in each half, to represent diffusing proteins and RNAs. Then 50 tracers were placed in the left (euchromatin) region. Although the simulation process was similar to the first simulation, we restricted the movements of crowding agents to within their regions to keep the density of each region constant. Results were obtained by averaging 150 samples from three independent trials. The simulation time step, Δt, was 10 ns.

Statistiese ontledings

All of the statistical analyses were performed using the two-tailed Student’s t toets. bl values less than 0.05 were considered statistically significant.


Kyk die video: DNA Packaging Animation. chromatin, histone and nucleosome modifications (September 2022).