Inligting

Kan primers vir PCR gedupliseer word?

Kan primers vir PCR gedupliseer word?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Voltooi beginnersvraag hier, moenie lag nie: As ek 'n paar primers het wat gesintetiseer is, en ek is amper besig om uit hulle te raak, is daar enige manier om dit te dupliseer / te versterk / om meer daarvan self te sintetiseer? Ek ken nie die rye nie. Of is my enigste opsie om meer te koop? Dankie


Kort antwoord: u moet nog iets koop, maar u moet ook die volgorde hê om te bestel.

Lang antwoord: Die Taq -polimerase benodig 'n stukkie DNA (of RNA) om die reaksie voor te berei en die DNA -ketting te kan vergroot; daarom gebruik ons ​​in die eerste plek primers (ook om die reaksiespesifisiteit te verseker vir die gebied wat ons wil hê versterk). Om die reaksie moontlik te maak, sal jy 'n onderlaag nodig hê wat komplimentêr is met die een wat jy gebruik het van omtrent dieselfde lengte (of ten minste nie veel korter nie), so dit maak eintlik nie regtig sin nie, want jy sal 'n onderlaag moet hê om jou onderlaag. Aangesien onderlaag vandag goedkoop is, bestel nog 'n paar.


Mariene Ensieme en Gespesialiseerde Metabolisme - Deel A

Michael F. Freeman, in Methods in Enzymology, 2018

2.2.2 Buffers, oplossings en reagense

Plasmied pLMB51 (Addgene #40083)

Phusion DNA polimerase en verskaf buffer

Deoksiribonukleotiede (dNTP's, 10 mM elk)

TAE agarosegel met 0,5 μg/ml ethidiumbromied of ekwivalent, TAE buffer (40 mM Tris, 20 mM asynsuur, 1 mM EDTA, pH 8.0)

Beperkingsensieme BamHI-HF, XbaI, BglII, SpeI-HF en gepaardgaande buffers

E coli kloningsstam soos DH5α

Lysogenie sous (LB) medium en LB-agar plate met 100 μg/ml ampisillien (finale konsentrasie)


Herhaalde mutagensis primer in plekgerigte mutagenese - (Okt/07/2013)

Ek probeer om puntmutasie te skep in die domein van geen van belang met behulp van enzynomics EZ-MIX kit. Ek glo hierdie kit volg 'n vinnige verandering-plek-gerigte mutagenese-metode PCR-amplifikasie van voorwaartse reserwe komplementêre primer met die bekendstelling van mutasie in die middel van primer, gevolg deur dpn1-vertering.

Ek is in staat om die kolonies te kry na transformasie, maar toe ek twee klone stuur vir die volgorde, blyk dit uit 'n herhalingsgebied van die hele mutagenese primer in beide klone. Mag ek weet of iemand dit al ondervind het en hoe ek hierdie probleem kan oorkom. Ek dink dit is beter om meer klone vir volgorde te stuur. Dankie !!

Ek moet genoem dat ek in staat is om die punt mutasie te kry, maar die hele primer streek gedupliseer. dankie !!

Bedoel u dat u twee duplikate van u mutasie in u geen het? Ek sukkel om te verstaan ​​wat jy bedoel.

Ek dink hy sê dat hy die volgorde het wat aanvullend is tot die mutagenese primers wat in sy resultaat gedupliseer word. Waarskynlik ook die mutasie wat hy wou hê.

Ek kan my net twee maniere voorstel hoe dit sou gebeur; die volgorde naby die mutasieplek is baie soortgelyk en die primers bind dit, maar dit sou onversoenbaar wees met die polimareringsproses. Die ander is die nuwe stringe wat op een of ander manier uitmekaar getrek is op plekke waar die snitte is, waarskynlik omdat die punte komplementêr is en die volgorde tydens die plasmiedherstel in die bakteriese selle gedupliseer het.

Probeer beslis meer klone. Maar as u ten minste primer -rye kan plaas, kan u weet of primers die probleem is.

Dankie vir die antwoord. Aangeheg is die primers wat ek gebruik het vir die terreingerigte mutagenese. Rooi kleur drievoudige kodon is die puntmutasie wat ek ingebring het in plaas van sy oorspronklike TAC trippelkodon. Ek ontwerp die onderlaag self en die onderlaag word nie gesuiwer soos nodig mag wees in plekgerigte mutagenese nie.

5 & ​​# 8217- AAACAAATTTG TTG ATTGGGTTCTT

Hierdie hele 25bp primer word gedupliseer of verdriedubbel in die kolonies volgordes na transformasie. Byvoorbeeld, in plaas van flanking-AAACAAATTTG TTG ATTGGGTTCTT-flanking, nou word dit flanking-AAACAAATTTG TTG ATTGGGTTCTTAAACAAATTTG TTG ATTGGGTTCTT-flank. Ek het meer klone gehad, maar kon nie normale klone kry nie. Ek is nie seker of dit te wyte is aan primer-gloeiing nie, aangesien hele streek in plaas van gedeeltelike streek gedupliseer word.

Ek sal dit waardeer as iemand my voorstelle kan gee. Dankie

Dit is vreemd dat u die primer verskeie kere perfek invoeg.

Thermo Scientific, self-dimers:

Is die 5'- en 3'-streke van jou invoegplek soortgelyk wat veelvuldige invoegings sal toelaat?

Sê die mutagenese kit dat 'n 25bp primer voldoende is vir 'n 2bp mutasie? My protokolle benodig gewoonlik & gt40bp vir die korrekte mutasie.

Jou resultate is om die minste te sê vreemd.  Kan jy 'n bietjie volgorde-inligting oor jou 3'- en 5'-geenvolgorde verskaf?

Was daar ooit 'n oplossing vir hierdie kwessie? Enige nuwe gedagtes? Ek het sopas 'n terreingerigte mutagenese uitgevoer en ek ervaar dieselfde verskynsel - herhaling van 'n volgorde wat die mutant bevat. 

Ek dink nie daar was 'n resolusie nie - maar dit lyk vir my asof daar moontlik 'n aanvulling van die OP se primers kan wees, wat moontlik kan lei tot duplisering van die webwerf van belang.

Ek het dit by verskeie geleenthede waargeneem. Ek het nog nooit 'n oplossing uitgepluis nie, behalwe om meer kolonies te sift. Toe dit gebeur, was dit gewoonlik 1 uit 5 kolonies wat ek vir volgorde gestuur het. Ek gebruik 'n baie hoër konsentrasie primer as wat aanbeveel word. Ek gebruik ongeveer 4-5uM primer in die reaksie, wat baie hoër is in vergelyking met my normale PCR. As ek moes raai hoekom dit gebeur, dink ek die hoë konsentrasie onderlaag kan hierdie vreemde resultaat veroorsaak.


Polymerase Chain Reaction (PCR): Biologie -aantekeninge oor PCR

PCR bied 'n eenvoudige en vernuftige metode vir eksponensiële amplifikasie van spesifieke DNS-volgordes deur in vitro DNS-sintese, d.w.s. hierdie tegniek het dit moontlik gemaak om groot hoeveelhede DNS-fragmente te sintetiseer sonder om dit te kloneer.

Kary Mulis het in 1985 die tegniek ontwikkel op grond van die gebruik van 'n ensiem wat Taq DNA -polimerase genoem word. Die PCR -tegniek is nou outomaties en word uitgevoer deur 'n spesiaal ontwerpte masjien.

Die tegniek behels die volgende drie stappe (Fig. 22.16):

ek. Denaturering van DNA-fragment:

Die teiken-DNA-bevattende volgorde wat geamplifiseer moet word, word hitte gedenatureer (ongeveer 94°C vir 15 sekondes) om sy komplementêre stringe te skei, hierdie proses word smelting van teiken-DNS genoem.

ii. Uitgloeiing van primers:

Primers word oormaat bygevoeg en die temperatuur word vir 60 sekondes tot ongeveer 68 ° C verlaag, gevolglik vorm die primers die waterstofbindings en gloei aan die DNA aan weerskante van die DNA -volgorde.

Laastens word verskillende nukleosiedtrifosfaat (dATP, dGTP, dCTP, dTTP) en 'n termostabiele DNA-polimerase (Taq-polymerase van Thermus aquaticus en Vent polymerase van Thermococcus litoralis) by die reaksiemengsel gevoeg, dit help in die polymerisasieproses van primers en daarom , verleng die primers (by 68°C) wat lei tot sintese van veelvuldige kopieë van teiken-DNS-volgorde.

Na voltooiing van al hierdie stappe in een siklus, word die tweede siklus weer herhaal na dieselfde proses. As 20 sulke siklusse voorkom, word ongeveer een miljoen kopieë van teiken-DNS-volgorde geproduseer. Onlangs is hierdie tegnologie baie meer verbeter, waar in plaas van Taq-polimerase die rTth-polimerase gebruik word wat RNA na DNA transkribeer, en daarna die DNA amplifiseer.

Gewysigde vorme van PCR:

Die konvensionele PCR is die simmetriese PCR tegniek. Daar is 'n paar ander gewysigde vorme van PCR wat vir verskeie doeleindes gebruik word:

AP-PCR (Arbitrarily Primed Polimerase Chain Reaction):

Dit benodig slegs 'n enkele primer relatief en skynbaar baie kleiner as die primers wat in PCR gebruik word. Hierdie tegnologie word gebruik vir DNA -profilering, in dier- en plantbiotegnologie sowel as in forensiese medisyne.

Teikensekwensies van een string kan in verskeie grootteordes meer versterk word in vergelyking met sy komplementêre string. Hierdie benadering is veral nuttig vir die generering van enkelstring DNA-fragmente wat gebruik word vir volgordebepaling van DNA.

IPCR (omgekeerde polimerase kettingreaksie):

Met hierdie metode kan die amplifikasie en insig van DNA langs 'n bekende DNA -volgorde, die primers na buite wys. Deur die omgekeerde PCR te gebruik, kan die onbekende reekse wat bekende reekse flankeer, maklik geamplifiseer word.

RT-PCR (Reverse Transcriptase Polymerase Chain Reaction):

Alhoewel die PCR-amplifikasie gewoonlik op die DNA-sjabloon uitgevoer word, maar met hierdie tegniek kan die RNA ook vir amplifikasie gebruik word. Hierdie tegniek is veral nuttig om die uitdrukking van gene te bestudeer en om die obskure spesies van mRNA te monitor.

Geneste PCR-inleiders is dié wat intern tot die eerste primerpaar is. Die groter fragmente wat deur die eerste ronde PCR geproduseer word, word gebruik as die sjabloon vir die tweede PCR. Hierdie tegniek skakel enige vals nie-spesifieke amplifikasie produkte uit.

Toepassing van PCR in Biotegnologie:

PCR het baie vou toepassings.

1. Die versterking van geenfragmente as 'n vinnige alternatief vir kloning:

(a) Inserts van bakteriële plasmiede kan versterk word met primers.

(b) DNA uit bekende volgorde kan verkry word deur primers te ontwerp.

(c) PCR help met die identifisering van homoloë rye van verwante organismes.

(d) Deur gebruik te maak van RT-PCR kan die 3 ′ einde van cDNA versterk word (RACE: Rapid Amplification of cDNA Ends).

(e) Omgekeerde PCR help om die flankerende rye van 'n bekende DNA -kloon te ken.

2. Wysiging van DNA -fragmente:

Terreingerigte mutagenese met behulp van oligonukleotiede as PCR-primers bied 'n kragtige benadering om struktuur-funksie-verband te bestudeer.

3. Diagnose van patogene mikro-organismes:

DNA van die besmette dele van 'n persoon of dier kan aan PCR onderwerp word, met 'n primer -spesifieke gen van die patogeen en diag & shynosis kan gedoen word op amplifikasie van DNA.

4. DNA -analise van argeologiese monsters:

Aangesien DNS relatief stabiel is en vir 'n lang tydperk ongeskonde bly, kan PCR help met die ontleding van DNS van daardie ingebedde en verskuilde materiale.

5. Opsporing van mutasie wat relevant is vir oorgeërfde siektes:

Enige puntmutasie, 'n verwydering of invoeging en uitgebreide tandem -trinukleotiedherhaling kan deur PCR opgespoor word. Somatiese mutasies in onkogene of tumor -onderdrukkende gene kan ook opgespoor word deur PCR met primers wat die invoegings of deleties flanker.

6. Ontleding van genetiese merkers vir forensiese toepassings, vir vaderskaptoetsing en vir die kartering van oorerflike eienskappe.

(b) RAPD (Random Amplified Polymorphic DNA) met arbitrêre, dikwels kort (10 bp) primers.

7. Spesie-spesifieke amplifikasie van DNA-segmente tussen interspersed repeat elements (IRS) deur gebruik te maak van die primer gebaseer op die SINE volgorde (Short Interspersed Nuclear Elements).

8. Genetiese Ingenieurswese met behulp van PCR:

Deur PCR te gebruik, kan ons verandering of mutasie in die uiteindelike produk inkorporeer deur rye aan die primer aan die einde van 5 ′ te verander, te verwyder of toe te voeg. Deur rekombinante PCR -tegniek is dit moontlik om twee DNA -fragmente op 'n spesifieke plek te verbind deur komplementêre oorvleueling (hierdie tegniek word splicing genoem). Deur twee mutageniese primers te sintetiseer, wat strek oor die interne plek wat verander moet word, is dit moontlik om mutasies binne 'n fragment in te voer.


DNA -voorbereiding

Molekulêre kloning behels die inbring van DNA, as 'n insetsel, in 'n vektormolekule. Die DNA wat gekloneer moet word, kan verkry word deur dit uit 'n bron-DNA te sny deur te verteer met beperkingsensieme, deur dit van 'n bronmolekule te kopieer deur óf die Polymerase Chain Reaction (PCR) óf Reverse Transcription-PCR (RT-PCR), of deur dit saam te stel uit kort DNS-stukke (oligonukleotiede). Hierdie metodes vereis almal dat die DNS-bron voldoende vry is van kontaminante wat moontlik die ensiemaktiwiteite (endonukleases, polimerases) wat betrokke is by die verwerking van die DNS vir kloning kan inhibeer.


Tradisionele kloning deur beperking endonuklease vertering kan enige van 'n aantal verskillende bron-DNA-tipes gebruik. Genomiese DNA kan met 'n beperkingsensiem verteer word en in 'n versoenbare vektorplek gekloneer word om 'n biblioteek van verskillende insetsels te produseer, almal uit dieselfde bron -DNA. DNS wat reeds in een vektor gekloneer is, kan na 'n nuwe ontvangervektor oorgedra (gesubkloneer) word deur die DNS met beperkingsensieme uit te sny en in die ooreenstemmende plekke van die tweede vektor te kloneer. Dit word gereeld onderneem om proteïenuitdrukking of transkripsie van RNA te vergemaklik, byvoorbeeld, wat moontlik nie moontlik is met die oorspronklike vektor nie.

PCR word dikwels gebruik vir die generering van DNA vir kloning en dikwels word beperkingsplekke in die primer-plekke geïnkorporeer sodat die geamplifiseerde DNA verteer en in versoenbare beperkingsplekke van die kloningsvektor gekloneer kan word. Enige tipe DNA wat die gewenste volgorde bevat, kan dien as die sjabloon vir PCR. Kloning met twee afsonderlike beperkingsensieme verseker dat nie-versoenbare ente op elke molekule gegenereer word, waardeur eenvoudige vektorhersirkularisering voorkom word en insetsels gedwing word om rigting gekloneer te word. Dit kan belangrik wees om 'n translasionele oop leesraam vir proteïenuitdrukking te verseker. Verandering van DNA-eindes na beperkingsvertering kan in sekere situasies nuttig wees. Byvoorbeeld, in nie-rigtingkloning, waar 'n enkele beperkingsensiem gebruik word, sal defosforilering van die verteerde vektor-DNA hersirkulasie van die vektor voorkom, en sodoende die proporsie van die verlangde rekombinante DNA-molekules verhoog.

PCR word toenemend gebruik vir die voorbereiding van DNA vir kloningstoepassings. Versterkte DNA kan óf direk gekloon word, óf na die vertering van beperkings met beperkingsplekke wat in die primers gebruik word wat vir PCR gebruik word. Alternatiewelik kan geamplifiseerde DNA gebruik word in Naatlose Kloningstrategieë soos NEBuilder HiFi DNA Assembly of in Ligation Independent Cloning. Die vektormolekules vir hierdie kloningsmetodes kan ook deur PCR geproduseer word. DNA wat met Taq-polimerase geamplifiseer is, het 'n templaat-onafhanklike enkele adenosien (A) wat by die 3&rsquo-punte bygevoeg word wat kloning in komplementêre T-stert-vektore moontlik maak. Hoë-getrouheid proeflees polimerases voeg nie bykomende basisse by wat die kloning van die geamplifiseerde DNA in stomp-einde beperkingsplekke toelaat nie. Afhangende van die gekose kloningstrategie, kan die eindes van geamplifiseerde DNA gewysig word deur A-stert, afstomping of byvoeging of verwydering van 5 & rsquo-fosfaatgroepe. Komplementêre DNA (cDNA) wat gegenereer word deur omgekeerde transkripsie van RNA kan ook deur PCR versterk word. Hierdie vermoë om DNA uit RNA -sjablone te sintetiseer, maak kloning van rye wat ooreenstem met gene transkripsies moontlik.


EKSPERIMENTELE PROSEDURES

Voorlaboratoriumvaardighede—

Vir sukses in hierdie oefening word die volgende tegniese vaardighede vereis: steriele laboratoriumtegniek, akkurate pipetteringsvermoë, kennis van tegnieke vir die behoud van ensiemaktiwiteit, en die gebruik van mikrosentrifuges en semi-logaritmiese papier. Kennis van DNA -replikasie, PCR en agarose -gelelektroforese is nuttig, maar kan in 'n agtergrondlesing voor die laboratoriumoefening aangebied word. Studente werk in groepe van twee of drie ten minste een lid van die groep moet manlik wees en een moet vroulik wees.

Toerusting—

Die laboratoriumoefening vereis 'n mikrosentrifuge, twee verhittingswaterbaddens, gelelektroforese-toerusting (kragbronne, horisontale jelbokse, skinkborde en kamme), en een of meer termofietsryers met voldoende kapasiteit om die aantal studentegroepe te akkommodeer. 'N Ultraviolet ligbron met 'n ultraviolet-beskermende skild is nodig om die DNA-bande te visualiseer. Indien beskikbaar, kan 'n gel -dokumentasie -apparaat of kamera gebruik word om 'n prentjie van die gel te maak. Vir die eksperimente wat hier beskryf word, die Mastercycler Gradient-termosiklus en 5415C mikrosentrifuge (Eppendorf, Hamburg, Duitsland), Mini-Sub Cell GT PowerPac 300 gelelektroforese stelsel (katalogus nr. 165-4347 Bio-Rad, Hercules, CA) en IS- 1000 Digital Imaging System (Alpha Innotech Corp., San Leandro, CA) is gebruik.

Kits, Ensieme en Oplossings—

Die genomiese DNA-isolasiestel (katalogus no. SA-40001) en X&Y-chromosoom-inleidingstel (katalogus no. SP-10704) is van Maxim Biotech gekoop. Die primer kit verskaf die twee primers, PCR buffer met nukleotiede, 100-bp DNA leer, en menslike DNA vir gebruik as 'n positiewe kontrole. Teoreties bevat elke kit genoeg materiaal vir 100 toetse (33 groepe), maar omdat oortollige oplossing aan elke groep verskaf word, kan een kit 20 tot 24 stelle van drie PCR insluit, insluitend die toets van die eksperiment. Die hoeveelheid 100-bp DNA-leer in die stel kan beperkend wees, maar addisionele DNA-leer kan apart van die onderneming gekoop word. Taq polimerase (5 U/ul) is verkry uit Eppendorf. DNA-monster laai buffer kan gekoop word (katalogus nr. 161-0767 Bio-Rad) of volgens standaard protokolle [9] voorberei word. Agarose (SeaKem GTG) is verkry van BioWhittaker Molecular Applications (Rockland, ME). Etidiumbromied ('n mutageen) is as 'n 10 mg/ml oplossing (Bio-Rad) gekoop en die gekonsentreerde oplossing is slegs deur die instrukteur of onderwysassistent hanteer met toepaslike handskoene. Studente is toegelaat om verdunde etidiumbromiedoplossings te hanteer met handskoene met waarskuwings oor die mutagene eienskappe daarvan. Ander DNA -kleurstowwe met na berig word minder skadelike eienskappe is beskikbaar (Gelstar -nukleïensuurvlek FMC, Philadelphia, PA).

Laboratoriumbenodigdhede en opset—

Vir elke groep is die volgende benodigdhede nodig: handskoene vir die hantering van oplossings met ethidiumbromied, pipette en steriele pipetpunte vir volumes van 2 tot 1000 ul, vier steriele 1,5 ml mikrosentrifugebuise vir die isolasie van DNA, twee steriele 1-ml pipetpunte ( of twee steriele deppers) vir die versameling van wangselmonsters, drie 0,5 ml PCR-buise en drie steriele 0,5 ml mikrosentrifugeerbuise vir die voorbereiding van elektroforesemonsters.

Omdat studente dikwels beperkte ondervinding het in die pipettering en hantering van aktiewe ensieme, kan dit voordelig wees om individuele groepe van die verskillende oplossings wat in die prosedure gebruik word, te voorsien. In ons laboratoriums was dit ook voordelig om óf die onderwysassistent óf die instrukteur die ensieme by te voeg. Sonder hierdie voorsorgmaatreëls het pipetteringsfoute deur studente soms gelei tot aansienlike verliese van duur ensieme uit die voorraadhouers. Alternatiewelik kan Taq -polimerase onmiddellik voor die laboratoriumperiode met die geoptimaliseerde PCR -buffer gemeng word en voorsien word as 'n PCR -buffer/polimerase -mengsel (0,2 ul Taq -polimerase per 30 ul PCR -buffer).

Gee vir elke groep studente 'n ysemmer met afsonderlike hoeveelhede gemerkte komponente (1,2-2 keer die volume wat in die protokol gespesifiseer word). Die oplossings en volumes hieronder is van toepassing op die Maxim Biotech genomiese DNA -suiweringsstel. Ander kits kan ook gebruik word. Vir DNA-isolasie (dag 1), aliquot sellise-oplossing (1,5 ml BD-3-oplossing), ribonuklease A (25 μl op ys), proteïenpresipiterende oplossing (0,5 ml BD-4-oplossing op ys), en 100% etanol (1,5 ml by kamertemperatuur).

Gee vir dag 2 yskoue 70% etanol (2,5–3 ml), steriele gedistilleerde, gedeïoniseerde water (0,5 ml), primers uit die X&Y primer kit (40 μl), 10-voudig verdunde menslike genomiese DNA (15 μl) ) en PCR -buffer/polimerase -mengsel (120 ul). Vir agarosegelelektroforese (dag 3), verskaf 5 × nukleïensuurmonsterbuffer (15 μl) en Tris-asetaat-EDTA (TAE)12 2 Die afkorting wat gebruik word is: TAE, Tris-asetaat-EDTA. elektroforesebuffer (300 ml 40 m M Tris-asetaat, 1 m M EDTA). Voormeng ook 20 μl monsterbuffer met 100 μl 100-bp DNA-leer, en deel 6 μl in elke groep. Om die blootstelling van studente aan gekonsentreerde etidiumbromiedoplossings te verminder, kan die onderrigassistent die agarose (1% in TAE-buffer) onmiddellik voor die laboratoriumperiode smelt, 50 ml-hoeveelhede in hittebestande weggooibare buise van 50 ml plaas, etidiumbromied byvoeg, en bêre die buise in 'n 65 °C-waterbad tot gebruik.

Veiligheids kommer -

Etidiumbromied en ander DNA -kleurstowwe is mutageen. Dra handskoene en vermy kontak met hierdie stowwe. Raak ontslae van pipetpunte wat in aanraking kom met gekonsentreerde etidiumbromied. Autoklaaf alle biologiese monsters aan die einde van die oefening en gooi dit weg volgens die omgewingsgesondheids- en veiligheidsbeleid van die individuele kampus.

Eksperimentele prosedures—

Die vervaardiger se instruksies vir die genomiese DNA-isolasiestel is aan die studente verskaf, en die prosedure word hieronder opgesom. Berei afsonderlike manlike en vroulike DNA -monsters voor. Skraap die binnekant van albei wange liggies 10 keer met 'n steriele 1-ml pipetpunt of 'n steriele depper. Soliede materiaal en speeksel moet in die pipetpunt sigbaar wees. Meng die monster deeglik met 0,6 ml koue BD-3-oplossing (lisis-oplossing) in 'n steriele 1,5-ml mikrosentrifugeerbuis. Die lisis-oplossing bevat skoonmaakmiddel en 'n sterk basis om die selmembraan te ontwrig en die sellulêre inhoud vry te stel. Homogeniseer die monster deur te meng en inkubeer dan by 65 ° C vir 30 minute. Koel die oplossing tot kamertemperatuur en voeg 10 ul RNase A -oplossing by om die RNA -molekules wat in die monster voorkom, te verteer. Inkubeer by 37 ° C vir 20 minute en plaas dan die buis vir 5 minute op ys. Voeg 0,2 ml BD-4-oplossing by, wat 'n sout bevat wat veroorsaak dat die proteïene deur 'n uitsout-effek neerslaan. Meng goed deur die buis verskeie kere om te draai, en sentrifugeer vir 10 min in 'n mikrosentrifuge teen maksimum spoed om die gepresipiteerde proteïene te verwyder. Versamel die supernatant wat DNA bevat en plaas dit in 'n vars mikrocentrifugebuis van 1,5 ml. Voeg 0,6 ml 100% etanol by kamertemperatuur by en keer die buis 40-50 keer om om die DNA te presipiteer. Bêre die sentrifugebuise by 4 ° C tot die volgende laboratoriumperiode.

Voltooiing van DNA -isolasie en voorbereiding van die PCR -mengsels—

Om die DNA -isolasie te voltooi, sentrifugeer die buise teen maksimum spoed vir 10 minute en gooi die supernatant weg. Die DNA moet presipiteer, maar sal in die meeste gevalle nie sigbaar wees nie. Pipetteer liggies 1 ml yskoue 70% etanol in die buis om die DNA te was. Moenie die inhoud van die buis meng nie. Sentrifugeer vir 5 minute, gooi die supernatant weg en laat die korrel aan die lug droog word. Voeg 0,2 ml steriele gedistilleerde gedeïoniseerde water by. Verhit die buis by 65 °C vir 20 minute, draai die buis verskeie kere om tydens die inkubasie om die DNA op te los. Indien nodig, kan die DNA -monster by -20 ° C gestoor word, maar moet nie herhaaldelik gevries en ontdooi word nie.

Agarose Gel Elektroforese—

Gee instruksies en materiaal om studente in staat te stel om horisontale 1% agarosegel (7 × 10 cm) in TAE -buffer voor te berei. Plaas die gels in die gel bokse met TAE buffer. Benoem drie steriele mikrosentrifugeerbuise as vroulik, manlik of kontrole-DNS. Voeg 3 ul 5 × monsterbuffer by elke buis. Gebruik 'n vars punt vir elke buis, voeg 15 μl van elke PCR by die toepaslik gemerkte mikrosentrifugebuis. Meng kortliks. Laai 15 ul van elke mengsel in 'n aparte baan op die gel. Voeg in die vierde baan 5 ul DNA -leer (molekulêre grootte standaard) by wat vooraf met DNA -monster laaibuffer gemeng is. Maak die deksel op die gelkassie vas en laat die gel hardloop totdat die donkerblou kleurstof die helfte tot twee derdes van die lengte van die gel bereik (gewoonlik 45 minute by 100 V). Skakel die kragtoevoer af, verwyder die jel en teken die bandpatroon wat met ultravioletlig waargeneem is, aan.


ONTWERP PCR PRIMERS

AGTERGROND INLIGTING: Vir webwerwe wat PCR-teorie beskryf, sowel as maatskappye wat PCR-produkte bemark, wil jy dalk begin deur Highveld te besoek. Vir PCR-tegnieke sien PCRlink.com.

Daar is verskeie uitstekende webwerwe vir die ontwerp van PCR-primers:

Primer3: WWW primer instrument (University of Massachusetts Medical School, U.S.A.) & ndash Hierdie webwerf het 'n baie kragtige PCR-primer-ontwerpprogram wat 'n aansienlike beheer oor die aard van die primers moontlik maak, insluitend die grootte van die gewenste produk, primer-grootte en Tm-reeks, en die teenwoordigheid/afwesigheid van 'n 3 & rsquo-GC-klem.
GeneFisher - Interaktiewe PCR Primer Ontwerp (Universitat Bielefeld, Duitsland) - 'n baie goeie webwerf wat groot beheer oor primer -ontwerp moontlik maak.

Primer3Plus - 'n nuwe verbeterde webkoppelvlak na die gewilde Primer3 primer ontwerpprogram (Verwysing: A. Untergasser et al. 2007. Nucl. Acids Res. 35(Webbedienerprobleem): W71-W74)
BiSearch Primer Design and Search Tool-dit is 'n nuttige hulpmiddel vir primer-ontwerp vir enige DNA-sjabloon en veral vir bisulfietbehandelde genome. Die ePCR-instrument bied vinnige opsporing van mispriming-terreine en alternatiewe PCR-produkte in cDNA-biblioteke en inheemse of bisulfiet-behandelde genome. (Verwysing: Ar & aacutenyi T et al. 2006. BMC Bioinformatics 7: 431).

Primer-BLAST is ontwikkel by NCBI om gebruikers te help om primers te maak wat spesifiek is vir die invoer PCR-sjabloon. Dit gebruik Primer3 om PCR-primers te ontwerp en stuur dit dan na BLAST-soektog teen die gebruiker-gekose databasis. Die ontploffingsresultate word dan outomaties ontleed om primerpare te vermy wat versterking van ander teikens as die insetsjabloon kan veroorsaak.

Met MFEprimer kan gebruikers die primer -spesifisiteit vinnig en maklik kontroleer met genomiese DNA en boodskapper -RNA/komplementêre DNA -volgorde databasisse. Hierdie bediener gebruik 'n k-mer-indeksalgoritme om die soekproses na primerbindingsplekke te versnel en gebruik termodinamika om die bindingsstabiliteit tussen elke primer en die DNA-sjabloon daarvan te evalueer. Verskeie belangrike eienskappe, soos die volgorde, smelttemperatuur en grootte van elke amplikon, hetsy spesifiek of nie-spesifiek, word gerapporteer. (Verwysing: Qu W et al. 2012. Nucl. Acids Res. 40 (Webbedienerprobleem): W205-W208)

Primer Ontwerp en Soek Gereedskap

PrimerDesign-M-bevat verskeie opsies vir meervoudige onderlaagontwerp, waardeur navorsers in staat is om doeltreffende loop-primers te ontwerp wat lang DNA-teikens dek, soos hele HIV-1 genome, en wat primers gelyktydig op die hoogte bring van genetiese diversiteit in verskeie belynings en eksperimentele ontwerpbeperkings optimaliseer deur die gebruiker gegee. PrimerDesign-M kan ook primers ontwerp wat DNA-strepieskodes insluit en primer dimerization minimaliseer. PrimerDesign-M vind optimale primers vir hoogs veranderlike DNA-teikens en vergemaklik ontwerp buigsaamheid deur alternatiewe ontwerpe voor te stel om aan te pas by eksperimentele toestande. (Verwysing: Yoon H & amp; Leitner T. 2015. Bioinformatika 31:1472-1474).

RF-kloning (beperking-vrye kloning)-is 'n PCR-gebaseerde tegnologie wat uitbrei op die QuikChange & trade-mutagenese-proses wat oorspronklik in die middel van die negentigerjare deur Stratagene gewild gemaak is, en dit moontlik maak om in wese enige volgorde in enige plasmied op enige plek in te voeg. (Verwysing: Bond SR & Naus BK. 2012. Nucl. Acids Res 40(Webbedienerprobleem): W209-W213)

primers4clades - is 'n pyplyn vir die ontwerp van PCR-inleiders vir kruis-spesie amplifikasie van nuwe volgordes vanaf metagenomiese DNA of van ongekarakteriseerde organismes wat aan gebruiker-gespesifiseerde filogenetiese afstammelinge behoort. Dit implementeer 'n uitgebreide CODEHOP -strategie wat gebaseer is op beide DNA en proteïen meervoudige belyning van koderende gene en evalueer termodinamiese eienskappe van die oligonukleotiedpare, sowel as die filogenetiese inligtingsinhoud van voorspelde amplikone, bereken uit die takondersteuningswaardes van maksimum waarskynlikheidsfilogenieë. Bome wat op die skerm vertoon word, maak dit maklik om primers op interaktief geselekteerde klades te rig. (Verwysing: Contreras-Moreira B et al. 2009. Nucleic Acids Res. 37(Webbediener-kwessie):W95-W100).

TaxMan: Inspekteer u rRNA -amplikone en taxa -opdragte - In mikrobioomontledings word dikwels rRNA -gendatabasisse gebruik om taksonomiese name aan volglesings toe te ken. Die TaxMan-bediener vergemaklik die ontleding van die taksonomiese verspreiding van jou leeswerk op twee maniere. Eerstens kan u kyk watter taksonomiese name toegeken word aan die rye wat u primers produseer en watter takse u sal verloor. Tweedens kan die geproduseerde amplikonreekse met afstammelinge in die FASTA-kopskrif afgelaai word. Dit kan 'n baie meer doeltreffende analise met betrekking tot werktyd en geheueverbruik tot gevolg hê, aangesien die amplicon -rye aansienlik korter is as die rRNA -geenvolgorde van volle lengte. Boonop kan u 'n afstammingslêer aflaai wat die tellings van alle taxas vir u primers en die gebruikte verwysing bevat. (Verwysing: Brandt, B.W. et al. 2012. Nucleic Acids Research 40:W82-W87).

Oligonukleotied fisies-chemiese parameters:

NetPrimer (Premier Biosoft International, VSA) - Myns insiens die beste webwerf, aangesien dit een met Tm, termodinamiese eienskappe en stabielste haarspeld en amp -dimers bied, maar dit neem 'n rukkie voordat die program gelaai word.

dnaMATE - bereken 'n konsensus Tm vir kort DNS-volgorde (16-30 nts) deur 'n saamgevoegde metode te gebruik wat op drie verskillende termodinamiese tabelle gebaseer is. Die konsensus Tm-waarde is 'n robuuste en akkurate skatting van smelttemperatuur vir kort DNS-reekse van praktiese toepassing in molekulêre biologie. Akkuraatheid maatstawwe wat alle eksperimentele data beskikbaar gebruik, dui aan dat die konsensus Tm voorspellingsfoute binne 5 ºC vanaf die eksperimentele waarde sal wees in 89% van die gevalle. (Verwysing: A. Panjkovich et al. 2005. Nucl. Acids Res. 33: W570-W572.).

OligoCalc - 'n aanlyn sakrekenaar vir oligonukleotied eienskappe - (Verwysing: W.A. Kibbe. 2007. Nucl. Acids Res. 35 (Webbediener -uitgawe): W43 -W46)
OligoAnalyzer 3.1 (Integrated DNA Technologies, Inc)
Mongo Oligo Massa Sakrekenaar v2.06
Oligo -evalueerder (Sigma -Aldrich)
Oligo-berekeningsinstrument (Genescript, V.S.A.) - laat wysiging toe

PCR -primers gebaseer op proteïenvolgorde:

As u die proteïenvolgorde het en die DNA -volgorde wil hê, is proteïen -tot -DNA -reverse -vertaling of Reverse Translation -deel van die Sequence Manipulation Suite die beste plekke. As u belangstel om 'n spesifieke aminosuur in 'n ander te verander, moet u Primaclade raadpleeg (Verwysing: Gadberry MD et al. 2005. Bioinformatics 21:1263-1264).

PCR en kloning:

AMUSER (Ageoutomatiseerde DNA Modifikasies met GEBRUIKER kloning) bied 'n vinnige en maklike ontwerp van PCR -primers wat geoptimaliseer is vir verskillende USER -kloninggebaseerde DNA -ingenieurswese. USER kloning is 'n vinnige en veelsydige metode vir die ontwerp van plasmied DNA. Hierdie webbedienerhulpmiddel outomatiseer die ontwerp van optimale PCR-primers vir verskillende verskillende kloninggebaseerde USER-toepassings. Dit vergemaklik die samestelling van DNA en die bekendstelling van feitlik enige tipe terreingerigte mutagenese deur optimale PCR-primers te ontwerp vir die gewenste genetiese veranderinge. (Verwysing: Genee HJ et al. 2015. ACS Synth Biol. 4:342-349).

Genomiese skaal primers: (N.B. sien ook die JAVA -bladsy vir addisionele aflaaiprogramme)

Die PCR Suite (Klinische Genetica, Erasmus MC Rotterdam, Nederland) - dit is 'n reeks van vier programme gebaseer op Primer3 vir genomiese primer ontwerp. Almal bied aansienlike beheer oor primer -eienskappe:

Overlapping_Primers - skep verskeie oorvleuelende PCR -produkte in een volgorde.
Genomic_Primers - ontwerp primers rondom eksone in genomiese volgorde. Al wat u nodig het, is 'n GenBank -lêer wat u geen bevat.
SNP_Primers - ontwerp primers rondom elke SNP in 'n GenBank -lêer.
cDNA_Primers - ontwerp primers rondom oop leesrame. Laai eenvoudig 'n GenBank -lêer op wat u gene bevat.

Oorvleuelende onderlaagstelle:

Twee werwe bied sagteware is gebaseer op die Primer3-program vir die ontwerp van oorvleuelende PCR-primer-paarstelle - Veelvuldige Primer-ontwerp met Primer 3 en oorvleuelende Primersets

PHUSER (Primer H.elp vir GEBRUIKER ) - Uracil-Specific Exision Reagent (USER) samesmelting is 'n onlangs ontwikkelde tegniek wat die samestelling van veelvuldige DNA-fragmente in 'n paar eenvoudige stappe moontlik maak. PHUSER bied 'n vinnige en maklike ontwerp van PCR -geoptimaliseerde primers wat verseker dat rigtings korrek saamsmelt fragmente in 'n plasmied wat 'n aanpasbare USER -kasset bevat. Die primers het soortgelyke uitgloeitemperatuur (Tm). PHUSER vermy ook identiese oorhange, waardeur die korrekte samestelling van DNA -fragmente verseker word. Alle moontlike primers word individueel geanaliseer in terme van GC-inhoud, die teenwoordigheid van GC-klem aan 3 '-end, die risiko van primer dimeervorming, die risiko van intra-primer sekondêre strukture en die teenwoordigheid van polyN strek. (Verwysing: Olsen LR et al. 2011. Nucl. Acids Res. 39 (Webbediener-kwessie): W61-W70)

Primerize is 'n webbediener vir primerontwerpe van DNA -volgorde PCR -samestelling. Primerize is geoptimaliseer om primer-grense mispriming te verminder, is ontwerp vir vaste volgordes van RNA-probleme, en het wye en streng toetse geslaag. Hierdie doeltreffende algoritme is geskik vir uitgebreide gebruik soos massiewe parallelle mutagenese-biblioteek. (Verwysing: Tian, ​​S., & Das, R. (2016) Kwartaallikse oorsig van biofisika 49(e7): 1-30).

Kort interfererende RNA (siRNA) ontwerp:

Klein interfererende RNA (siRNA) lei volgorde-spesifieke degradasie van die homoloë mRNA, en produseer dus "knock-down" selle. siRNA-ontwerpinstrument skandeer 'n teikengeen vir kandidaat-siRNA-volgordes wat aan die gebruiker-verstelbare reëls voldoen. Daar bestaan ​​'n verskeidenheid bedieners:

siRNA -ontwerpprogrammatuur - vergelyk bestaande ontwerpgereedskap, insluitend die hierbo gelys. Hulle probeer ook om die MPI -beginsels en bestaande instrumente te verbeter deur 'n algoritme wat ondoeltreffende siRNA's kan filter. Die algoritme is gebaseer op 'n paar nuwe waarnemings oor die sekondêre struktuur. (Verwysing: S.M. Yiu et al. (2004) Bioinformatika 21: 144-151).

OligoWalk is 'n aanlyn bediener wat termodinamiese kenmerke van sin-antisense hibidisering bereken. Dit voorspel die veranderinge in vrye energie van oligonukleotiede wat aan 'n teiken -RNA bind. Dit kan gebruik word om doeltreffende siRNA te ontwerp wat gerig is op 'n gegewe mRNA -volgorde. (Verwysing: Lu ZJ & Mathews DH. 2008. Nucl. Acids Res. 36: 640-647).

VIRsiRNApred - 'n menslike virale siRNA doeltreffendheid voorspelling bediener (Verwysing: Qureshi A et al. 2013. J Transl Med. 11:305).

Dicer-substraat siRNA's (DsiRNA's) is chemies gesintetiseerde 27-meer dupleks RNA's wat 'n verhoogde sterkte in RNA-interferensie het in vergelyking met tradisionele siRNA's.RNAi DESIGN (IDT Integrated DNA Technologies)

pssRNAit-Ontwerp effektiewe en spesifieke plant-RNAi siRNA's met genoomwye nie-teiken-gene-assessering.

DSIR is 'n hulpmiddel vir siRNA (19 of 21 nt) en shRNA teikenontwerp. (Verwysing: Vert JP et al. 2006. BMC Bioinformatics 7:520).

Imgenex siRNA retriever-program is ontwerp om siRNA-koderende DNA-oligonukleotiede te kies wat in een van die pSuppressor-vektore gekloneer kan word. Die insetvolgorde kan direk verkry word vanaf 'n Genbank -toetreding of reeks wat deur die navorser verskaf word.

siDRM is 'n implementering van die DRM -reëls vir die keuse van effektiewe siRNA's. Die skrywers het 'n opgedateerde ontleding uitgevoer met behulp van die benadering van disjunctive rule fusion (DRM) op 'n groot en uiteenlopende dataset wat uit siRecords saamgestel is, en die gevolglike reëlstelle geïmplementeer in siDRM, 'n nuwe aanlyn siRNA -ontwerphulpmiddel. siDRM implementeer ook 'n paar hoëgevoeligheidsreëlstelle en vinnige reëlstelle, skakels na siRecords en gebruik verskeie filters om ongewenste nadelige gevolge te kontroleer, insluitend aangebore immuunreaksies, seltoksiese effekte en aktiwiteite buite die teiken in die seleksie van siRNA's. (Verwysing: Gong W et al. 2008. Bioinformatika 24:2405-2406).

siMAX siRNA Ontwerphulpmiddel (Eurofins Genomic, Duitsland) - is 'n eie sagteware wat ontwikkel is om u te help om die mees geskikte siRNA te kies wat u gen (e) van belang is.

shRNA Ontwerper (Biosettia Inc., VSA) - Gebruik hierdie program om shRNA-oligo's te ontwerp wat versoenbaar is met ons SORT-A/B/C-vektore. Die ontwerpinstrument verskaf teikens met die grootste kans om jou geen af ​​te slaan. Let asseblief daarop dat slegs een oligo ontwerp is aangesien dit palindromies is.

syDESIGN Sentrum (Horizon Discovery Ltd., VK) - is 'n gevorderde, gebruikersvriendelike siRNA-ontwerpinstrument, wat die waarskynlikheid om funksionele siRNA te identifiseer aansienlik verbeter. Een-of-a-soort opsies is beskikbaar om teikenspesifisiteit te verbeter en siRNA-ontwerpe aan te pas vir meer gesofistikeerde eksperimentele ontwerp.

Intydse PCR -onderlaagontwerp:

RealTimeDesign (Biosoektegnologieë) - gratis, maar vereis registrasie.

GenScript Real -time PCR (TaqMan) Primer Design - u kan die potensiële grootte van die PCR -amplicon, Tm (smelttemperatuur) vir die primers en probes sowel as die organisme aanpas. Jy kan ook besluit hoeveel Primer/Probe-stelle jy wil hê die instrument moet aan jou terugbesorg. Dit is moontlik om 'n GenBank -toetredingsnommer as sjabloon te gebruik.

QuantPrime - is 'n buigsame program vir betroubare onderlaagontwerp vir gebruik in groter qPCR -eksperimente. Die buigsame raamwerk is ook oop vir eenvoudige gebruik in ander kwantifiseringstoepassings, soos hidrolisasie-probe-ontwerp vir qPCR en oligonukleotied-probe-ontwerp vir kwantitatiewe in situ verbastering. (Verwysing: S. Arvidsson et al. 2008. BMC Bioinformatics 9:465)

PrimerQuest - (IDT, VSA)

Bekendstelling van mutasies:

WatCut (Michael Palmer, Universiteit van Waterloo, Kanada) - neem 'n oligonukleotied en stel stille mutasies in potensiële beperkingsplekke in, sodat die aminosuurvolgorde van die proteïen onveranderd is.

PrimerX - kan gebruik word om die ontwerp van mutagene primers vir outomatiese mutagenese te outomatiseer. Dit is beskikbaar in twee geure (a) Primer-ontwerp gebaseer op DNA-volgorde en (b) Primer-ontwerp gebaseer op proteïenvolgorde

Primerize-2D - is designed to accelerate synthesis of large libraries of desired mutants through design and efficient organization of primers. The underlying program and graphical interface have been experimentally tested in our laboratory for RNA domains with lengths up to 300 nucleotides and libraries encompassing up to 960 variants. ( Reference: Tian, S., & Das, R. (2017) Bioinformatics 33(9): 1405-1406).

When you are ready to set-up your PCR reaction see:

PCR Box Titration Calculator (Allotron Biosensor Corporation) - for figuring out the amounts of each reagent to use in a two-dimensional box titration for PCR. For standard PCR reactions adjust volume, and change "row" and "column" number to "1", click on all the "top" or "bottom" and "done". PCR Titration Calculator (Angel Herráez Cybertory: virtual molecular biology lab Universidad de Alcalá, Spain) is a similar site.

PCR Reaction Mixture Setup (R. Kalendar, University of Helsinki, Finland) - very nice site (requires Java).

PCR Optimization (Bioline, United Kingdom) - a lot of conditions

Primer presentation on the DNA sequence:

Sequence Extractor (Paul Stothard) - generates a clickable restriction map and PCR primer map of a DNA sequence (accepted formats are: raw, GenBank, EMBL, and FASTA) offering a great deal of control on output. Protein translations and intron/exon boundaries are also shown. Use Sequence Extractor to build DNA constructs in silico.


Loop-Mediated Isothermal Amplification

Loop-mediated isothermal amplification (LAMP) uses 4-6 primers recognizing 6-8 distinct regions of target DNA for a highly specific amplification reaction. A strand-displacing DNA polymerase initiates synthesis and 2 specially designed primers form &ldquoloop&rdquo structures to facilitate subsequent rounds of amplification through extension on the loops and additional annealing of primers. DNA products are very long (>20 kb) and formed from numerous repeats of the short (80&ndash250 bp) target sequence, connected with single-stranded loop regions in long concatamers. These products are not typically appropriate for downstream manipulation, but target amplification is so extensive that numerous modes of detection are possible. Real-time fluorescence detection using intercalators or probes, lateral flow and agarose gel detection are all directly compatible with LAMP reactions. Instrumentation for LAMP typically requires consistent heating to the desired reaction temperature and, where needed, real-time fluorescence for quantitative measurements. Optimized settings for running LAMP experiments on isothermal instruments can be found here.

Reaction Temperature Amplicon Size Detection Method(s)
65°C <250 nt Visual, Lateral flow, Gel, Turbidity

Loop-mediated isothermal amplification (LAMP) uses 4-6 primers recognizing 6-8 distinct regions of target DNA. A strand-displacing DNA polymerase initiates synthesis and 2 of the primers form loop structures to facilitate subsequent rounds of amplification.

In addition to the more traditional or complex detection methods, LAMP is so prolific that the products and byproducts of these reactions can also be visualized by eye. For example, magnesium pyrophosphate produced during the reaction can be observed as a white precipitate or added indicators like calcein or hydroxynaphthol blue can be used to signal a positive reaction. Alternatively, using the 2X Colorimetric LAMP Master Mix developed by NEB enables a strong color change from pink to yellow based on a pH change during the reaction. An updated version of this product has been formulated with dUTP and UDG to be compatible with carryover prevention between amplification rounds &ndash WarmStart Colorimetric LAMP 2X Master Mix with UDG. The colorimetric detection technology is a key component of the SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit, which can be used in the analysis of SARS-CoV-2, the novel coronavirus that causes COVID-19.

Designing LAMP primers can be challenging, but software tools greatly facilitate this process. We suggest using the NEB LAMP Primer Design Tool to design LAMP primers. After inputting a DNA or RNA sequence of interest, the LAMP Primer Design tool will identify suitable target regions and create the outer F3/B3 and looping inner FIP/BIP primers in a single step. The LoopF/LoopB primers, that accelerate the LAMP reaction, are created in a second step and are strongly recommended for best performance.

LAMP is well-suited for point-of-care and field diagnostics and LAMP assays have been designed for the detection of a wide range of RNA and DNA targets from all manner of sample types. Examples include tests for:

The LAMP reaction is robust and tolerant of inhibitors, allowing for crude sample prep and minimal nucleic acid purification if desired. WarmStart ® RTx and Bst 2.0 WarmStart were developed for optimal performance in LAMP/RT-LAMP and are combined in convenient LAMP Master Mixes to simplify assay design.


Kyk die video: CCI Primers In Stock (Augustus 2022).