Inligting

Blastn: Watter substitusiematriks word gebruik?

Blastn: Watter substitusiematriks word gebruik?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ek werk tans aan die opstel van rye, en ek moet die ooreenkoms bereken tussen pare DNA -'woorde' van 'n spesifieke lengte.

Vir aminosure kan ek die substitusiematrikse in Biopython (Bio.SubsMat.MatrixInfo) gebruik.

Ek het egter niks soortgelyk aan DNA gevind nie, en ek het gelees dat die meeste stelsels 'n stelsel vir ooreenstemmings/mismatchings gebruik, waar elke nukleotiedpassing en mismatching aangeteken word, en dan word die tellings opgesom. Dit werk goed solank ek net met A, G, C en T te doen het, maar ek loop probleme ondervind as ek 'n reeks met N of M en dies meer kry (wat onbekende nukleotied beteken).

Is daar 'n standaard manier om die situasie met onbekendes te hanteer? Dit wil sê, hoe kry ek A teenoor N of M teenoor N?

Dankie by voorbaat.


BLASTN gebruik nie 'n substitusiematriks nie. Daar is tellings vir wedstryd, wanpassing en gapings wat jy ook kan definieer.

Daar is tans geen funksie beskikbaar om wedstryde teen onbekendes aan te teken nie. Hulle word as wanverhoudings beskou (soos hieronder getoon). As hierdie onbekende in die middel van 'n HSP is, kan u waarskynlik die HSP volgens u skema weer met 'n python-script her score. As dieN.rek ontwrig die HSP, dan kan u probeer om die boetes wat nie ooreenstem nie, te verslap en die woordgrootte te verminder (verminder basies streng). Ek kan nie aan 'n ander oplossing dink nie.

Navraag 1 CAGCGTCCANNTCCCGAGGTGCCGGGATTGCAGACGGAGTCTGGTTCACTCAGTGCTCAA 60 ||||||||| ||||||||||||||||||||| Sbjct 8 CAGCGTCCACCTCCCGAGGTGCCGGGATTGCAGACGGAGTCTGGTTCACTCAGTGCTCAA 67 Navraag 61 TGGTGCCCAGGCTGGAGTGCAGTGGCGTGATCTCGGCTCGCTACANNCTCCACCTCCCCCAG 120 |||||||||||||||||||||||||||||| ||| ||||||||||| Sbjct 68 TGGTGCCCAGGCTGGAGTGCAGTGGCGTGATCTCGGCTCGCTACAACCTCCCACCTCCCAG 127 Navraag 121 CCGCCTGCCCTGGCCTCCCAAAGTGCCGAGATTGCAGCCTCTGCCCAGCCGCCACCCCCC 178 |||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 128 CCGCCTGCCCTGGCCTCCCAAAGTGCCGAGATTGCAGCCTCTGCCCAGCCGCCACCCC 18


Kyk die video: Making Custom Database and Sequence Alignment using NCBI BLAST+ (Augustus 2022).