Inligting

Hoe word RNA van retrovirus in cDNA omgeskakel?

Hoe word RNA van retrovirus in cDNA omgeskakel?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Die retrovirus (onkovirus) bevat RNA. Dit het ook 'n molekule genaamd omgekeerde transkriptase. Hierdie molekule transkribeer RNA in cDNA. Hierdie cDNA is die DNA-kopie van virale RNA-genoom

RNA het uracil in plaas van timien en DNA het timien in plaas van uracil. So, hoe kan RNA in DNA omgeskakel word? Waarheen gaan Uracil en waar kom timien vandaan?


RNA het uracil in plaas van timien en DNA het timien in plaas van uracil. So, hoe kan RNA in DNA omgeskakel word?

Ek dink jy sal dalk 'n meer basiese vraag wil vra. DNA en RNA is uiters soortgelyk, met slegs 'n suurstof wat die verskil is. Dit het groot gevolge vir organismes, en die lewe soos ons dit ken, gebruik DNA en RNA vir baie afsonderlike doeleindes. DNA stoor die genoom en verskaf die instruksies vir die lewe, en RNA in 'n neutedop is hoe daardie boodskap in proteïen omgeskakel word vir 'n nuttige aksie. RNS is oor die algemeen minder stabiel as DNA, so hierdie rangskikking werk goed uit.

DNS word gereeld en voortdurend na RNA getranskribeer, so Thymine word gereeld gebruik ten gunste van Urasil. Daar is 'n fantasties antwoord hier op Biology.SE reeds besig met hoekom so ek stel voor om dit te lees. Die hoe is redelik eenvoudig, daar word verskillende molekules gebruik! DNA-polimerases inkorporeer Timien terwyl RNA-polimerases Uracil inkorporeer. Die omgekeerde transkripsie wat deur die retrovirus gekodeer word, doen presies dit: dit transkribeer RNA na DNA, met timien in plaas van uracil. Beide uracil en timien is teenwoordig in die sel en is dus beskikbaar vir gebruik.


Ek dink dit kan nuttig wees om jou die verskil tussen uracil en timien te wys

Hulle is baie soortgelyke strukture. Die deel wat by basisparing betrokke is, is eintlik die stikstof en die suurstof wat die verste van die suiker af is. Sien onder:

Om dus 'n ekstra metielgroep aan die ander kant van die molekule te hê, onderbreek nie basisparing nie. En onthou, met DNA/RNA-sintese het jy 'n sjabloon, en die nuwe string is gebaseer op die sjabloon. Dus, wanneer die RT-ensiem Medhat noem 'n adenien in die sjabloon-RNA teëkom, sal dit dit met 'n timidien koppel. En wanneer dit 'n uracil teëkom, is dit in staat om dit met 'n adenien te koppel. Die ensiem is spesifiek gestruktureer om slegs timien in te laat en nie uracil nie, wat is hoe dit die onderskeid maak.


CDNA sintese

Wat ook al jou vereistes is, daar is 'n Bio-Rad cDNA-sintesestel wat aan jou behoeftes voldoen.

Reliance Select cDNA Sintese
Kit

Kies die Reliance Select cDNA Synthesis Kit om GC-ryke teikens en sekondêre struktuur in FFPE en moeilike monsters met gedegradeerde RNA of inhibeerders vas te vang.

Omgekeerde transkripsie Supermix
vir RT-qPCR

Kies iScript omgekeerde transkripsie supermix vir vinnige, doeltreffende en sensitiewe cDNA-sintese vir RT-qPCR &ndash 'n enkele buis en 'n 40-minute protokol.

Gevorderde cDNA-sintesestel
vir RT-qPCR

Kies die iScript Advanced cDNA Synthesis Kit wat 'n uitgebreide dinamiese reeks het met 'n kapasiteit vir tot 7.5 &mikro-invoer-RNA.


Hoe word RNA van retrovirus in cDNA omgeskakel? - Biologie

Hierdie ensiem-omgekeerde transkriptase stel ons in staat om 'n RNA-sjabloon te gebruik om 'n dubbelstring-cDNA-kopie te produseer. Omgekeerde transkripsie is deur H. Temin en D. Baltimore ontdek terwyl hulle retrovirusse bestudeer het. Retrovirusse bevat 'n RNA-genoom wat omgeskakel word na 'n DNA-kopie en geïntegreer word in die gasheergenoom tydens sy replikatiewe siklus. Dit is 'n interessante stel virusse, insluitend baie tumorvirusse en die VIGS-virus MIV.

Omgekeerde transkriptase is 'n RNA-afhanklike DNA-polimerase. Dit gebruik RNA as 'n templaat, benodig dNTP's en 'n primer (vry 3' OH) om DNA-polimerisasie te inisieer.

Twee tipes onderlaag word algemeen gebruik.

Oligo-dT begin priming vanaf die 3'-kant van die mRNA's.
cDNA's wat met oligo-dT geprimeer is, word verryk vir mRNA 3'-punte.

Ewekansige oligonukleotiede kan enige plek langs die mRNA-volgorde hibridiseer en prima cDNA-sintese. Willekeurig geprimeerde cDNS's word langs die lengte van die templaat versprei en is dus meer verteenwoordigend van die mRNA-populasie.

mRNA's is tipies kort (in vergelyking met die genoom) - die meeste mRNA's is minder as 6 kb lank en slegs skaars mRNA is langer as 10 kb.
Hierdie klein grootte beteken dat beide plasmied- en faag-invoegingsvektore geskik is vir die konstruksie van cDNA-biblioteke
(in teenstelling met genomiese biblioteke waar faagvervangingsvektore verkies word).

In ons bespreking van genomiese biblioteke het ons gefokus op volledige dekking van genoom.
Ewekansige genomiese fragmente is gegenereer deur gedeeltelike vertering met 'n gereelde snyensiem.
Die gevolglike ewekansige haelgeweerbiblioteek bevat veelvuldige oorvleuelende klone wat die volledige genoomvolgorde dek.

cDNA-biblioteke is 'n bietjie anders.
Hier verteenwoordig elke bakteriële transformant of verpakte faag 'n unieke mRNA-molekule.
Rekombinante wat dieselfde DNA-volgorde bevat verteenwoordig verskillende sjabloonmolekules wat in die oorspronklike mRNA-populasie teenwoordig is.

Daar is byvoorbeeld 100 000 mRNA-molekules in die sel op 'n gegewe tydstip
10% van hulle is 'n paar hoogs uitgedrukte mRNA (laat sê aktien mRNA's)
dan in 'n primêre cDNA-biblioteek wat uit 100 000 klone bestaan,
10% van hulle (10 000) sal aktien cDNS'e wees.
Of jy kan net 'n paar honderd cDNA's sif en steeds aktien-cDNA's vind.

Wel, dit is baie lekker as jy actin wil studeer.

Wat as jy een of ander seldsame transkripsiefaktor wil bestudeer wat net op lae vlakke uitgedruk word.
In jou 100 000 mRNA's is daar dalk net 10 mRNA's wat jou transkripsiefaktor kodeer.
Nou sal jy jou hele biblioteek van 100 000 klone moet skerm.

As jou transkripsie net vir 'n kort tydjie op lae vlakke uitgedruk is, kan dit op selfs laer vlakke teenwoordig wees.

Die meerderheid van rekombinante fage in 'n standaard cDNA biblioteek dra hoogs uitgedrukte volgordes.
Skaars mRNA's is moeilik om te vind, tensy jou biblioteek baie groot is (aantal rekombinante - moet meer as 10 6 onafhanklike rekombinante bevat om 'n mRNA-populasie van 100 000 transkripsies met 99% waarskynlikheid te dek).

Die alternatief vir die sifting van toenemende getalle onafhanklike rekombinante is om die biblioteek te 'normaliseer' deur gebruik te maak van hibidiseringskinetika soos ons voorheen bespreek het.
Genormaliseerde biblioteke bevat minder kopieë van hoogs uitgedrukte mRNA's (verwyder met hibridisering) en meer kopieë van seldsame transkripsies (in 'n relatiewe sin).


Retrovirus

Ons redakteurs sal nagaan wat jy ingedien het en bepaal of die artikel hersien moet word.

Retrovirus, enige van 'n groep virusse wat aan die familie Retroviridae behoort en wat kenmerkend hul genetiese bloudruk in die vorm van ribonukleïensuur (RNA) dra. Retrovirusse is vernoem na 'n ensiem bekend as omgekeerde transkriptase, wat onafhanklik in 1971 deur die Amerikaanse viroloë Howard Temin en David Baltimore ontdek is. Omgekeerde transkripsie transkribeer RNA in deoksiribonukleïensuur (DNS), 'n proses wat 'n omkering van die gewone rigting van sellulêre transkripsie (DNS na RNA) uitmaak. Die werking van omgekeerde transkripsie maak dit moontlik vir genetiese materiaal van 'n retrovirus om permanent in die DNA-genoom van 'n besmette sel geïnkorporeer te word die ensiem word wyd gebruik in die biologiese wetenskappe om gene te sintetiseer.

Retrovirusse veroorsaak tumorgroei en sekere kankers by diere en word geassosieer met stadige infeksies van diere, soos perde aansteeklike anemie. By mense veroorsaak 'n retrovirus bekend as menslike T-sel limfotropiese virus tipe 1 (HTLV-1) 'n vorm van kanker genaamd volwasse T-sel leukemie (ATL). Dit kan ook 'n neurodegeneratiewe toestand bekend as HTLV-1-geassosieerde myelopatie/tropiese spastiese paraparese (HAM/TSP) veroorsaak. 'n Naverwante virus genaamd HTLV-2 word geassosieer met relatief ligte neurologiese afwykings, maar is nie geïdentifiseer as 'n veroorsakende middel van menslike siekte nie. Soveel as 20 miljoen mense wêreldwyd word vermoedelik met HTLV's besmet, maar slegs 'n klein persentasie van besmette individue ontwikkel werklik ATL of HAM/TSP. Die retrovirus bekend as menslike immuniteitsgebrekvirus (MIV) veroorsaak verworwe immuniteitsgebreksindroom (VIGS) by mense. MIV is nou verwant aan simian immunodeficiency virus (SIV), 'n retrovirus wat in sjimpansees en gorillas voorkom.

Sogenaamde endogene retrovirusse (ERV's) is aanhoudende kenmerke van die genome van baie diere. ERV's bestaan ​​uit die genetiese materiaal van uitgestorwe, of "fossiele," virusse, waarvan die genomiese samestelling soortgelyk is aan dié van bestaande retrovirusse. Menslike ERV's (HERV's) het in die loop van evolusie binne menslike DNA versprei geraak. Hulle word van een generasie na die volgende oorgedra en maak na raming 1 tot byna 5 persent van die menslike genoom uit. Daar word vermoed dat HERV's die evolusie van sekere elemente van die menslike genoom beïnvloed het. Hulle is ook betrokke by sekere menslike siektes, insluitend veelvuldige sklerose.

HTLV-1 was die eerste menslike retrovirus wat ontdek is, nadat dit in 1979 deur die Amerikaanse viroloog Robert C. Gallo en kollegas opgespoor en geïsoleer is. MIV is die eerste keer in 1983 geïsoleer.


Die wydverspreide voorkoms en potensiële biologiese rolle van endogene virale elemente in insekgenome

Moderne genomiese volgordebepaling en bioinformatika-benaderings het talle voorbeelde opgespoor van DNA-volgordes afgelei van DNA- en RNA-virusgenome wat in beide gewerwelde- en insekgenome geïntegreer is. Retrovirusse kodeer vir RNA-afhanklike DNA-polimerases (omgekeerde transkriptases) en integrase wat hul RNA virale genome in DNA-provirusse omskakel en provirale DNA-integrasie in die gasheergenoom fasiliteer. Verbasend genoeg kom DNS-volgordes afkomstig van RNA-virusse wat nie hierdie ensieme kodeer nie ook in gasheergenome voor. Nie-retrovirale geïntegreerde RNA-virusvolgorde (NIRVS) kom teen relatief hoë frekwensie voor in die genome van die arbovirale vektore Aedes aegypti en Aedes albopictus, word nie lukraak versprei nie en dra moontlik by tot muskiet-antivirale immuniteit, wat daarop dui dat hierdie muskiete as 'n modelstelsel kan dien om die funksie van NIRVS te ontrafel. Hier spreek ons ​​die volgende vrae aan: Wat dryf DNA-sintese vanaf die genome van nie-retrovirale RNA-virusse? Hoe vind integrasie van virus-cDNA in gasheer-DNA plaas, en wat is die biologiese funksie daarvan (indien enige)? Ons hersien huidige kennis van virale integrasies in insekgenome, veronderstel meganismes van NIRVS-vorming en hul potensiële impak op insekbiologie, veral antivirale immuniteit, en stel aanwysings vir toekomstige navorsing voor.


Retrovirusse 'byna 'n halfmiljard jaar oud'

'n Retrovirus het 'n membraan wat glikoproteïene bevat, wat in staat is om aan 'n reseptorproteïen op 'n gasheersel te bind. Daar is twee stringe RNA binne die sel wat drie ensieme het: protease, omgekeerde transkriptase en integrase (1). Die eerste stap van replikasie is die binding van die glikoproteïen aan die reseptorproteïen (2). Sodra dit gebind is, breek die selmembraan af, word deel van die gasheersel, en die RNA-stringe en ensieme gaan die sel binne (3). Binne die sel skep omgekeerde transkriptase 'n komplementêre DNA-string van die retrovirus-RNA en die RNA word afgebreek. Hierdie DNA-string staan ​​bekend as cDNA (4). Die cDNA word dan gerepliseer, en die twee stringe vorm 'n swak binding en gaan die kern binne (5). Sodra dit in die kern is, word die DNS met behulp van integrase in die gasheersel se DNS geïntegreer (6). Hierdie sel kan óf dormant bly, óf RNA kan uit die DNA gesintetiseer word en gebruik word om die proteïene vir 'n nuwe retrovirus te skep (7). Ribosoomeenhede word gebruik om die mRNA van die virus na die aminosuurvolgordes te transkribeer wat in proteïene in die growwe endoplasmiese retikulum gemaak kan word. Hierdie stap sal ook virale ensieme en kapsiedproteïene maak (8). Virale RNA sal in die kern gemaak word. Hierdie stukke word dan bymekaargemaak en word as 'n nuwe retrovirus van die selmembraan afgeknyp (9). Krediet: Wikipedia/CC BY-SA 3.0

Retrovirusse – die familie van virusse wat MIV insluit – is byna ’n halfmiljard jaar oud, volgens nuwe navorsing deur wetenskaplikes aan Oxford Universiteit. Dit is 'n paar honderd miljoen jaar ouer as wat voorheen gedink is en dui daarop dat retrovirusse antieke mariene oorsprong het, omdat hulle saam met hul dieregashere deur die evolusionêre oorgang van see na land was.

Die bevindinge, berig in die joernaal Natuur kommunikasie, sal ons help om meer te verstaan ​​oor die voortgesette 'wapenwedloop' tussen virusse en hul gashere.

Studie skrywer Dr Aris Katzourakis, van Oxford Universiteit se Departement Dierkunde, het gesê: "Baie min is bekend oor die antieke oorsprong van retrovirusse, deels as gevolg van die afwesigheid van geologiese fossielrekords. Retrovirusse is wydverspreid onder gewerwelde diere en kan ook tussen gashere oordra. , wat tot nuwe siektes soos MIV lei, en daar is getoon dat hulle in staat is om te spring tussen ver-verwante gashere soos voëls en soogdiere. Maar tot nou toe is gedink dat retrovirusse relatiewe nuwelinge was - moontlik so onlangs as 100 miljoen jaar in ouderdom.

"Ons nuwe navorsing toon dat retrovirusse ten minste 450 miljoen jaar oud is, indien nie ouer nie, en dat hulle saam met, indien nie voorheen nie, hul gewerwelde gashere in die vroeë Paleosoïkum-era moes ontstaan ​​het. Verder sou hulle teenwoordig gewees het in ons gewerwelde voorouers voor die kolonisasie van land en het hul leërskare vergesel gedurende hierdie oorgang van see na land, tot en met vandag."

Retrovirusse is 'n familie van virusse wat die MIV-virus insluit wat verantwoordelik is vir die VIGS-pandemie. Hulle kan ook kankers en immuniteitsgebreke by 'n reeks diere veroorsaak. Die 'retro' deel van hul naam kom van die feit dat hulle van RNA gemaak is, wat hulle in DNA kan omskep en in hul gasheergenoom kan invoeg - die teenoorgestelde rigting as die normale vloei van inligting in 'n sel. Hierdie eienskap beteken dat hulle soms geërf kan word as endogene retrovirusse (retrovirusse met 'n interne oorsprong), wat 'n virtuele genomiese fossielrekord vorm wat gebruik kan word om terug te kyk na hul evolusionêre geskiedenis.

Hierdie navorsing het genoomvolgordes van endogene retrovirusse gebruik wat soos die 'skuimagtige' virusse lyk - 'n groep virusse wat geneig is om langs hul gashere te divergeer. Skuimagtige virusse is wydverspreid in soogdiere, en in hierdie studie het die navorsers genomiese fossiele opgegrawe vir skuimagtige retrovirusse in hoogs diverse gashere, insluitend straalvinvisse en amfibieë waarin hulle nie voorheen gevind is nie.

Tydens hierdie studie het die navorsers een van die sleutelbeperkings oorkom in die bestudering van die diep evolusionêre geskiedenis van virusse: hul vinnige evolusie. Hierdie eienskap vergemaklik die rekonstruksie van virusse se onlangse geskiedenis, maar verbloem hul verder verlede. 'n Nuwe model wat in hierdie navorsing gebruik is - in kombinasie met die genomiese fossielrekords van die skuimagtige virusse - het die wetenskaplikes egter toegelaat om verantwoordelik te wees vir 'n oënskynlike verlangsaming in die tempo van evolusie hoe verder hulle teruggegaan het.

Dr Katzourakis het bygevoeg: "Hierdie bevindings toon dat hierdie medies belangrike groep virusse ten minste tot 'n halfmiljard jaar oud is - baie ouer as wat voorheen gedink is. Hulle dateer terug na die oorsprong van gewerwelde diere, en dit gee ons die konteks waarin ons moet hul hedendaagse aktiwiteit en interaksies met hul gashere beskou. Ons moet byvoorbeeld die aanpassings wat gewerwelde diere ontwikkel het om virusse te bekamp, ​​en die ooreenstemmende virale teenmaatreëls, beskou as die produk van 'n voortdurende wapenwedloop wat honderde miljoene jare.

"Ons afgeleide datum van die oorsprong van retrovirusse val saam met die oorsprong van adaptiewe immuniteit, en dus is dit waarskynlik dat retrovirusse 'n belangrike rol gespeel het in die ontstaan ​​van hierdie sleutelinstrument in gewerwelde antivirale verdediging. Soos ons die aard van die interaksie tussen virusse en gasheerimmuniteit, sal ons beter geplaas wees om in hierdie fyn gebalanseerde wapenwedloop in te gryp om nuwe behandelings en intervensies te ontwikkel.

"En terwyl ons 'n duideliker prentjie bou van die oorsprong van die diverse groepe virusse wat ons vandag besmet, moet ons nader kom om die raaisel van hul uiteindelike oorsprong te ontrafel."


Komponente wat in die RT-qPCR gebruik word:

Die keuse van komponente vir die omgekeerde transkripsie-PKR is net so belangrik soos die keuse van temperatuurtoestande, maar moenie daaroor bekommer nie, die gereed om te gebruik omgekeerde transkripsie-PKR-stel bevat al die bestanddele in die reaksiebuffer en reaksiemengsel.

Die keuse van elke PCR-bestanddeel en die hoeveelheid daarvan is net so belangrik as die keuse van temperatuurtoestande vir PCR. Deesdae maak gereed om te gebruik omgekeerde transkripsie PCR-stelle jou werk doeltreffend aangesien dit elke bestanddeel in het. Kom ons kyk na 'n paar komponente van RT-PCR,

  • Omgekeerde transkriptase-ensiem met RNase-aktiwiteit
  • RNase H (as die omgekeerde transkriptase dit nie het nie)
  • DNA-polimerase

Abstrak

Baie virusse dra meer as een segment van nukleïensuur in die viriondeeltjie in, maar retrovirusse is die enigste bekende groep virusse wat twee identiese (of amper identiese) kopieë van die RNA-genoom binne die virion bevat. Hierdie RNA-genome word nie-kovalent saamgevoeg deur 'n proses bekend as genomiese RNA-dimerisasie. Uniek is die RNA-dimerisering van die retrovirale genoom van deurslaggewende belang vir doeltreffende retrovirale replikasie. In hierdie artikel word ons huidige begrip van die verband tussen retrovirale genoomkonformasie, dimerisasie en replikasie hersien.


Stap 7: Data-analise

A. Datanormalisering—Vergelykende Cq metode

Die belangrikheid van normalisering van qPCR-data is herhaaldelik beklemtoon [1, 26]. Datanormalisering is 'n kritieke stap in die qPCR-werkvloei, aangesien dit regstel vir variasies in veelvuldige stappe, insluitend RNA-suiwering, RNA-konsentrasie-assessering, sowel as omgekeerde transkripsie en amplifikasie-doeltreffendheid. Normalisering met stabiel uitgedrukte verwysingsgene as interne beheermaatreëls, bekend as die vergelykende Cq of die Δ㥌q metode, is die mees algemene metode vir die normalisering van mRNA-data. Hierdie tegniek vereis egter toepaslike validering om seker te maak dit word korrek uitgevoer [27]. Vir die vergelykende Cq metode om geldig te wees, is dit belangrik om seker te maak dat die verwysingsgene en teikengene 'n soortgelyke amplifikasie-doeltreffendheid het, as 'n geldige vergelykende Cq metode is gebaseer op 'n bykomende aanname van soortgelyke versterking doeltreffendheid [28]. 'n Standaardkurwe kan vir die 㥌 geteken wordq (die verskil tussen verwysing en teikengeen teenoor die log van cDNA-invoer), en die absolute waarde van die helling moet π.1 [29] wees. Sien 'n voorbeeld van 㥌q tussen Siklofilien en PGC-1α in Fig 6. Indien dit nie moontlik is om verwysingsgene met soortgelyke amplifikasiedoeltreffendheid as die teiken te verkry nie, word voorgestel om die Pfaffl-metode vir berekening te gebruik, waarin die berekening aangepas word deur die verskille in die amplifikasiedoeltreffendheid van die teiken- en verwysingsgene [30, 31].

Die vergelykende Cq metode normaliseer die Cq waarde van 'n teikengeen na interne verwysingsgene voordat vergelykings tussen monsters gemaak word. Eerstens, die verskil tussen Cq waardes (㥌q) van die teikengeen en die geometriese gemiddelde van veelvuldige verwysingsgene word vir elke monster bereken, en dan word die verskil in die 㥌q (Δ㥌q) word bereken tussen twee monsters (bv. kontrole en behandeling, of voor- en nabehandeling). Die vou-verandering in uitdrukking van die twee monsters word bereken as 2 -Δ㥌q, waar 2 afkomstig is van 1 + doeltreffendheid en doeltreffendheid word aanvaar as 1 (d.i. 100% doeltreffendheid) [28]. Ons aanbeveling vir die gebruik van vergelykende Cq metode word in boks 9 gelys.

Boks 9

Dit is belangrik om te verseker dat die verwysingsgene en teikengene 'n soortgelyke amplifikasie-doeltreffendheid het wanneer die vergelykende C gebruik word.q metode anders moet die Pfaffl-metode oorweeg word.

B. Keuse van verwysingsgene

Verskeie tradisionele verwysingsgene is wyd gebruik in die qPCR-analise. 'n Oorsigartikel het gerapporteer dat 33% en 32% van die uitdrukkingsanalise van 6 hoë-impak joernale gebruik gliseraldehied-3-fosfaat dehidrogenase (GAPDH) en Aktien beta (ACTB) as verwysingsgene onderskeidelik vir referate wat in 1999 gepubliseer is [32]. Dieselfde resensie het egter daarop gewys dat die uitdrukking van beide GAPDH en ACTB wissel aansienlik onder verskillende eksperimentele instellings in 'n reeks weefsels [32]. GAPDH is oorspronklik geïdentifiseer as 'n intermediêre in glikolise-weg en na verwagting stabiel teenwoordig in alle selle, dus is dit gekies as 'n verwysingsgeen. Ander aktiwiteite van GAPDH, insluitend funksies in endositose, translasiebeheer en DNA-replikasie [33], is eers later herken [32].

Verskeie verwysingsgene is in verskillende oefeningstudies gebruik. Mahoney et al. -[34] berig dat β-2-mikroglobulien (B2M) en ACTB was die mees stabiele verwysingsgene na 300 eksentrieke kontraksies, terwyl B2M en GAPDH was die mees stabiele na 75 minute se hoë-intensiteit intermitterende fietsry. In 'n ander studie is spierbiopsies geneem voor, onmiddellik na en 4 uur na 30 minute se trapmeul wat teen 70% van VO gehardloop het2 maks, en RNA is uit 40 enkelvesels onttrek. GAPDH is gevind dat dit stabiel uitgedruk word in alle monsters [35]. Dus, wanneer verwysingsgene as interne beheermaatreëls vir 'n oefeningstudie gebruik word, moet die stabiliteit van elke verwysingsgeen noukeurig geëvalueer word, en daar is geen ‘one-size-pas-almal’ geen wat in alle studies en met alle oefenprotokolle.

Ten einde die veranderlikheid van interne beheer te verminder, word dit aanbeveel om veelvuldige gene vir normalisering te gebruik [36, 37]. Met behulp van monsters verkry van neuroblastoom-sellyne, Vandesompele en sy kollegas het getoon dat normalisering met behulp van 'n enkele verwysingsgeen gelei het tot verskille van 3,0-voudig in 25%, en 6,4-voudig in 10%, van die gevalle wat ontleed is [36]. Die evaluering van verwysingsgene kan bereik word deur 'n statistiese analise op die C uit te voerq waarde of die gebruik van beskikbare sagteware. Verskeie sagtewareprogramme is beskikbaar vir verwysingsgenevaluering deur verskillende analitiese benaderings te gebruik, soos BestKeeper [38], NormFinder [39] en GeNorm [36].

In ons laboratorium het ons ses algemeen gebruikte verwysingsgene, ACTB, TATA-boks bindende proteïen (TBP), Siklofilien, GAPDH, B2M, en 18S rRNA (Tabel 4). Daar is 'n paar redes waarom hierdie kandidaatverwysingsgene gekies is. Eerstens is hierdie ses gene potensieel stabiel uitgedrukte verwysingsgene, en word wyd gebruik in die qPCR-analise van skeletspiermonsters wat in menslike oefeningstudies verkry is [34, 35, 40]. Tweedens behoort hulle aan verskillende funksionele klasse, dus is dit onwaarskynlik dat hulle mede-gereguleer word. Gebruik egter vergelykende Cq metode, is dit moeilik om klein verskille in geenuitdrukking (d.w.s. minder as 2-voudig) te kwalifiseer, tensy verskeie stabiel-uitgedrukte verwysingsgene vir normalisering gebruik word [36, 41].

Tabel 4

GeneToegangsnr.Funksie (NCBI Verwysingsvolgorde databasis [42])
ACTB (aktien beta) <"type":"entrez-nukleotied","attrs":<"text":"NM_001101.3","term_id":"168480144","term_text":"NM_001101.3">> NM_001101.3Hierdie geen kodeer een van ses verskillende aktienproteïene, wat 'n hoofbestanddeel van die kontraktiele apparaat is en een van die twee niespier-sitoskeletaktiene.
TBP (TATA-boks bindende proteïen) <"type":"entrez-nukleotied","attrs":<"text":"NM_003194.4","term_id":"285026518","term_text":"NM_003194.4">> NM_003194.4Hierdie geen kodeer vir 'n algemene transkripsiefaktor wat spesifiek aan 'n DNA-volgorde genaamd die TATA-boks bind, en help om RNA-polimerase II oor die transkripsie-beginplek van die geen te posisioneer.
Siklofilien (PPIA, peptidiel-prolyl cis-trans-isomerase A) <"type":"entrez-nukleotied","attrs":<"text":"NM_021130.4","term_id":"665821272","term_text":"NM_021130.4">> NM_021130.4Hierdie geen kodeer vir 'n proteïen wat die cis-trans-isomerisasie van prolien imidiese peptiedbindings in oligopeptied kataliseer en die vou van proteïene versnel.
GAPDH (gliceraldehied-3-fosfaat dehidrogenase) <"type":"entrez-nukleotide","attrs":<"text":"NM_001289746.1","term_id":"576583523","term_text":"NM_001289746.1">> NM_001289746.1.Hierdie geen kodeer 'n sleutelensiem in die glikolitiese pad, wat die omkeerbare oksidatiewe fosforilering van gliseraldehied-3-fosfaat in die teenwoordigheid van anorganiese fosfaat en nikotinamied adenien dinukleotied (NAD) kataliseer.
B2M (β-2-mikroglobulien) <"type":"entrez-nukleotied","attrs":<"text":"NM_004048.2","term_id":"37704380","term_text":"NM_004048.2">> NM_004048.2Hierdie geen kodeer 'n serumproteïen in assosiasie met die hoof histoversoenbaarheidskompleks (MHC) klas I swaar ketting op die oppervlak van byna alle kernselle.
18S rRNA (RNA, 18S ribosomaal) <"type":"entrez-nukleotied","attrs":<"text":"NR_003286.2","term_id":"225637497","term_text":"NR_003286.2">> NR_003286.2Hierdie geen verteenwoordig die gedeelte van een rDNA-herhaling wat 'n 18S rRNA kodeer.

Eksperiment 4

In ons menslike oefeningstudie (sien Materiale en metodes), is spiermonsters geneem van 9 deelnemers in rus (Basislyn), en dan onmiddellik na (0 uur) en 3 uur ná (3 uur) die finale oefensessie van 'n 4-week opleidingsintervensie. Alle spiermonsters is onmiddellik na die spierbiopsie snap-bevries, en die RNA vir alle monsters (n = 27) is onttrek met behulp van RNeasy Plus Universal Mini Kit met 'n gewysigde protokol (met 2-propanol) vir alle monsters wat ons verkry het. A260/A280 verhouding groter as 1.9 en 'n RQI-telling groter as 7 (met behulp van 'n Experion outomatiese elektroforesestelsel). Ons het toe die omgekeerde transkripsie uitgevoer om RNA in 'n enkele lopie na cDNA om te skakel, voordat qPCR-analise uitgevoer is. Om stabiel uitgedrukte verwysingsgene oor alle monsters te alle tye te vind, het ons ses verwysingsgene getoets (ACTB, TBP, Siklofilien, GAPDH, B2M, en 18S rRNA Tabel 5 en Fig 7). Ons het toe RefFinder gebruik om die stabiliteit van hierdie gene te evalueer. RefFinder is 'n webgebaseerde hulpmiddel wat in staat is om vier goed gevestigde algoritmes gelyktydig te laat loop (GeNorm [36], BestKeeper [38], NormFinder [39] en vergelykende delta-CT [43]), ken 'n gepaste gewig aan elkeen toe. individuele geen, en bereken die meetkundige gemiddelde van hul gewigte vir die algehele finale ranglys [44]. Gebaseer op die aanbevole omvattende rangorde van RefFlinder, is ons kandidaatgene gerangskik van die meeste tot die minste stabiel as B2M, TBP, 18S rRNA, ACTB, GAPDH en Siklofilien (Tabel 5).

Cq waardes van individuele reaksies gebruik ACTB, TBP, Siklofilien, GAPDH, B2M, en 18S rRNA primers aangebied word. Alle monsters is van 'n oefeningstudie (n = 9 deelnemers × 3 tydpunte = 27 monsters).

Tabel 5

Rangorde (mees tot minste stabiel)
Metode123456
Delta CTTBPB2M18S rRNAACTBGAPDHSiklofilien
Beste BewaarderB2MTBP18S rRNAACTBGAPDHSiklofilien
NormFinderTBPB2M18S rRNAACTBGAPDHSiklofilien
GenormB2M / 18S rRNATBPACTBGAPDHSiklofilien
Aanbevole omvattende rangordeB2MTBP18S rRNAACTBGAPDHSiklofilien

Om te illustreer hoe 'n mens te werk kan gaan om verwysingsgene te kies, kies ons PPARG koaktiveerder 1 alfa (PGC-1α) as 'n voorbeeld vir geenuitdrukking-analise. PGC-1α is 'n transkripsionele koaktiveerder wat in skeletspiere verryk is. Dit is getoon dat oefening in staat is om te verhoog PGC-1α mRNA-inhoud in mense [45]. Die amplifikasie-doeltreffendheid van al ses kandidaatverwysingsgene was soortgelyk aan ons teikengeen, PGC-1α (Tabel 6). Ons het die meetkundige gemiddelde van top drie-gerangskik gene deur RefFinder (TBP, B2M, en 18S rRNA) vir daaropvolgende datanormalisering. Ons aanbevelings vir die keuse van verwysingsgene word in Raam 10 gelys.

Tabel 6

GeneToegangsnr.Primers (vorentoe en terug)Amplikongrootte (bp)Beginposisie (bp)Doeltreffendheid (%)Bron
TBP (TATA-boks bindende proteïen) <"type":"entrez-nukleotied","attrs":<"text":"NM_003194.4","term_id":"285026518","term_text":"NM_003194.4">> NM_003194.4 F: CAGTGACCCAGCAGCATCACT
R: AGGCCAAGCCCTGAGCGTAA
20512199[46]
Siklofilien (PPIA, peptidiel-prolyl cis-trans-isomerase A) <"type":"entrez-nukleotied","attrs":<"text":"NM_021130.4","term_id":"665821272","term_text":"NM_021130.4">> NM_021130.4 F: GTCAACCCCACCGTGTTCTTC
R: TTTCTGCTGTCTTTGGGACCTTG
10093100[47]
B2M (β-2-mikroglobulien) <"type":"entrez-nukleotied","attrs":<"text":"NM_004048.2","term_id":"37704380","term_text":"NM_004048.2">> NM_004048.2 F: TGCTGTCTCCATGTTTGATGTATCT
R: TCTCTGCTCCCCACCTCTAAGT
8658998[36]
ACTB (aktien beta) <"type":"entrez-nukleotied","attrs":<"text":"NM_001101.3","term_id":"168480144","term_text":"NM_001101.3">> NM_001101.3 F: GAGCACAGAGCCTCGCCTTTT
R: TCATCATCCATGGTGAGCTGGC
7026107Ontwerp deur skrywers
18S rRNA (RNA, 18S ribosomaal 5) <"type":"entrez-nukleotied","attrs":<"text":"NR_003286.2","term_id":"225637497","term_text":"NR_003286.2">> NR_003286.2 F: CTTAGAGGGACAAGTGGCG
R: GGACATCTAAGGGCATCACA
71144399[48]
GAPDH (gliceraldehied-3-fosfaat dehidrogenase) <"type":"entrez-nukleotide","attrs":<"text":"NM_001289746.1","term_id":"576583523","term_text":"NM_001289746.1">> NM_001289746.1. F: AATCCCATCACCATCTTCCA
R: TGGACTCCACGACGTACTCA
82388106[49]
PGC-1α (PPARG koaktiveerder 1 alfa) <"type":"entrez-nukleotied","attrs":<"text":"NM_013261.3","term_id":"116284374","term_text":"NM_013261.3">> NM_013261.3 F: CAGCCTCTTTGCCCAGATCTT
R: TCACTGCACCACTTGAGTCCAC
101199104[50]

Boks 10

Dit word aanbeveel om veelvuldige verwysingsgene te toets [36, 37], en die stabiliteit van elke geen moet beoordeel word voordat toepaslike verwysingsgene vir 'n spesifieke studie gekies word. Ons beveel aan om RefFinder te gebruik om die stabiliteit van verwysingsgene te assesseer, aangesien dit vier goed gevestigde algoritmes gelyktydig laat loop. Behalwe vir die stabiliteit van die verwysingsgeen, behoort die amplifikasiedoeltreffendheid van die verwysingsgene soortgelyk aan die teikengene te wees.

C. Normalisering van geenuitdrukking via cDNA-kwantifisering

Om stabiele verwysingsgene te vind is 'n uitdaging wanneer qPCR uitgevoer word, en navorsers het alternatiewe metodes gesoek soos om cDNA te kwantifiseer. Quant-iT ™ OliGreen ssDNA-reagens is 'n fluoresserende nukleïensuurkleurstof vir die kwantifisering van cDNA, en dit is in baie gepubliseerde artikels gebruik, insluitend studies wat geenuitdrukking in menslike skeletspier ondersoek in reaksie op oefening [51�]. 'n Potensiële probleem met die gebruik van OliGreen-kleurstof om cDNA-inhoud te kwantifiseer, is dat die kleurstof ook sensitief is vir RNA, soos in die gebruikershandleiding vermeld “die OliGreen-reagens vertoon wel fluoressensieverbetering wanneer dit aan RNA gebind word” [54].

Eksperiment 5

Om die spesifisiteit en geldigheid van die gebruik van OliGreen-kleurstof te toets om cDNA-inhoud te kwalifiseer, het ons cDNA gesintetiseer uit vier verskillende hoeveelhede (0, 0,25, 0,5 en 1 μg) RNA verkry uit eksperiment 1 (‘Goeie Praktyk,” = 4 vir elke RNA-invoer). Ons het ook 1 μg RNA in die–RT kontrolereaksie gelaai, wat geen cDNA bevat het nie (n = 4). Ons het iScript ™ Reverse Transcription Supermix (Bio-Rad) gebruik vir cDNA-sintese. Die ensiem omgekeerde transkriptase in hierdie stel het RNase H + aktiwiteit wat die RNA string in RNA-DNA basters afbreek na cDNA sintese. Die cDNA inhoud in elke monster is dan gemeet met behulp van OliGreen kleurstof (Fig 8A). In ooreenstemming met vorige navorsing [51], het cDNA-monsters wat uit verskillende hoeveelhede RNA gesintetiseer is, 'n sterk positiewe korrelasie getoon vir die gemete cDNA-konsentrasie teenoor RNA-insette (r = 0.9947, P< 0,0001) (Fig 8B). Die -RT kontrolereaksie, wat slegs 1 μg RNA maar geen cDNA bevat het nie, het egter 'n hoër lesing getoon as cDNA gesintetiseer vanaf 0.5 μg RNA. Hierdie resultaat het bevestig dat die OliGreen kleurstof nie spesifiek ssDNA meet nie, maar ook RNA meet. Dit kan 'n vals hoë cDNA-inhoud in die toets veroorsaak as RNA nie behoorlik afgebreek word nie. Ons aanbevelings vir die normalisering van geenuitdrukking via cDNA-kwantifisering word in boks 11 gelys.

A: Determination of cDNA amount in reactions with different RNA input. Different amounts of RNA were used to synthesise cDNA (n = 4 for each RNA input), and the relative amount of cDNA in each reaction was measured using OliGreen dye. Values are presented as mean ± SD. B: Correlation between RNA input and average relative amount of cDNA measured.

Box 11

In order to obtain an accurate and specific measurement of cDNA from the Oligreen dye, RNA in the RNA-DNA hybrids needs to be degraded before measurement. This can be achieved by using a reverse transcriptase enzyme with RNase H + activity ( Fig 8 ), or including an RNase degradation step after cDNA synthesis [51].

D. Effect of normalisation methods on the results

Experiment 6

To investigate how normalisation might alter the outcome, we measured the exercise-induced expression of PGC-1α mRNA in the samples from a human exercise study (as described in Experiment 4) and analysed the same set of data in three ways. We performed normalisation using three of the most stable reference genes (TBP, B2M, en 18S rRNA), based on the reference gene evaluation ( Table 5 ). In comparison, we also used a single reference gene, Cyclophilin, which was the lowest ranked reference gene. Lastly, we analysed the data using the cDNA content measured by Quant-iT ™ OliGreen ssDNA Reagent. We saw a significant difference in gene expression at 3 hours after exercise using all three normalisation options (P < 0.01, Fig 9 ). These exercise-induced fold changes in PGC-1α expression are consistent with the existing literature [40, 45].

Muscle samples were taken at rest (Baseline, Week 0) and immediately post-exercise (0 h), and 3 h post-exercise. Data were analysed using 3 different normalisation methods. Values are fold change ± SD.

There were no significant differences between the fold changes in PGC-1α mRNA content when using different methods of normalisation however, the fold changes were more similar when using three reference genes and cDNA content for normalisation, rather than using one reference gene. The increase of PGC-1α was 3.4 ± 2.0 fold when three reference genes were used for normalisation. When a single reference gene (Cyclophilin) was used for normalisation, the increase in gene expression was 5.1 ± 2.4 fold (P = 0.08 compared to 3 reference genes). When cDNA content was used for normalisation, the increase of gene expression was 3.2 ± 1.9 fold (P = 0.51 compared to 3 reference genes, P = 0.09 compared to 1 reference gene). In certain experimental settings, especially when examining small changes in mRNA level, these different results could lead to different conclusions. This may also help to explain the inter-study variability for exercise-induced changes in mRNA content. As previously suggested, use of a single reference gene is considered ‘not acceptable’ unless its stability has been clearly demonstrated in the same study [1]. Our recommendations for normalising gene expression via reference genes are listed in Box 12.

Box 12

We recommend testing four or more candidate reference genes for each study, and selecting the ones that are stably expressed for data normalisation. In our research laboratory, we chose to use two to three most stable reference genes based on evaluation software for an individual study [45, 55].


DNA provirus hypothesis

In the mid-20th century there were many advances in molecular biology, including the description of DNA in 1953 by American geneticist and biophysicist James D. Watson and British biophysicists Francis Crick and Maurice Wilkins. By the 1960s it was understood that sarcomas are caused by a mutation that results in uncontrolled cell division. It was also evident that RSV was inherited during the division of cancerous cells. This inheritance occurred in a manner agreeing with the Mendelian laws of genetic inheritance—laws that heretofore had been understood to apply only to DNA molecules (sien the articles genetics and heredity).

Scientists hypothesized that, in order for such viral inheritance to occur, a virus would need to transcribe its RNA genome into DNA and then insert this DNA into the host cell genome. Once incorporated into the host genome, the virus would be transcribed as though it were another gene and could produce more RNA virus from its DNA. This hypothesis, called the “DNA provirus hypothesis,” was developed in the late 1950s by American virologist Howard Martin Temin, when he was a postdoctoral fellow in the laboratory of Italian virologist Renato Dulbecco at the California Institute of Technology. Temin’s hypothesis was formally proposed in 1964. The provirus hypothesis came about when experiments demonstrated that an antibiotic called actinomycin D, which is capable of inhibiting DNA and RNA synthesis, inhibited the reproduction of RSV. However, the concept of an RNA molecule’s turning itself into DNA drew very few supporters.