Inligting

A10. Algemene skakels en verwysings - Biologie

A10. Algemene skakels en verwysings - Biologie


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

A10. Algemene skakels en verwysings

Begin in Algemene Chemie

Let wel: skakels gewys in is geargiveerde kopieë van bladsye wat verdwyn het en nie meer onderhou word nie.

Gratis aflaaibare Chemie-handboeke

'n Inleiding tot Chemie deur Mark Bishop. Daar is twee weergawes van hierdie huidige handboek, wat albei dieselfde inligting bevat, maar verskillend georganiseer: die "Chemie-eerste" weergawe begin met werklike "chemie" — dit wil sê chemiese vergelykings en reaksies. Die alternatiewe "Atome-eerste"-formaat stoor hierdie goed vir later, en begin met atoomteorie en binding. Om PDF-weergawes af te laai, kies Chemistry-First of Atoms-First. Neem asseblief kennis dat alhoewel jy dit gratis kan aflaai, Mark vra dat diegene wat gereeld daarvan gebruik maak 'n deelwarefooi van $20 betaal. Individuele hoofstukke vir iPad, iPhone, Android-toestelle en Kindle is ook beskikbaar: Chemistry-First, Atoms-First.

Chemiese beginsels, 3de Uitg (Richard Dickerson, Harry Gray en Gilbert Haight, 1979) - Hierdie 1979-teks word goed beskou en steeds goed vir die meeste eerstejaar Algemene Chemie-kursusse. Elke hoofstuk kan as 'n aparte pdf-lêer afgelaai word om te sien watter een jy benodig, beweeg jou muis oor die prent en die titel sal verskyn.

Chemiese beginsels (CK-12-stigting Sharon Bewick, Johathan Edge, Therese Forsythe, Richard Parsons) 'n Enkele 900-bladsy, 51 Mb pdf-lêer aflaai.

Algemene Chemie - 'n gratis handboek saamgestel uit die werk van verskeie skrywers. Dit is beskikbaar in die formaat van 'n "help"-lêer wat met MS Windows werk. Sien asseblief hier vir besonderhede.

Beginsels van Algemene Chemie - beskikbaar as 'n PDF-lêer (147 Mb) of as 'n zip-lêer vir gebruik vanlyn met 'n webblaaier.

Termodinamika en Chemie - deur Howard DeVoe, U. Maryland (2014) Hierdie gratis boek in PDF-formaat is 'n hersiene en vergrote weergawe van die eerste uitgawe wat in hardebandformaat in 2001 deur Prentice Hall gepubliseer is.

Gratis Organiese Chemie handboek - Individuele hoofstukke van Organiese chemie deur Daley & Daley kan as pdf-lêers afgelaai word.

Kollege-vlak aanlyn lesings

UC-Berkeley eChem1a: Aanlyn Algemene chemie - Hierdie professioneel vervaardigde video's, waarvan die meeste prof. Mark Kubinec bevat, is van uitstaande gehalte - miskien die beste algemene chemie-tutoriale op universiteitsvlak beskikbaar. Daar is meer as 400 van hulle, georganiseer in 38 lesse wat baie van laasgenoemde bevat probleemoplossing-tutoriale, interaktiewe vasvrae en laboratoriumdemonstrasies. Die meeste van die video's is redelik kort (5-15 min) en kan in enige volgorde verkry word.

MIT Beginsels van Chemiese Wetenskap - Hierdie MIT OpenCourseWare kursus bied 'n inleiding tot die chemie van biologiese, anorganiese en organiese molekules. Die klem val op basiese beginsels van atoom- en molekulêre elektroniese struktuur, termodinamika, suur-basis- en redoks-ewewigte, chemiese kinetika en katalise. Meer MIT Chemie lesings en video's.

Yale Freshman Organiese Chemie - Nog 'n uitstekende reeks, hierdie een dek die twee-semester eerstejaarskursus wat organiese chemie insluit. Dit is lewendige klaskamerlesings, aangebied deur prof. J. Michael McBride. Sy beskrywings van die historiese ontwikkeling van belangrike konsepte is buitengewoon goed, en dra by tot hul begrip. Sommige van die geprojekteerde skyfies is moeilik om te lees.
Eerstesemesterlesings - Tweedesemesterlesings

Reacciones Químicas y Cálculos Estequiométricos - Aprenderás los conceptos básicos de las reacciones químicas y profundizarás en su estudio cuantitativo (estequiometría). (Universitat Politècnica de Valencia)

Webgebaseerde hulpbronne vir Algemene Chemie

ChemWiki: The Dynamic Chemistry E-Textbook - 'n samewerkende benadering tot chemie-onderrig waar 'n ooptoegang-handboekomgewing voortdurend deur studente en fakulteitslede geskryf en herskryf word, wat lei tot 'n gratis Chemie-handboek om konvensionele papiergebaseerde boeke te vervang. Die materiaal is georganiseer in afdelings vir analitiese, biologiese, anorganiese, organiese, fisiese en teoretiese chemie. Elkeen hiervan bevat onderwerpe wat gewoonlik in "algemene" chemie ingesluit word, sowel as meer gevorderde onderwerpe wat verder gaan as eerstejaarkollegevlak.

Algemene Chemie Aanlyn! - 'n interaktiewe gids en webhulpbron vir studente en onderwysers van inleidende kollege-chemie, onderhou deur Fred Senese van Frostberg State University (MD). 'n Goed georganiseerde magdom materiaal, insluitend versamelings aantekeninge en gidse vir inleidende Algemene Chemie, vaardigheidskontrolelyste en aanlyn selfgraderingseksamens, en 'n V&A-kolom.

'n Inleiding tot Chemie - 'n aanlyn weergawe van 'n teks deur Mark Bishop van Monterey Peninsula College (CA). Dit is hoofsaaklik bedoel vir studente wat begin met chemiekursusse. ($20 " skenk-ware", en die moeite werd!)

Virtuele Chembook - hierdie mooi gedaante webwerf deur Charles Ophardt van Elmhurst College dek 'n wye reeks algemene, organiese en omgewingchemie. Die teksmateriaal is interessant en goed geskryf sonder om ensiklopedies te probeer wees.

Algemene Chemie Virtuele Handboek - 'n gratis versameling van omvattende, diepgaande behandelings van verskeie onderwerpe, bedoel om konvensionele handboekbehandelings aan te vul of te vervang. Dit is hoofsaaklik gemik op die eerstejaarkollege-vlak, maar gevorderde hoërskoolleerlinge sal baie daarvan nuttig vind. (Steve Lower, Simon Fraser Universiteit)

Die Chemogenese Webboek - hierdie uitgebreide, uitstekende en omvattende webwerf deur Mark Leach vertel hoe chemie na vore kom uit die Periodieke Tabel en verdeel in die ryk en buitengewone wetenskap wat ons ken en ervaar.

Chemie-tutoriaalreeks op YouTube en ander videoversamelings - 'n opsomming van die belangrikste versamelings, insluitend die Khan Akademie, en dié wat deur verskeie onderwysers gedoen word, meestal op hoërskoolvlak.

WikiBooks oor Chemie - Baie onderwerpe in algemene chemie word hier behandel, en dit is die moeite werd om na te kyk. Maar soos in enige "wiki-" tipe projek waartoe enigiemand kan bydra, is die kwaliteit veranderlik, en die visuele ontwerp is primitief.

Tanner se Algemene Chemie - 'n groot versameling bladsye oor materie (insluitend kwantumteorie), fisiese chemie, elektrochemie en waterige oplossings.

AUS-e-TUTE -'n Australiese "wetenskaponderwyswebwerf wat deur ervare onderwysers ontwikkel word." Hulle bied tutoriale, tekste, speletjies, oefeninge aan geregistreerde lede, sowel as 'n uitgebreide versameling tutoriale vir nie-lede.

Chemie Webhulpbronne - hierdie webwerf onderhou deur Ron Rinehart van Monterey Peninsula College bevat 'n magdom materiaal gerig op chemiese onderwys, alles goed georganiseer op 'n visueel-aantreklike manier.

ChemPaths: Studentehulpbronne vir Algemene Chemie - 'n omvattende versameling tutoriale van die Chemiese Onderwys Digitale Biblioteek

Kennisdeur - 'n uitstekende kompendium van Chemie- en Wetenskapverwante data, in baie opsigte meer omvattend as die Handboek van Chemie en Fisika, en beslis meer gerieflik om te gebruik. Moet deur elke ernstige Chemie-student geboekmerk word!

Die ChemCollective studenteblad het skakels na oefenprobleme en tutoriale oor verskeie onderwerpe.

Kollege fisika vir studente van biologie en chemie - Hierdie hiperhandboek deur Ken Koehler is mooi georganiseer en is die ideale plek om te gaan wanneer jou Chemie-handboek jou in die steek laat.

Hoe om chemie te slaag - goeie raad wat wyd geïgnoreer word.

> - hierdie uitgebreide versameling skakels by Bob Jacob se Wilton HS-werf het blykbaar vroeg in 2008 verdwyn, maar hierdie skakel na 'n 2007-argiveerde weergawe behoort steeds nuttig te wees vir beide hoërskool- en kollege-vlak Algemene Chemie.

Hierdie week in die geskiedenis van chemie - deel van Carmen Giunta (Le Moyne College) se uitstekende Classic Chemistry-webwerf, "This Week" bied mini-tydlyne aan wat die huidige tydperk van twee weke dek.

" Storieprobleme" - 'n paar praktiese raad vir diegene wat verslaaf is aan " plug-and-chug".

Chemieprobleme - uitgewerkte voorbeelde - Hierdie About.com-werf het 'n redelike keuse.

Agt wenke vir sukses in wetenskapkursusse - goeie raad van 'n Georgetown Universiteit prof.

Chemie Pakkette deur die veteraan-onderwyser Mark Rosengarten. 'n Versameling aantekeninge en werkkaarte in pdf-formaat in twee stelle van 13 eenhede, een vir honneurs en die ander vir Regents Chemistry. Elke eenheid begin met 'n mooi georganiseerde stel definisies en notas, en gaan voort met werkkaarte wat as studentehuiswerk kan dien. Alhoewel dit aan die hoërskool gerig is, kan hierdie materiaal dien as 'n goeie resensie vir kollege-chemiestudente.

Purdue Universiteit Algemene Chemie Onderwerpe - Notas en oefenprobleme oor 'n groot aantal onderwerpe.

ChemSpider "is 'n gratis chemiese struktuurdatabasis wat vinnige teks- en struktuursoektogtoegang tot meer as 58 miljoen strukture uit honderde databronne bied."

Video's vir Algemene Chemie

Daar is nou waarskynlik duisende hiervan op YouTube en ander werwe - veels te veel vir een persoon om te hersien, wat nog te sê om op datum te bly. In 2013 het ek 'n lys geskep van sommige van die beter video's wat ek die moeite werd beskou het om aan ander aan te beveel.

Doc Brown se Chemie-kliniek- algemene hersiening/hersieningwebwerf vir Britse GCSE, AS en A2 chemie en VSA/Kanada grade 9-12. Hersieningsnotas, veelkeusetoetse, gestruktureerde vrae, grafika en uitgebreide skakels na nuttige en interessante CHEMISTRY-webwerwe. Een terreinspesialiteit is die struktuur en benaming van organiese verbindings.

Chemie-afrigter is 'n hoërskool kursus ondersteuning bladsy van enklopediese proporsies. Geskryf deur Bob Jacobs van Hoërskool Wilton, bevat hierdie goed georganiseerde webwerf honderde skakels wat vir studente op beide die hoërskool- en eerstejaarkollegevlak van belang sal wees.

ChemThink - Hierdie nuwe webwerf bestaan ​​uit 'n reeks interaktiewe vasvra-gebaseerde tutoriale. Daar is ook 'n paar laboratoriumsimulasies. Registrasie is nodig, maar is gratis.

ChemTutor dek 'n verskeidenheid onderwerpe - hoofsaaklik gemik op HS en AP Chemie.

Die Chem-span - Tutoriale vir hoërskoolchemie in alle standaardonderwerpe vir studente in hoërskool en gevorderde plasingchemie.

Algemene Chemie I, Algemene Chemie II - "'n Virtuele Handboek" en 'n betroubare stel lesingnotas wat 'n volledige kollege-vlak kursus dek deur Michael Blaber van Florida State U. Kyk in die linkerkantse raam om te sien watter onderwerpe beskikbaar is.

Merlin s'n Beginsels van Alchemie is 'n chemie hiperhandboek in die vorm van 'n groot stel HTML-lêers wat gebruikers aflaai en dan met hul webblaaiers vanlyn bekyk. Dit is op 'n interessante manier georganiseer en is bedoel om gebruikers met 'n wye verskeidenheid agtergronde en vermoëns te ondersteun, insluitend tuisskolers en volwasse leerders. Daar is 'n nominale koste vir die aflaai van die materiaal.

Kwantumteorie en die atoom - 'n goed georganiseerde en verstaanbare stel webblaaie wat kwantummeganika en die toepassings daarvan dek, insluitend praktiese soos katskanderings en mikrogolfoonde. Die moeite werd om te kyk!

Virginia Tech se HyperMedia-werf het 'n paar mooi Algemene Chemie-tutoriaalbladsye.

Virtuele Chemie-eksperimente - 'n versameling interatiewe webgebaseerde chemie-tutoriale. Die tutoriale gebruik Physlets en Chemistry Applets om eksperimente te simuleer of molekulêre en atoomstruktuur uit te beeld. Onderwerpe sluit in ekwilibria, kinetika, koördinasiechemie en kristalstruktuur. (David Blauch, Davidson College)

Die basiese

Waaroor gaan Chemie? 'n Inleiding tot chemiese wetenskap. Hierdie tutoriaal poog om die belangrikste konsepte wat moderne chemie definieer aan te bied, sonder om natuurlik in die bloederige besonderhede in te gaan! Die eenheid word afgesluit met 'n geïllustreerde opsomming van die hoofstrominge van moderne chemie. (S. Lower, Simon Fraser U.)

Voorlopige: goed wat jy moet weet voordat jy te ver in Chemie delf - tutoriale wat die volgende onderwerpe dek: klassifikasie en eienskappe van materie, digtheid en dryfvermoë, energie, hitte en temperatuur, eenhede en afmetings, meetfout, betekenisvolle syfers en afronding (hierdie laaste drie onderwerpe is identies met die eerste drie in die les beskryf onmiddellik onder.) (S. Lower, Simon Fraser U.)

Materie en maatstaf: alles oor eenhede, onsekerheid, betekenisvolle syfers,en hoe om eksperimentele foute te hanteer. Deeglike dekking van die basiese idees met betrekking tot eenhede en afmetings, die SI-stelsel, akkuraatheid, akkuraatheid en onsekerheid in metings, betekenisvolle syfers en afronding, behandeling van ewekansige en sistematiese foute, standaardafwyking. (S. Lower, Simon Fraser U.)

Eenhede en omskakelingsfaktore - sien onder

Balansering van chemiese vergelykings - 1270 reaksies, georganiseer in maklike, intermediêre en "uitdagende".

Sure en basisse

Alles oor sure en basisse - hierdie stel van sewe lesse dek alles wat jy moet weet oor die fundamentele konsepte (Arrhenius, Brønsted-Lowry, en Lewis) van sure en basisse. Ander lesse dek 'n elementêre behandeling van pH en titrasie, hoe om suur en basiese stowwe uit hul strukture te herken, en 'n galery van sure en basisse wat algemeen voorkom. Afgesien van die materiaal oor pH, is daar geen wiskunde in hierdie lesstel nie suur-basis ewewig berekeninge word nie hier gedek nie.

Suur-basis sonder algebra 'n Eenvoudige grafiese metode om pH-probleme op te los wat net so goeie antwoorde gee as algebraïese oplossings en 'n globale siening bied van watter spesies betekenisvol is by enige pH. Veral nuttig vir poliprotiese stelsels wat andersins oplossing van baie gelyktydige vergelykings sou vereis.

Suur-basis handleiding (PDF-formaat Dan Dill, Boston U) - hierdie uitstekende tutoriaal dek al die hoofonderwerpe wat algemeen op die algemene chemievlak teëgekom word, met 'n buitengewone deeglike behandeling van bufferstelsels.

ChemBuddy pH Berekening tutoriale - 'n uitgebreide stel aanlyn tutoriale wat die meeste aspekte van suur-basis berekeninge dek. 'n Goeie versameling titrasie- en ander plotte.

Suur- en basistutoriaal (U van Brits-Columbië) - Nog 'n mooi georganiseerde stel lesse, wat elk bestaan ​​uit 'n goed uitgevoerde tutoriaal, plus 'n veelkeusevasvra.

Die val van die proton: Sal hierdie suur met daardie basis reageer? Hoe om te verstaan suur-basis reaksies (Hierdie eenvoudige siening van moderne suur-basis-teorie dateer uit 1954, maar het dit steeds nie in die standaardhandboeke gemaak nie.

Suur-basis hersiening (UNC-Chapel Hill) bied 'n kompakte behandeling van die grondbeginsels van suur-basis-berekeninge.

Suur-basis titrasie simulator - hierdie maklik-om-te gebruik bladsy laat jou toe om 'n groot verskeidenheid suur-basis-stelsels te verken, insluitend poliprotiese. Daar is ook die keuse om "eerstejaar" of massaladingbalansmetodes te gebruik.

Atoomteorie

Atome en die periodieke tabel - 'n ses hoofstukke eerstejaarsvlakbehandeling van basiese kwantumteorie, atoomspektra, elektronkonfigurasies, chemiese periodisiteit en die organisasie van die periodieke tabel. Deel van S.K. Laer s'n Algemene Chemie Virtuele Handboek.

Basiese atome: atome, elemente en isotope - 'n inleidende behandeling vir beginstudente, geskik vir die baie vroeë deel van 'n algemene chemiekursus. (SK Lower, Simon Fraser Universiteit)

Inleiding tot die elektroniese struktuur van atome en molekules - 'n goed georganiseerde reeks bladsye wat strek tot chemiese binding. (Alfred Bader, McMaster U)

Primer aan Kwantumteorie van die atoom - 'n Stel gereelde vrae in die vorm van 'n kwantumkategismus.

Atoomorbitale visualisering - sien die Die Orbitron: 'n galery van orbitale -- en ook die verwysings op ons visualiseringsbladsy.

Inleiding tot Atome - 'n Bondige uiteensetting van die beginsels (insluitend elementêre kwantumteorie) met 'n paar interessante kinkels. John Denker

Die raaisel van materie: Soek na die elemente - Hierdie PBS video " is 'n opwindende reeks uit drie dele oor een van die groot avonture in die geskiedenis van die wetenskap: die lang en voortdurende soeke om te verstaan ​​waaruit die wêreld bestaan. Drie uur lange episodes vertel die verhaal van sewe van die geskiedenis se belangrikste wetenskaplikes terwyl hulle poog om die basiese boustene van materie te identifiseer, te verstaan ​​en te organiseer."

Jag op die elemente - 'n Twee0uur PBS/NOVA-video. "Waar kom die natuur se boustene, wat die elemente genoem word, vandaan? Hulle is die verborge bestanddele van alles in ons wêreld, van die koolstof in ons liggame tot die metale in ons slimfone. Om hul geheime te ontsluit, draai David Pogue, tegnologie-rubriekskrywer en lewendige gasheer van NOVA se gewilde "Making Stuff"-reeks, kykers deur die wêreld van vreemde, ekstreme chemie: die sterkste sure, die dodelikste gifstowwe, die heelal se volopste elemente, en die skaarsste van die skaars—stowwe gekook in atoombrekers wat vir slegs breukdele van 'n sekonde tot stand kom." Let wel: hierdie video is nie in Kanada (en moontlik in ander lande) sigbaar nie as gevolg van dom " regte" kwessies.

Chemiese binding

Alles oor chemiese binding (Steve Lower, SFU) - hierdie 10-delige webwerf bied 'n diepgaande dekking van alles wat jy moet weet oor molekulêre struktuur en binding op die Algemene Chemie-vlak. Sluit afsonderlike afdelings oor polêre kovalensie, VESPR, hibriede orbitale, molekulêre orbitale, koördinasiekomplekse en metale in.

Chemiese binding - die werklik basiese goed! (S. Lower, Simon Fraser U.)

Modelle van chemiese binding - Bestaan ​​chemiese bindings werklik? Niemand het nog ooit een " gesien" nie, so die beste wat ons kan doen is om modelle te bou. Hier is 'n kort opsomming van diegene waarvan jy behoort te weet.

Kovalent, ionies, of wat? Ooreenkom met kovalente, ioniese en metaalbinding, en met mengsels daarvan. Gewaarborg om jou meer insig hieroor te gee as wat jou handboek doen!

Die elektron-tonnelmodel van chemiese binding Hoe kan daardie elektronpuntdiagramme wat gedeelde elektrone wys wat gelukkig sit tussen die kerne ooreenstem met die beginsel dat teenoorgestelde ladings aantrek? Die model wat hier beskryf word, is die eenvoudigste een wat regtig verduidelik binding, maar dit is onwaarskynlik dat jy dit in enige handboek sal vind!

VSEPR teorie - Hierdie opsomming met maklike toegang tot baie beelde is 'n hiperteks weergawe van die hoofstuk oor hierdie onderwerp uit 'n handboek deur Mark Winnter (U Sheffield).

VSEPR vir Algemene Chemie - Hierdie Purdue Universiteit webwerf bevat 'n nuttige stel praktykprobleme en vereis die aflaaibare CHIME-inprop.

Elektrochemie

Gasse

Eienskappe van gasse: materie op sy eenvoudigste - 'n sesdelige "virtuele handboek" behandeling van die gasvormige toestand van materie deur Steve Lower. Sluit talle voorbeelde van toepassing van kinetiese molekulêre teorie en 'n afdeling oor werklike gasse in. (Deel van die Chem1 virtuele handboek)

Intermolekulêre kragte

Interaksies tussen molekulêre eenhede - hierdie tutoriaal vir eerstejaarstudente kyk na ioniese, van der Waals-aantreklikhede en die universele afstootkrag, en hoe dit lei tot potensiële energiekrommes. (Deel van die Chem1 virtuele handboek)

Kinetika

Chemiese Kinetika en Dinamika - 'n Inleiding tot reaksietempo's, tempowette, halfleeftyd, aktiveringsenergie, die Arrhenius-vergelyking en reaksiemeganismes. (Chem1 virtuele handboek)

Chung Chieh s'n by U van Waterloo (Kanada) sluit toetsvrae met antwoorde in. (≤ 2010)

Kinetics Explorer - 'n inleiding tot die studie van chemiese kinetika gebaseer op die verkenning van dinamiese verskynsels. Sluit 'n paar goeie simulasies in. (St. Olaf Kollege)

Mol, formules en reaksieberekeninge

Balansering van chemiese vergelykings - hierdie ChemTeam-werf verskaf talle skakels en oefeninge.

Oksidasie-Reduksie

Die val van die elektron. Hoe om die rigting van oksidasie-reduksie-reaksies te voorspel. Bespreking van die aktiwiteitsreeks van die elemente en van oksidasie-vermindering in metabolisme. (S.K. Lower, SFU)

Redoksreaksies (UNC-Chapel Hill) Goeie opsomming van hoe om redoksreaksies te balanseer dek ook selpotensiale en Faraday se wette.

Kernchemie

Die deeltjie-avontuur: die grondbeginsels van materie en krag. Hierdie Lawrence Berkeley Nasionale Laboratorium-webwerf laat jou toe om die wêreld van fundamentele deeltjies en kragte te verken en dan die eksperimentele bewyse en tegnieke te ondersoek.

Marie Curie en die Radium-rage - ('n PBS-video) " Na Marie en Pierre Curie se ontdekking van radium, het die nuwe element se wonderlike vermoë om in die donker te gloei 'n wêreldwye gier geïnspireer - 'n stormloop van radium-geveerde produkte wat beloof het om alles van impotensie tot haarverlies te genees. Wat min mense besef het - en die Curies was huiwerig om te erken - was die groot skade wat hierdie radioaktiewe element kan aanrig."

Periodieke Tabelle

Vir periodieke tabel T-hemde, dasse, ens., sien hier

> - 'n groot maar goed georganiseerde lys van elke moontlike soort periodieke tabel waaraan jy kan dink, sowel as speletjies, sagteware, ens. (&le 10/2006)

Visual Key en Quantum Fold periodieke tabel - Hierdie verbeterde periodieke tabel deur Dr Eric Scerri, skrywer van Die periodieke tabel: sy verhaal en sy betekenis, maak accoriation-wise oop " om verborge patrone te wys wat nie in handboeke en muurkaarte gesien kan word nie." Dit kan vir US$10 vanaf hierdie webwerf gekoop word.

Die periodieke tabel van video's - Dit is nie net nog 'n periodieke tabel nie, maar 'n groot hulpbron wat uitgebrei het om meer as 500 video's in te sluit, meestal redelik kort. Op sy eenvoudigste klik jy net op 'n element en kyk na 'n video van twee minute wat die element en sy gebruike beskryf. Daar is ook 'n groter reeks "Molekulêre Video's" wat verskillende chemiese stowwe en hul gebruike beskryf - alles ontwerp om die fassinasie van Chemie oor te dra. Die meeste van hierdie video's vertolk die skilderagtige Sir Martyn Poliakoff, 'n professor in Chemie aan die Universiteit van Nottingham in die VK, waar hierdie projek gebaseer is.

Chinese periodieke tabelle - Ja, daar is sulke dinge! , en sien hierdie Wikipedia-artikel wat 'n paar voorbeelde het.

Stripboek periodieke tabel - as beide strokiesprente en chemie belangrik is in jou lewe, sal jy mal daaroor wees!

Die fotografiese periodieke tabel van die elemente - die tuisblad bevat foto's van (of verwant aan) die elemente, maar dit bevat " baie duisende bladsye van teks, stories, prente en data" deur Theodore Gray.

Dit is Elementeel - dit is nie soseer 'n periodieke tabel nie, maar 'n reeks skakels na uitstekende en interessante artikels wat fokus op die geskiedenis en gebruike van elke element, geskryf deur skrywers met spesiale kundigheid of belangstelling in die element. Geskryf in 'n styl wat meer joernalistiek as wetenskaplik is, het hierdie stel artikels verskyn in 'n spesiale 80 ste herdenking uitgawe van Chemiese & Ingenieurswese Nuus.

iPod periodieke tabel - wel, dit is nie regtig die hele tafel nie, maar net 'n handige elementdatabasis om saam met jou musiek te stoor.

Periodieke Tabel mnemoniese lied -

Periodieke Tabel van Poësie "Chemie en poësie saam soos nog nooit tevore nie."

Elemtimologie & Elemente Multidict - Wat noem hulle die element strontium in Georgië (die land, nie die staat nie!)? Antwoord: სტორცინიუმი. As juwele soos hierdie jou fassineer, kyk gerus na hierdie webwerf, wat alles oor die oorsprong van die elementname gaan, nie net in Engels nie, maar in 97 verskillende tale.

Periodieke Tabel van Haiku - vir diegene wat elemente liries vind.

Webelemente (Sheffield, VK) Die elemente in hierdie aanlyn periodieke tabel is gekoppel aan 'n uitgebreide verskeidenheid chemiese en fisiese data sowel as agtergrond, kristallografiese, kern-, elektroniese, biologiese en geologiese inligting. Jy kan ooit hoor hoe die Britte die naam van die element uitspreek!

Beduidende syfers

> Beduidende syfers en afronding: Hoe om leuens met getalle te vermy. Verskaf 'n verstaanbare, in-diepte verduideliking met baie voorbeelde. Verskaf 'n verstaanbare, in-diepte verduideliking met baie voorbeelde. (S.K. Lower, Chem1 virtuele handboek)

Vaste stowwe en materiale

Verken die Nanowêreld - Hierdie wonderlike webwerf word onderhou deur die NSF-gefinansierde Interdissiplinêre Onderwysgroep by U Wisc-Madison. Dit gebruik voorbeelde van nanotegnologie en gevorderde materiaal om wetenskap- en ingenieurskonsepte hoofsaaklik op kollegevlak te verken, maar daar is ook afdelings vir K-12. Daar is skakels na flieks, laboratoriumeksperimente, kits (insluitend Lego-nanostene) en onderrigmateriaal.

Ioniese en ioon-afgeleide vaste stowwe - 'n gedetailleerde blik op alkalihalied-energetika en strukture, en uitgebreide strukture. (Deel van die Chem1 virtuele handboek)

Inleiding tot kristalle - hoe die eksterne vorme van kristalle verband hou met hul interne strukture. Dek die empiriese wette van kristalle, roosters en eenheidselle, Miller-indekse en faktore wat groeigewoontes beïnvloed. (Deel van die Chem1 virtuele handboek)

Kubieke kristalroosters en nou verpakking - die oorsprong van langafstand-orde in vaste stowwe. Gesiggesentreerde en liggaamsgesentreerde strukture. (Deel van die Chem1 virtuele handboek)

Verkenning van materiaalingenieurswese - skakels na 'n verskeidenheid webwerwe wat verband hou met materiaal en polimeerwetenskap.

BuckyBalls (Buckminsterfullerenes, daardie sokkerbalagtige koolstofstrukture). Hierdie Nanotegnologie nou webwerf het 'n goeie oorsig van nanobuise en Buckyballs en baie skakels.

Polimere. Die uitstaande terrein Makrogalleria dek die strukture en eienskappe van polimere op 'n ongewoon innemende manier. Sterk aanbeveel.

Termodinamika

Chemiese energie: alles oor entalpie, termochemie en die Eerste Wet van termodinamika - 'n Uitgebreide, diepgaande maar grootliks nie-wiskundige plaasvervanger vir die gewone (en taamlik dun) handboekbehandeling. S.K. Lower, Simon Fraser Universiteit

Termodinamika van ewewig: alles oor entropie, vrye energie, die Tweede Wet van termodinamika, en hoekom reaksies soms plaasvind—. S.K. Lower, Simon Fraser Universiteit.

<Die bladsy van EntRopY> - 'n baie verstaanbare uiteensetting van hierdie moeilike onderwerp deur Dave Slaven van Saginaw Valley State U.

Die Tweede Wet: Die grootste, kragtigste, mees algemene idee in die hele wetenskap. 'n Lewendige, nie-wiskundige uiteensetting van die manier waarop entropie en aktiveringsenergie dit uitveg in die wêreld soos ons dit ken. Deur Frank Lambert van Occidental College. 'n Alternatiewe weergawe, gerig aan nie-wetenskapstudente en volwassenes, is ook beskikbaar. Sien ook Lambert se nie-tegniese beskrywing van hoe aktiveringsenergieë die toepassing van die Tweede Wet verander. Sien ook Shakespeare en Termodinamika: Dam die Tweede Wet, en Entropie is eenvoudig. As ons die bruinvlekke vermy!.

Die Tweede Wet van Termodinamika, Evolusie en Waarskynlikheid. Verduidelik hoe die ontwikkeling en evolusie van lewe ooreenstem met die beginsel dat die entropie van die wêreld nooit afneem nie.

Kelvin is Here!! Almal prys Lord Kelvin! 'n Spoof-kultusterrein vir die termodinamies geneig.

Eenhede en omskakelingsfaktore

Eenhede en afmetings vir chemie - sluit kaarte in wat die reekse van die skale soos lengte, massa, temperatuur, ens. toon wat belangrik is in chemie.

Eenhede, mate en omskakelings inligting kan by 'n aantal bronne gevind word:

  • Wikipedia se Tabel van Omskakelingsfaktore is goed vir diegene wat vasgevang is in die moeras van Amerikaanse nie-SI-eenhede - 'n goeie handleiding oor hoe om die wiskunde van eenheidomskakelings te doen
  • Hierdie Numericana-bladsy het 'n eklektiese versameling eenhede, insluitend 'n paar nogal ongewone.
  • Vir diegene wat belangstel in die geheimsinnige: Verouderde en ou meeteenhede

101 Vrae en antwoorde - Jy sal seker 'n paar interessante vrae hier vind wat jy nooit daaraan gedink het om te vra nie!

Hoe los ek dit op? Hierdie uitstekende bladsy van Purdue U. bevat skakels na gidse vir die oplossing van baie van die tipiese kwantitatiewe probleme wat in Algemene Chemie teëgekom word.

Vra maar vir Antoine - As jou instrukteur nie die antwoord het nie, probeer hier! Onder leiding van Fred Senese van Frostberg Staatsuniversiteit (MD) as deel van "Project Antoine".

Newton: Vra 'n wetenskaplike - 'n aanlyn gemeenskap vir wetenskap, wiskunde en rekenaarwetenskap onderwysers en studente. NEWTON word deur Argonne Nasionale Laboratorium bedryf.

AP Chemie Praktyktoetse - 'n Groot versameling gratis oefentoetse wat baie onderwerpe op AP-vlak dek.

Die Chemistry Cluster is 'n Yahoo-groep waar jy vrae kan vra (of beantwoord!).

Chemiese Forums vir studente in Chemie - 'n plek waar jy vrae en antwoorde kan plaas. Daar is aparte forums vir hoërskoolchemie, kollege algemene chemie, organiese, analitiese, fisiese kern- en anorganiese chemie, en chemiese biologie, sowel as ander van meer algemene belang. Registrasie is nodig, maar dit is gratis.

ChemiCool-forums is nog 'n webwerf waarop jy vrae en antwoorde kan plaas wat verband hou met Algemene Chemie en biochemie sowel as organiese, teoretiese en rekenaarchemie.

Cramster is nog 'n bord vir "chemiehulp" met oefeneksamens, handboekuittreksels en vrae wat deur die gebruiker geplaas is.

breinchemie - nog 'n webwerf vir chemie vrae en antwoorde

Chemie tutors te huur - Jy kan hierdie WyzAnt-werf gebruik om plaaslike tutors te soek, profiele en kwalifikasies te hersien, agtergrondondersoeke uit te voer en vir tuislesse te reël.

Atoomgewigte van tien chemiese elemente op die punt om te verander - en jy het gedink dat atoomgewigte vir ewig is? Sien hierdie Desember 2010 nuusvrystelling van die US Geological Survey!

Chemie van skoonmaak - 'n mooi oorsig van die aard van "vuil" en die agente wat gebruik word om daarvan ontslae te raak. Nog 'n nuttige bron: die York U. (VK) bladsy Hoe werk skoonmaakmiddels?" bevat 'n paar eenvoudige eksperimente oor seepborrels en oppervlakspanning. Chemie agter skoonmaak bevat baie nuttige skakels na ander webwerwe.

Gids vir vlekverwydering - Hoe om omtrent elke soort vlek waaraan jy kan dink te verwyder.

Wetenskap van kook - 'n Goed ontwerpte webwerf van die Exploratorium-wetenskapmuseum in San Francisco. Skakels na onderwerpe van brood tot piekels help om begrip van die wetenskap agter kos en kook te verbeter.

Voedselwetenskapvideo's - goeie versameling video's

- Hierdie webwerf van die Oostenrykse Museum beskryf die natuurlike chemiese en biologiese prosesse wat uiteindelik met ons almal sal gebeur. [Hierdie webwerf is in 2008 dood, skakel is na die nuutste argiefweergawe]

Die chemie van eierwitte - 'n buitengewoon goed gedoende behandeling van hierdie onderwerp.

Hoe om 'n eier te kook - alles oor eiers en die wetenskap om dit hard te kook deur Charles Williams (U Exeter, VK)

Struktuur van roomys - alles oor die chemie en fisika van jou gunsteling lekkerny van die Suiwelwetenskap Fakulteit van die Universiteit van Guelph (Ontario, Kanada)

Gids vir vlekverwydering - hier is iets om jou ouers jou as 'n Chemie-kenner te laat beskou!

> Skunk Spray Chemie - waaroor is die groot stink? Wat is in skunk spray, en wat kan jy daaromtrent doen? Hierdie bladsy deur W.FD. Wood van Humboldt State U (CA) vertel alles.

Hoekom het my vel groen geword? Hoe om te keer dat juweliersware jou vel verkleur.

Hoekom laat die eet van aspersies jou piepie snaaks ruik? - Beïndruk jou vriende met jou begrip van hul verleentheid geheime! Vir inligting oor ander walglike liggaamsvloeistowwe en reuke, kyk na die Grossology-webwerf.

Hoekom is dinge gekleur?

Hoekom is die lug blou? Vereenvoudigde verduideliking - Meer volledige verduideliking wat Rayleigh-verstrooiing beskryf.

Wetenskapkennisvasvra - " Toets jou kennis van wetenskaplike feite en toepassings van wetenskaplike beginsels deur ons kort 12-vrae vasvra te neem. Kyk dan hoe jy gevaar het in vergelyking met 'n nasionaal verteenwoordigende groep van 3 278 lukraak geselekteerde Amerikaanse volwassenes wat tussen 11 Augustus en 3 September 2014 aanlyn en per pos ondervra is as lede van die Pew Research Center&rsquos American Trends Panel."

Chemie verduidelik: Grondslae en toepassings - Met die eerste oogopslag blyk hierdie webwerf net 'n AZ-indeks te wees vir 'n reeks kort definisies van die vele onderwerpe wat dit dek, maar deur op die naam van die onderwerp self te klik, word 'n redelik gedetailleerde (maar anoniem saamgestelde) beskrywing of uiteensetting van die onderwerp.

> <Die A tot E-benadering tot probleemoplossing in Chemie> deur David Woodcock. 'n Reeks handstukke in webbladformaat wat beskryf hoe om Algemene Chemie-probleme te benader. (Die oorspronklike webwerf is lankal weg, maar hierdie argiefadvies is steeds die moeite werd om te weet!)

> Blog van die Periodieke Tabel - "a reeks van 28 "Wilde, vreemde, wonderlike stories oor die elemente waaruit ons heelal bestaan" deur Sam Kean. Hierdie reeks het middel 2010 in Slate verskyn.

Waarvoor is chemie goed? ('n Lekker repliek vir diegene wat chemie daarvan beskuldig dat hulle die wêreld besoedel.)

Elementêre ontdekkings 'n Weeklikse tydskrif met chemie-onderwerpe en resensies.

Emulsies en kook - Hierdie Wetenskap in die kombuis bladsy bespreek die rol van emulsies in melk, slaaisouse, botter en grondboontjiebotter.

Hoe brood werk - Jy eet seker elke dag brood. Jy kan selfs weet hoe om jou eie brood te maak. Maar het jy al ooit aan brood gedink as 'ntegnologie?

Menslike termodinamika - hierdie taamlik ver-uit webwerf poog blykbaar om chemiese affiniteit met menslike interaksies in verband te bring.

Die chemie van hout - 'n 6-minute video van Glasgow Universiteit oor hierdie alomteenwoordige stof.

Meet-omskakelaar - omskakelingsfaktore tussen SI- en cgs-eenhede van alle soorte, georganiseer volgens kategorie en naam van eenheid. OnlineConversion.com is 'n soortgelyke webwerf.

Minerale Galery - N goeie minerologie webwerf met inligting en uitstekende foto's van 'n groot aantal minerale wat beide volgens naam en volgens klassifikasie georganiseer is.

Wat is pseudowetenskap? Alles oor pseudowetenskap, slegte wetenskap en patologiese wetenskap. Hoe om die verskil van wetenskap te onderskei. As jy in wetenskap belangstel, behoort jy iets te weet van die snert wat in die naam van die wetenskap gegesel word. (S.K. Lower, Simon Fraser Universiteit)

Water na wyn: Die molekulêre basis van aanwyserkleurveranderinge. 'n Baie goed gedoen webwerf met interessante grafika en baie kruisskakels. Baie leesbaar en interessant, op die "Scientific American"-vlak en geskik vir hoërskool- en inleidende kollege-kursusse.

Kookwater sonder borrels - 'n interessante artikel oor die nanopartikels en die Leidenfrost-effek.

John Oliver oor " wetenskaplike studies" en hul verslagdoening - A Verlede week vanaand YouTube-video oor hoe en hoekom mediagroepe so dikwels onwaar of onvolledige inligting as wetenskap rapporteer.

Chemie Trivia Vasvrae - hierdie webwerf bied toegang tot 'n verskeidenheid vasvrae uit verskillende bronne.

Chemie humor

Chemie Joke-a-rama - gewaarborg deur die American Chemical Society om jou te laat lag.

Molekules met simpel of ongewone (of suggestiewe) name - 'n Amusante en insiggewende webwerf deur Paul May van Bristol U (VK) wat waarskynlik spesiale aantrekkingskrag vir tienermans van alle ouderdomme sal hê.

Wetenskap humor WebRing - sommige daarvan is redelik oulik.

"Verbied DHMO" (diwaterstofmonoksied) bladsy. Dit kan jou doodmaak! Alles oor hierdie onheilspellende chemikalie in ons omgewing.

Wetenskappe gevaar! Speletjies - hierdie U Pittsburgh-webwerf dek algemene, organiese, analitiese en biochemie.

Chemie-verwante klere en bykomstighede

Wys die wêreld dat chemie vir jou saak maak! Hier is 'n paar Amerikaanse verskaffers van periodieke tabel T-hemde en ander goeie gesprek-aanvangers.

Cotton Expressions bied 'n paar mooi chemie, biologie en geologie T-hemde.

Gemaak-met-molekules Hierdie wetenskaplike wat kunstenaar geword het met 'n fassinasie vir molekules bied silwer juweliersware, sleutelhouers, babageskenke, vakansiekaartjies en, vir die ouens, testosteroon-bokserbroeke.

Die Atoom Dashboard - is 'n interaktiewe chemiehulpbron en leerinstrument wat deur Bitwixt Software Systems vir die Mac ontwikkel is. Gebruik deur opvoeders, studente, wetenskaplikes en die eenvoudig nuuskieriges. Met sy 3D-molekulebiblioteek, en sy 3D-modelle van atoomorbitale, molekules, verbindings, gasse en kristalle, help The Atomic Dashboard jou om die verwantskappe tussen die gedrag van atome en molekules en hul 3D-struktuur te verken. Mac App Store, $15.

CurTiPot - Gratisware vir pH en suur-basis ewewig berekeninge en vir simulasie en
analise van Potentiometries Titrasie Curves

Intelli Balanser - hierdie aflaaibare, slegs Windows-program sal byna enige chemiese vergelyking vir jou balanseer.

Die Atomic Mac is 'n deelware periodieke tabel-georiënteerde databasis insluitend isotopiese en kerndata) oor die elemente. Sluit ook 'n molekulêre gewig sakrekenaar in.

Atoom-in-'n-boks is 'n Macintosh-deelware-toepassing wat atoomorbitale intyds vertoon.

3D Chemical Elements Screensaver is ook 'n interaktiewe periodieke tabel en 3D-atoommodelleringsprogram. $20 en slegs vir Windows.

Linux4 Chemie bladsy bevat 'n aantal Chemie-toepassings, insluitend open source, freeware en shareware

Chem1 Konsepbouer vir Algemene Chemie - nou gratis!
Hierdie stel lesse wat geleide, interaktiewe onderrig in Algemene Chemie by die kollege en gevorderde hoërskoolvlakke bied. Hierdie materiaal is geskik vir tuisstudie of as 'n aanvulling tot 'n formele kursus. Alle lesse begin op 'n baie elementêre vlak, en baie van hulle gaan ietwat verder as die inhoud van die standaard eerstejaarkursus, wat dit nuttig maak vir studente wat ingeskryf is vir analitiese chemie-, biochemie- en omgewingschemiekursusse. Windows 3.1 tot XP.

ChemBuddy pH Sakrekenaar bereken die pH van enige mengsel van sterk/swak/poliprotiese sure en basisse, met of sonder ioniese sterkte of aktiwiteitskorreksies, en kan titrasiekurwes teken. Dit bevat ook 'n uitgebreide databasis van suur/basisdata.

Chemie struktuur-tekening sagteware

Symyx Teken is 'n gratis Windows-alleen-toepassing wat jy dit kan gebruik om chemiese strukture te teken en dit uit te voer om as 3D-modelle te kyk. Symyx Draw is 'n opvolger van Isis/Draw wat nie meer beskikbaar is nie.

ACD/ChemSketch is 'n gratis-vir-nie-kommersiële-gebruik-toepassing vir Windows of Linux wat 3D-optimering, besigtiging en rotasie, sny en plak in ander toepassings, en tautomer-voorspelling bied.

> ChemDraw "is die bedryfstandaardsagteware wat deur wetenskaplikes wêreldwyd gebruik word om akkurate, chemies-bewuste strukture te teken vir gebruik in databasisnavrae, voorbereiding van publikasiekwaliteit-grafika, en inskrywing vir modellering en ander programme wat 'n elektroniese beskrywing van molekules en reaksies vereis." Weergawes is beskikbaar vir beide Windows en Mac-OS, en 'n groot afslag is beskikbaar vir studente.

EasyChem is 'n gratis multi-platform GPL-program wat publikasie-gehalte strukture teken.file:///Users/slower/Web/ChemEd/genchem.shtml

iMol is 'n gratis molekulêre visualisering aansoek vir Mac OS X bedryfstelsels. iMol ondersteun verskeie lêerformate. Dit kan maklik klein en groot molekules hanteer, laai veelvuldige molekules, kan hulle onafhanklik beweeg en roteer, of vertoon 'n molekulêre dinamika-baan.

Bronne van gratis molekulêre modellering sagteware is gelys by die MathMol webwerf -

Gratis sagteware van die Journal of Chemical Education se JCE Software-reeks is nou beskikbaar. Die vangplek: dit is pre-Windows (DOS), maar sommige daarvan is redelik goed.

Trinity sagteware bied studenteafslag op al sy produkte wat 'n aantal titels in Algemene Chemie insluit.

Nutsakrekenaars vir Chemie

Studente: jy sal wys wees om te vermy om afhanklik te wees van hierdie nutsprogramme vir roetine in die begin van kursusse, jy het regtig die oefening nodig om hierdie probleme vir jouself uit te werk!

MoleCalc is 'n gratis molekulêre gewig sakrekenaar Slegs Windows-hulpmiddel deur Davd Defoort. Jy tik die formule in en dit gee die molekulêre gewig terug.

Gratis molekulêre gewig sakrekenaars deur Matthew Monroe (slegs Windows)

Aanlyn Molekulêre gewig sakrekenaar van Lenntech

MW sakrekenaars vir Macintosh OS X: Digitale Wetenskap (sluit ingeboude periodieke tabelverwysing in) - Struktureel

iPhone/iPod MW sakrekenaar: Invitrogen Science Sakrekenaar - Aanlyn formule en molêre massa sakrekenaar - LabCalPlus vir die iPad

Aanlyn oplossing sakrekenaars: massa om oplossing van gegewe volume en molariteit op te maak, verdun 'n voorraadoplossing tot gegewe volume en molariteit

CurTiPot suur-basis sagteware - Alles-in-een freeware vir pH en suur-basis ewewig berekeninge en vir simulasie en ontleding van potensiometriese titrasie kurwes.

Model ChemLab is 'n real-time 2-D simulasie van 'n chemie laboratorium waarin die gebruiker interaksie het met geanimeerde laboratorium toerusting in 'n groot aantal eksperiment modules (sien lys.) 'n Goedkoop weergawe is beskikbaar vir ongeveer $25. Macintosh en Windows Gratis demo beskikbaar deur af te laai.

> MoluCAD is 'n volledige molekulêre modellering- en visualiseringsinstrument wat ontwerp is vir persoonlike rekenaarplatforms. Dit is ontwikkel met NSF-ondersteuning en is beskikbaar vir studente teen 'n baie lae prys. Beide Macintosh- en Windows-weergawes kan afgelaai word. Die nuutste weergawe bevat baie gevorderde kenmerke wat slegs in duur werkstasie-gebaseerde modelleringspakkette gevind word. Beginnergebruikers kan vinnig modelle genereer, dit vanuit enige perspektief bekyk, reaksie-animasies skep en alle data op skyf stoor.

Slegs vir Chem-junkies! Die Chemiese Tesourus is 'n groot (200 Mb) versameling inligting oor chemiese reaksies, faseveranderinge en radiochemie wat in 'n relasionele databasis georganiseer is. Dit is gratis vir persoonlike gebruik en beskikbaar in beide Windows- en Macintosh-weergawes.

Vergelyking- en funksieplot sagteware

Sien die lys wat deur Wikipedia saamgestel is

Sommige webgebaseerde aanlynfunksie-plotnutsmiddels is QuiSoft, FooPlot en Zorn's Online Function Grapher.

&kopie 2004-2017 deur Stephen Lower - laas gewysig 2019-08-08

Hierdie werk is gelisensieer onder 'n Creative Commons Attribution 3.0 Unported License


Resensies

Beoordeel deur Steve Acquah, Mede-navorsingsprofessor, Universiteit van Massachusetts Amherst op 26/6/21

Dit is baie omvattend as 'n algemene chemie-handboek, met meer inligting aangebied as wat tipies vereis word. Hierdie hulpbron kan aangepas word om studente van verskeie hoofvakke te ondersteun. Alhoewel die onderwerp relevant is en. lees meer

Beoordeel deur Steve Acquah, Mede-navorsingsprofessor, Universiteit van Massachusetts Amherst op 26/6/21

Omvattendheidsgradering: 4 sien minder

Dit is baie omvattend as 'n algemene chemie-handboek, met meer inligting aangebied as wat tipies vereis word. Hierdie hulpbron kan aangepas word om studente van verskeie hoofvakke te ondersteun. Alhoewel die onderwerp relevant en konsekwent is in vergelyking met ander handboeke, moet beide die aanlyn weergawe en die PDF 'n groot opdatering van die formatering kry om voordeel te trek uit ontwikkelende leerstyle en die behoefte aan kwaliteit leerhulpbronne soos ons uit die pandemie kom. . Die aanvaarding van afstandsonderrigtegnologieë tydens die pandemie het die behoefte aan ooptoegangshulpbronne vir onderrig beklemtoon, en hierdie handboek kon 'n kritieke hulpmiddel vir onderrig gewees het. Ek hou van die byvoeging van die leerdoelwitte wat help om 'n duidelike fokus vir die hoofstukke te behou, en oorvleuelende temas help om die konsepte te verbind, wat 'n noodsaaklike deel van leer is. Verbeterings aan die navigasie van die handboek is steeds nodig om studente en fakulteit te help, maar as 'n vrylik beskikbare onderrighulpbron is daar baie potensiaal.

Inhoud Akkuraatheid gradering: 5

Dit lyk asof die inhoud geen foute het nie, behalwe vir die ontbrekende beelde wat in hierdie resensie gelys word.

Relevansie/Langlewendheid-gradering: 4

Die boek is steeds relevant aangesien dit op die onderliggende beginsels van chemie gebaseer is. Die handboek baat daarby om meer inligting te hê as wat tipies vereis word, wat 'n modulêre benadering vir onderrig verder ondersteun.

Die PDF en die aanlyn weergawe van die handboek is duidelik om te lees. Studente kan deur die hoofstukke werk, maar bykomende wysigings aan die formaat van sommige vrae sal nuttig wees om hulle te lei.

Baie beelde het nie figuurnommers toegeken nie, wat die konsekwentheid deur die handboek beïnvloed. Hierdie probleem kan in toekomstige hersienings reggestel word terwyl die ontbrekende beeldplekhouers herstel word.

Die handboek hoofstukke is modulêr in ontwerp, maar daar is steeds probleme met die navigasie as gevolg van die ontbrekende inhoudsopgawe in die PDF. Dosente sal addisionele voorbereidingstyd benodig om 'n modulêre benadering tot die handboek te integreer.

Organisasie/Struktuur/Vloeigradering: 4

Die organisasie van die handboek is oor die algemeen goed en bied baie verskillende maniere om die inhoud vir lesings en onderrigmediabronne aan te pas. Hoofstuk 7 het 'n goeie afdeling oor die allotrope van koolstof wat ek kan aanpas vir kort virtuele aanbiedings.

Die PDF-weergawe benodig aansienlike werk om die koppelvlak te verbeter, aangesien die opskrif aan die einde van 'n bladsy kan verskyn in plaas van aangepas na 'n nuwe bladsy vir estetika. (Sien bladsye 61, 62 en 87 vir voorbeelde) Die beeld vir Figuur 2.2 op bladsy 97 is nie in die korrekte verhouding nie. Die aanlyn weergawe het baie syfers wat permanent onbeskikbaar is. Hierdie is 'n omvattende lys van die vermiste beelde: Figure 1.6, 1.7, 1.8, 1.9, 1.16, 2.9, die beeld aan die begin van hoofstuk 3, 3.1, 3.7, 3.9, die beeld in voorbeeld 13, die beeld in voorbeeld 15, die beeld aan die begin van hoofstuk 4, 4.4, die beeld in voorbeeld 8, die beeld in voorbeeld 11, (geen figuurnommer - Verdonkering van silwerbromiedkristalle deur blootstelling aan lig), 4.14, 4.16, 4.21, 4.23, 4.24, 5.12 , die beeld aan die begin van hoofstuk 6, 6.9, 6.13, (geen syfernommer - Kalium verbrand), die beeld aan die begin van hoofstuk 8, 9.27, 10.15, 10.16, 11.1, 11.10, 13.5, 13.8, 14.22, . 14.2, 14.3, 14.4, 15.1, 15.12, 15.13, die beeld aan die begin van hoofstuk 16, 16.22, 16.25, 17.4, 17.9, 17.11, 18.6, 18.7, 19. sel 19. , 21.11, 22.14, 23.4 en 23.5.

Gradering van grammatikale foute: 4

Die grammatikale foute wat ek gevind het, was gekoppel aan die formatering, waarskynlik met die omskakeling na PDF. Oor die algemeen is daar geen ander grammatikale foute wat ek opgemerk het nie.

Kulturele relevansie-gradering: 4

Daar is geen spesifieke kulturele verwysings nie. Dit sal baat by die insluiting van moontlike streeksverskille in die manier waarop vakonderwerpe as voetnote onderrig kan word.

Dit is duidelik dat baie tyd en moeite in hierdie handboek geplaas is wat 'n omvattende siening van chemie bied. Met verloop van tyd blyk dit dat die aanlyn weergawe die skakels na baie van die syfers verloor het, en dit sal in toekomstige hersienings aangespreek moet word. Die formatering van die PDF verg nog baie werk om dit vir studente makliker te maak om te navigeer.

Beoordeel deur Leanna Giancarlo, medeprofessor, Universiteit van Mary Washington op 4/30/19

Hierdie teks dek al die hoofonderwerpe wat in 'n tweesemester, eerstejaar Algemene Chemie-kursus gevind word en het die toepaslike tabelle (termodinamiese hoeveelhede, ewewigskonstantes, ens.) as benoemde bylaes. Die tabel van standaardvermindering. lees meer

Beoordeel deur Leanna Giancarlo, medeprofessor, Universiteit van Mary Washington op 4/30/19

Omvattendheidsgradering: 3 sien minder

Hierdie teks dek al die hoofonderwerpe wat in 'n tweesemester, eerstejaar Algemene Chemie-kursus gevind word en het die toepaslike tabelle (termodinamiese hoeveelhede, ewewigskonstantes, ens.) as benoemde bylaes. Die tabel van standaardreduksiepotensiale (Bylae E) sal moeiliker wees om te gebruik as die meeste ander handboeke aangesien die potensiaal alfabeties volgens simbool gelys word. Die periodieke tabel in Bylaag H is ook te klein om te gebruik. Die pdf-weergawe sluit nie 'n inhoudsopgawe, indeks of woordelys van terme in nie. Die aanlyn formaat is beter in hierdie verband met skakels na hoofstukke en onderwerpe in die inhoudsopgawe. 'n Woordelys en indeks ontbreek steeds. Hierdie teks is meer omvattend as baie ander in terme van suur-basis-ewewigte aangesien die skrywers uitstekende werk doen om voorbeelde van kwantitatiewe hoeveelhede by ewewig vir beide swak sure en swak basisse te verskaf (laasgenoemde is gereeld afwesig).

Inhoud Akkuraatheid gradering: 3

Die chemiese en wiskundige inhoud lyk akkuraat (alhoewel die Lewis-struktuur wat vir koolstof in Figuur 8.7 verskaf is, verkeerd is), maar daar is sleutelidees wat nie in genoeg detail bespreek word sodat studente die belangrikheid daarvan kan assesseer nie. Een hiervan is die uitsonderings binne elektronkonfigurasies (Hoofstuk 6) waar die families van Cu en Cr slegs in Figuur 6.4 uitgelig word. Beklemtoning van hierdie verskil in die normale patroon van elektronkonfigurasies en 'n verduideliking waarom ontbreek in die teks- of figuurbyskrif. Daarbenewens blyk 'n bespreking van afskerming te ontbreek.

Relevansie/Langlewendheid-gradering: 2

Die inhoud is nie op datum nie met baie beelde wat verwyder is en 'n "publikasie" datum van 2011.

Die geskrewe teks en die probleemoplossingstrategieë is redelik duidelik en eenvoudig. Meer noukeurige definisie van terminologie sal die student help, sowel as die eliminasie van gevorderde materiaal (bv. golffunksiebeskrywing van molekulêre orbitale). Baie hoofstukke bevat te veel vreemde inligting wat dit vir studente moeiliker maak om te fokus op die belangrike leerdoelwitte en sleutelwegnames wat bates vir die werk is. Byvoorbeeld, die verwydering van die "Essential Elements for Life" en "Brief History of Chemistry" uit hoofstuk 1 of "Spoorelemente in biologiese sisteme" in hoofstuk 7 sal die vloei vir die studenteleser verbeter. Alhoewel verskeie van die grafika (bv. Tabelle 2.2, 2.5 en Figuur 2.12) baie goed gedoen is, is sommige figure onnodig waar dit tans in die teks voorkom of verskaf inligting wat te gevorderd is vir 'n student op hierdie vlak. (Byvoorbeeld, Figure 2.3 en 2.4 sal meer gepas wees wanneer elektron- en molekulêre geometrieë in Hoofstuk 9 bekendgestel word, en die titrasiekurwes wat in konseptuele probleem 3 afdeling 4.9 verskyn, sal beter pas nadat suur/basis-ewewigte, buffers en titrasies formeel aangebied is in hoofstuk 16.)

Die formaat van die handboek is redelik konsekwent: binne die meeste onderwerpe is 'n leerdoelwit (afgesonder met 'n gekleurde blokkie), teks, gevolg deur voorbeelde (uitgelig met 'n anderkleurige agtergrond met 'n selfkonsekwente formaat), sleutelvergelykings ('n ander gekleurde agtergrond), opsomming, sleutel wegneemetes, konsep en numeriese probleme (albei met antwoorde). Nie al die hoofstukke bevat Toepassingsprobleme nie (in 'n afdeling getiteld "Einde-van-hoofstukmateriaal"), waar studente bykomende oefening gegee word sonder die leiding om die onderwerp vooraf te ken.

Die teks is redelik leesbaar en deelbaar in kleiner gedeeltes, dit stel die instrukteur/student in staat om gedeeltes wat vreemd mag lyk, weg te laat of om na noodsaaklike vaardighede te spring (bv. metrieke voorvoegsels, temperatuuromskakelings, die voorbereiding van 'n grafiek, ens.). Die teks is goed georganiseer en gegewe sy struktuur kan dit maklik herorganiseer word om by 'n kursus se doelwitte te pas.

Organisasie/Struktuur/Vloeigradering: 4

Afgesien van interkalêre inligting, word die onderwerpe op 'n logiese wyse aangebied, begin met standaard idees van die wetenskaplike metode en meting, vorder na die elementêre struktuur van die atoom, stoïgiometrie en reaksies, energie, meer gedetailleerde struktuur van die atoom, periodieke tendense, binding, molekulêre vorms, fases van materie, kinetika, ekwilibria, termodinamika, elektrochemie en kernchemie.

Die aanlyn weergawe van die teks ontbreek beelde (verklarings van verskoning en kennisgewings dat beelde permanent verwyder is, is ingevoeg, eerder as om die oproep na die figuur te verwyder, binne 'n hoofstuk te hernommer en die teks te redigeer). Dit was steurend en het die leesbaarheid belemmer. Die pdf-weergawe bevat nie hierdie stellings nie (die beelde is eenvoudig weggelaat), en die teks lyk skoner met 'n groter lettertipe. Ongelukkig ontbreek die pdf-weergawe noodsaaklike hulpmiddels (inhoudsopgawe, indeks, ens.) en hiperskakels dit maak die pdf-lêer moeilik om te gebruik wanneer 'n student/instrukteur probeer om na 'n spesifieke plek binne die teks te navigeer. Laastens verander die lettergroottes (veral) binne die beelde/grafika. Dit laat inligting belangriker lyk as wat deur die skrywers bedoel is. (Let wel: lettertipeveranderinge kom ook in die aanlyn teks voor, maar dit is minder steurend in hierdie formaat.)

Gradering van grammatikale foute: 4

Die teks is relatief vry van grammatikale foute, maar ekwilibria word oor die algemeen gebruik as die meervoud van ewewig.

Kulturele relevansie-gradering: 5

Die teks is nie kultureel onsensitief nie.

Beoordeel deur Soheila Adl, Adjunkdosent, LAGCC op 1/15/19

Beide PDF- en aanlynweergawes het goeie dekking van onderwerpe met 'n mate van onnodige oorvleueling van dieselfde onderwerpe in verskillende hoofstukke. Byvoorbeeld, die atoomstruktuurbespreking in afdelings 1.4-1.7 van hoofstuk 1 word meer en minder bespreek in. lees meer

Beoordeel deur Soheila Adl, Adjunkdosent, LAGCC op 1/15/19

Omvattendheidsgradering: 3 sien minder

Beide PDF- en aanlynweergawes het goeie dekking van onderwerpe met 'n mate van onnodige oorvleueling van dieselfde onderwerpe in verskillende hoofstukke. Die atoomstruktuurbespreking in afdelings 1.4-1.7 van hoofstuk 1 word byvoorbeeld meer en minder in hoofstuk 6 bespreek. Hoofstuk 1 van die boek (Inleiding tot Chemie) is te lank en vervelig om te lees (vir die studente) aangesien dit baie dek onbekende onderwerpe vir die eerstejaarstudente van algemene chemie 1. In plaas van atoomstruktuur wat in hoofstukke 2 en 6 bespreek word, moet die dimensionele analise (eenheidomskakeling) aan studente bekendgestel word in hoofstuk 1 wat in hoofstuk 3 van hierdie handboek ingesluit is. PDF-weergawe van die boek ontbreek inhoudsopgawe, navigasiebalk en woordelys. Die uiteensetting van die boekbladsye in PDF-weergawe moet verbeter word om te help met die leesbaarheid van die materiaal. Die beelde en grafika moet ook behoorlik in PDF-weergawe geplaas word. Die aanlyn weergawe het ook nie woordelys nie, maar die navigasiebalk en inhoudsopgawe word waardeer. Alhoewel die onderwerpdekking van die boek bevredigend is, sal ek die volgorde van onderwerpe in sommige hoofstukke verander en die oorvleuelingsmateriaal uitskakel. Die formateringskwessies van PDF-weergawe en organisasie van die onderwerpe in sommige hoofstukke maak dit moeilik om hierdie handboek as 'n selfstandige onderrigboek aan te pas.

Inhoud Akkuraatheid gradering: 4

Sommige van die terminologie wat deur die Skrywers gebruik is, is laat vaar en vervang deur die onlangse skrywers van die algemene chemieboeke. Byvoorbeeld in hoofstuk 5, afdeling 5.3 onder klassifikasie van chemiese reaksies, word 3 klasse van die chemiese reaksies genoem as uitruiling, kondensasie en splitsing wat onderskeidelik bekend staan ​​as vervanging (dubbel of enkel), kombinasie en ontbinding in die meerderheid van die onlangse algemene chemie boeke. Alhoewel daardie terminologie wat in hierdie boek gebruik word korrek is, is dit nie op datum nie en as hierdie handboek saam met die ander algemene chemieboek gebruik word, kan dit verwarring onder die studente veroorsaak. Oor die algemeen is die boek met goeie akkuraatheid geskryf.

Relevansie/Langlewendheid-gradering: 5

Die basiese fundamentele beginsels van chemie is steeds ongeskonde en relevant en die boek se inhoud is op datum. Ek is nie seker oor die akkuraatheid van die geskiedenis van chemie nie. Dit moet deeglik ondersoek word op grond van die ware historiese feite. Met alle rekenaarprogrammeertale soos html, j-navraag en ander programmeerhulpmiddels wat reeds in beide PDF- en aanlynweergawes van enige boek geïmplementeer is, is dit maklik om enige handboek by te voeg, te redigeer en op te dateer.

die teks is redelik duidelik en konsekwent, maar die skrywers is geneig om sommige onderwerpe te oorverduidelik wat die leser laat belangstelling verloor. 'n Beknopte en duidelike geskrewe styl sal interessanter wees. Dit sal die studente help om die essensie van die onderwerpe vas te vang deur die stap-vir-stap berekeninge met behulp van Vergelykingsredigeerder te wys. Uit my eie ondervinding weet ek dat studente moeilik die dimensionele analise probleme begryp as oplossings nie met die regte formaat gedemonstreer word nie.

Die handboek is redelik konsekwent in gebruikte terminologie en manier van , skryfstyl en aanbieding van die onderwerpe. ongelukkig beïnvloed die formateringsprobleme veral met PDF-weergawe en ontbrekende beelde die konsekwentheid van die handboek.y

Die gebrek aan inhoudsopgawe en navigasiebalk in PDF-weergawe maak dit moeilik om 'n spesifieke onderwerp te vind. vir die aanlyn weergawe, met die uitsondering van die eerste hoofstuk, is daar 'n betroubare modulariteit regdeur die handboek. Dit word aanbeveel om bladsynommer en kopskrif bo-aan bladsye by te voeg om die spesifieke hoofstuk te wys.

Organisasie/Struktuur/Vloeigradering: 4

Ek het die aanlyn weergawe 4 gegradeer vir sy georganiseerde manier. Die PDF het nie daardie graad van organisasie nie as gevolg van die uitleg- en formateringskwessies.As ek hierdie handboek moet aanpas, sal ek beslis die volgorde van sommige onderwerpe vir verskeie hoofstukke verander om dit versoenbaar te maak met my onderwysstelselsillabus.

Die PDF-weergawe benodig 'n dramatiese formateringverandering. Die aanlyn weergawe benodig 'n woordelys, bladsynommer, kopskrif om die betrokke hoofstuk te wys en die ontbrekende beelde moet reggestel word. Daar is 'n oorleg van die blaaibladsye oor die navigasiebalk wat deur 'n rekenaarprogrammeerder reggemaak kan word.

Gradering van grammatikale foute: 4

Ek het nie 'n grammatikale fout teëgekom nie, maar in PDF-weergawes is daar baie gevalle van spelfoute wat veroorsaak word deur die uitskakeling van spasies tussen woorde. byvoorbeeld bladsy 57 op PDF-weergawe dat die spasie tussen twee opeenvolgende woorde uitgeskakel is.

Kulturele relevansie-gradering: 5

Hierdie is 'n chemieboek en is heeltemal onbevooroordeeld.

Die aanlyn weergawe van die handboek het 'n goeie dekking van die onderwerp en ek oorweeg dit om dit aan my studente bekend te stel as 'n opsie om geld te spaar. Die volgorde van onderwerpe in verskeie hoofstukke en gebrek aan behoorlike formateringskwessies is vir my die groot nadele om hierdie handboek vir my onderrig aan te pas. Dit gesê, ek waardeer die pogings van die skrywers baie om tyd te neem om hierdie handboek te vervaardig.

Beoordeel deur Michael Russell, Professor in Chemie, Mt. Hood Community College op 11/9/18

Die boek dek die noodsaaklikhede van 'n eerstejaar chemiekursus, maar dit ontbreek diepte en "leesbaarheid". Inderdaad, hierdie teks kon nie as 'n selfstandige onderrigopsie gebruik word nie. Die eerste deel van die boek, "Inleiding tot Chemie" doen 'n goeie werk. lees meer

Beoordeel deur Michael Russell, Professor in Chemie, Mt. Hood Community College op 11/9/18

Omvattendheidsgradering: 4 sien minder

Die boek dek die noodsaaklikhede van 'n eerstejaar chemiekursus, maar dit ontbreek diepte en "leesbaarheid". Inderdaad, hierdie teks kon nie as 'n selfstandige onderrigopsie gebruik word nie. Die eerste deel van die boek, "Inleiding tot Chemie" bespreek die wetenskaplike metode, die basiese voorskrifte van chemie en geskiedenis van chemie 'n regverdige werk, maar ek het gevind dat die bespreking van beduidende figure ('n onderwerp na my mening krities is vir die eerste jaar chemie kurrikulums) onvoldoende in detail of omvang. Die handboek sal ook baat by bykomende prente en tabelle, enigiets om die ewige eentonigheid van die woorde wat in die teks gebruik word, op te breek. Ek waardeer opreg die tyd wat ingegaan het om 'n boek soos hierdie te skep, maar klein besonderhede sal die leser (en student in chemie) baie baat.

Inhoud Akkuraatheid gradering: 5

Ek het geen foute of onakkuraathede teëgekom tydens die hersiening van die teks nie.

Relevansie/Langlewendheid-gradering: 5

Die handboek is in 2011 geskryf, so tot op hierdie datum lyk die boek baie relevant. 'n Opdatering sal, soos altyd, waardeer word!

Die teks gebruik 'n leesbare prosastyl. Alhoewel dit nie super opwindend is nie, is dit redelik duidelik en konsekwent .... die vasberade leser sal kan klaarmaak en die ervaring bevredigend vind.

Die teks is baie konsekwent in sy terminologie en raamwerk. Ek het nie oorvleuelende definisies, of uitsonderings op vorige afdelings, ens.

Met die uitsondering van die eerste hoofstuk, het ek gevind dat die teks maklik in kleiner segmente verdeel kan word. Dit sal baie nuttig wees in 'n seminaarkursus, of miskien 'n kursus oor 'n spesifieke segment van chemie .... baie koel. Dit lyk egter of die eerste hoofstuk - en waarskynlik die belangrikste - saamsmelt in 'n ondeelbare groepie ... en dit is jammer: as ek oor, sê maar, beduidende syfers wil praat, sal dit lekker wees om daardie afdeling(s) te "kopieer en plak" in 'n nuwe dokument om met die klas te deel, ens. In plaas daarvan is die inleidingsonderwerpe inmekaar en oorvleuel mekaar, en ek sal waarskynlik 'n tweede handboek nodig hê om hierdie boek aan te vul as ek dit vir my klasse sou aanneem. Ek besef die opsie om 'n teks deelbaar te maak is die prerogatief van die skrywers, maar dit sal lekker wees om so 'n kenmerk beskikbaar te hê.

Organisasie/Struktuur/Vloeigradering: 5

Die teks is op 'n logiese en baie duidelike manier georganiseer. Die formaat volg gevestigde vorderings soos gestel deur ander chemie handboek skrywers .... daar behoort geen groot struikelblokke te wees vir onderwysers wat hierdie boek vir hul klasse aanneem nie.

Ek was nogal verbaas dat die begin van die handboek nie 'n inhoudsopgawe in die PDF-weergawe gehad het nie. Die webwerf en aanlyn weergawe het 'n inhoudsopgawe gehad .... die PDF-weergawe sal baie baat vind by 'n lys van die verskillende hoofstukke, ens. Om ook die leesbaarheid van die materiaal te verhoog, sal dit wonderlik wees om kleurvolle prente, diagramme, tabelle en voorbeelde by te voeg: die teks is op die oomblik taamlik droog, wat Ek vind dit betowerend aangesien die materiaal so vol verwondering en ontsag is.

Gradering van grammatikale foute: 5

Ek het geen ooglopende of skreiende foute in die teks gesien nie.

Kulturele relevansie-gradering: 5

Die teks het nie op "the" of "she" staatgemaak nie en het meestal geslagsneutraal gebly. Ek het niks in die teks gesien wat spesifieke rasse, etnisiteite of agtergronde sou uitsluit nie.

Ek waardeer die aansienlike pogings deur die skrywers om hierdie teks te skep, en ek wil hulle bedank vir die deel van hul werk met die publiek in hierdie arena - dankie! As jy ooit besluit om 'n nuwe weergawe te skryf (of as jy dit oorweeg om hierdie boek vir jou eie klasse aan te neem), sal dit lekker wees om 'n paar inligting na 2011 ook in te sluit, sluit ASSEBLIEF 'n inhoudsopgawe in die PDF-weergawe van die handboek. Die byvoeging van bykomende prente, diagramme, tabelle, ens. sal die leser se ervaring baie ophelder. net 'n idee. Oor die algemeen hou ek van hierdie boek, en gegewe 'n paar toevoegings en veranderinge, sal dit ook wonderlik wees.

Beoordeel deur Gabriele Backes, Chemie-instrukteur, Portland Community College op 9/12/18

Die aanlyn teks is omvattend en spreek alle onderwerpe aan wat nodig is in 'n eenjarige wetenskaphoofvak se algemene chemiekurrikulum. Dit is goed georganiseer en word in die tradisionele benadering uiteengesit. Elke hoofstuk bevat grafika en illustrasies. lees meer

Beoordeel deur Gabriele Backes, Chemie-instrukteur, Portland Community College op 9/12/18

Omvattendheidsgradering: 4 sien minder

Die aanlyn teks is omvattend en spreek alle onderwerpe aan wat nodig is in 'n eenjarige wetenskaphoofvak se algemene chemiekurrikulum. Dit is goed georganiseer en word in die tradisionele benadering uiteengesit. Elke hoofstuk bevat grafika en illustrasies, alhoewel baie beelde ontbreek - gemerk as permanent onbeskikbaar. Dit is veral duidelik in hoofstuk 14 (Kinetika), met geringe weglatings in omtrent elke hoofstuk. Klein formateringskwessies in hoofstuk 16.2 lei af van die andersins baie mooi geskrewe gedeelte (of teks in die algemeen). / Elke hoofstuk sluit ook 'n stel einde van die hoofstuk oefeninge in. Ek dink die teks kan beslis baat by addisionele oefeninge, sowel as dalk 'n gedeelte van uitdagende oefeninge byvoeg. / Die teks bevat 'n baie omvattende bylaag met alle nodige tabelle en data. / Ek het gehou van die feit dat elke afdeling met 'n 'leerdoelwit' begin en met 'n 'sleutel wegneemete' eindig. / Die teks vergelyk beslis goed met ander tekste wat ontwerp is vir 'n hoofvak se chemiekursus. Aanpassing van die teks vir gebruik in enige algemene chemiekursus is beslis moontlik.

Inhoud Akkuraatheid gradering: 5

Sover ek kan oordeel, is die inhoud akkuraat en het ek geen groot foute of wanopvattings teëgekom nie.

Relevansie/Langlewendheid-gradering: 5

Die teks is so uiteengesit dat dit baie maklik sal wees om by elke afdeling by te voeg soos nodig. Op hierdie stadium is toepassings binne die teks aktueel en sal dit vir 'n geruime tyd gebruik kan word (figuur 2.22 moet beslis opgedateer word). Ek sou graag nog 'n paar aktuele gebeure, figure, tabelle, of skakels na aktuele gebeure wou sien, in die teks geweef. / Enige opdaterings wat mettertyd sal moet plaasvind kan maklik geïntegreer word en behoort nie die vloei van die teks te beïnvloed nie.

Die boek is goed geskryf, dit is bondig en die inhoud is maklik om te volg.

Die teks is deurgaans baie konsekwent in sy uitleg, formatering en skryfstyl.

Voldoende. Elke hoofstuk kan baie maklik as 'n selfstandige hoofstuk aangeneem word

Organisasie/Struktuur/Vloeigradering: 5

Die chemieboek is geskryf om die tradisionele volgorde van onderwerpe te weerspieël. Ek voel dat die uitleg tesame met die aard van die boek enige veranderinge moontlik maak indien 'n ander rangskikking van onderwerpe is wat deur die kurrikulum verlang word.

Ek het gekies om die aanlyn weergawe te hersien (eerder as om die pdf af te laai). Navigasie van die teks was maklik met my rekenaar en ek het geen probleme ondervind met die laai van beelde nie. Sommige van die beelde blyk relatief klein te wees en ek het gewonder hoe dit op 'n kleiner tablet of IPad sal lyk (wat baie van my studente gebruik). Alle hoofstukke het ook skakels wat na vorige hoofstukke verwys, maar geen van die skakels wat op my rekenaar oopgemaak is nie.

Gradering van grammatikale foute: 5

Ek het geen grammatikale of spelfoute gevind nie.

Kulturele relevansie-gradering: 5

Dit is 'n chemie teks. Ek het geen probleme gevind nie.

Hierdie boek is baie mooi geskryf en maklik om te volg. Die inhoud is akkuraat, die teks omvattend en kan maklik in 'n algemene chemiekurrikulum gebruik word. Dit is 'n wonderlike aanlyn chemieboek en ek sal beslis daaraan dink om dit in die toekoms vir ons algemene chemiekursusse aan te neem. Op hierdie stadium is dit egter nie heeltemal gereed om gebruik te word nie, aangesien daar formateringsprobleme en baie ontbrekende beelde is wat die aandag van die andersins baie goedgeskrewe teks aflei.

Beoordeel deur Alvin Holder, Medeprofessor in Chemie, Old Dominion Universiteit op 20/6/17

Die teks is ontwerp om biologiese en biomediese studente, ingenieurstudente, algemene onderwysstudente, gesondheidswetenskappestudente, pre-mediese wetenskapstudente en wetenskaphoofvakke te bedien wat minstens een jaar kursus in algemene chemie vereis. lees meer

Beoordeel deur Alvin Holder, Medeprofessor in Chemie, Old Dominion Universiteit op 20/6/17

Omvattendheidsgradering: 3 sien minder

Die teks is ontwerp om biologiese en biomediese studente, ingenieurstudente, algemene onderwysstudente, gesondheidswetenskappestudente, pre-mediese wetenskapstudente en wetenskaphoofvakke te bedien wat minstens een jaar kursus in algemene chemie benodig en die teks bevat al die vereiste materiaal en onderwerpe om hierdie taak uit te voer. Hierdie handboek is 'n voorloper vir studente wat organiese I-chemie gaan studeer en daardie studente wat dalk na die eerstejaars en tweedejaars gevorderde anorganiese chemie sal moet studeer, selfs eersgenoemde afdeling is te kort van aard. Daar is baie stimulusmateriaal in die vorm van spotprente/figure, maar sommige van hul kwaliteit is nie op standaard nie. Die teks ontbreek 'n inhoudsopgawe, indeks of 'n woordelys en die gebrek aan hierdie entiteite is 'n ernstige tekortkoming. Daar is 'n paar baie ernstige formateringskwessies wat moontlik die gevolg was van die omskakeling van 'n .doc- of .docx-formaat na 'n .pdf-formaat en hierdie foute maak dele van hierdie teks onleesbaar. Die aanlyn weergawe het 'n waarskuwing op sommige plekke, dit wil sê, "Jammer! Die prent is permanent onbeskikbaar.” Die instrukteur sal aansienlike tyd moet spandeer om hierdie formaatfoute reg te stel en baie min tyd sal oorbly vir die onderrig van die materiaal. Daar is ook formateringsprobleme met onderskrifte in chemiese formules wat NIE as onderskrifte verskyn nie, weereens 'n formateringskwessie. Hierdie kwessie is meer oorheersend in die pdf-weergawe, waar breuke nie gewys word nie. Dit sou wys gewees het vir die skrywers om Equation Editor te gebruik om wiskundige vergelykings te skryf en ChemDraw vir die strukture en hoofvergelykings te gebruik (gevolg deur die lêers in die .tiff-formaat te stoor). Die pdf-weergawe is heeltemal te lank (2.365 bladsye in totaal). Dit is baie duur ($$) om te druk en baie moeilik om te lees.

Inhoud Akkuraatheid gradering: 3

Die handboek het 'n paar foute in samehang met die formatering wat in vraag 1 van bo genoem word. Een geval is waar die elektroniese konfigurasies van Cr en Cu nie korrek is nie. In 'n ander geval word die grootte en die eenhede nie deur 'n spasie geskei nie, bv. 25 °C moet as 25 °C geskryf word. Die geskiedenis van chemie is NIE akkuraat nie aangesien dit in Afrika/Egipte begin het, waar khemica 'n antieke Egiptiese woord vir chemie is. Die geskiedenis van chemie moes nagevors gewees het, aangesien die geskiedenis van chemie baie bevooroordeeld is teenoor Europeërs teenoor ander rasse wat werklik al baie jare chemie beoefen.

Relevansie/Langlewendheid-gradering: 5

Die teks en sy voorbeelde is beide relevant en tydloos die klassieke Haber-Bosch-proses vir die vervaardiging van ammoniak is 'n voorbeeld. Onderwerpe soos termochemie, elektrochemie, kernchemie is van die onderwerpe wat ek as hoërskoolleerling by The Lodge School in Barbados in die 1980's geleer het. Sulke onderwerpe sal nog baie jare bestaan. Een ding om op te let, as instrukteurs wat hierdie handboek aanneem toegang tot die oorspronklike dokument as 'n MS Word-dokument gehad het, sou die nodige opdaterings eenvoudig en reguit wees, aangesien die wysiging van die handboek deur 'n PDF-lêer na 'n MS Word-dokument om te skakel, baie probleme sou skep, alles as gevolg van die punte wat in vraag 1 hierbo gemaak is.

Die handboek is meer as voldoende in terme van duidelikheid, maar sommige van die voorbeeldberekeninge sal baat by addisionele formatering so gou as moontlik. Dit is die beste om Vergelykingsredigeerder te gebruik om die antwoorde te skryf en die antwoorde en vergelykings reël vir reël te wys waar dimensionele analise makliker sal wees om te verstaan. 'n Goeie voorbeeld is in die gebruik van hierdie probleem: Etanol het 'n entalpie van verdamping van 42,3 kJ/mol. Die verbinding het 'n dampdruk van 1.00 atm by 78.3 °C. By watter temperatuur is die dampdruk gelyk aan 0,500 atm? (R = 8,314 J/K mol). Ook moet die berekeninge wat persentasie oorvloede behels, herskryf word. Let daarop dat berekeninge wat mol, molêre massas, die gebruik van Avogadro se konstante insluit, op 'n beter manier georganiseer moes gewees het. Die oksidasiegetal van 'n proton en 'n hidried was nie duidelik nie. Die handboek moet op sommige gebiede opgeknap word, veral die onderwerp wat oorgangsmetaalchemie behels.

Die handboek is baie konsekwent in terminologie en aanbieding, selfs met al die foute en formatering binne.

Die gebrek aan 'n inhoudsopgawe verhoed dat die handboek maklik herorganiseer en/of herbelyn word. Al die tipiese onderwerpe vir 'n jaarlange algemene chemiekursus is teenwoordig, maar met 'n inhoudsopgawe sal die handboek baie modulêr wees. Persoonlik moes hoofstuk 8 saamgevoeg gewees het met hoofstuk 2. Alle termochemiese onderwerpe en probleme moes in een hoofstuk gewees het. 'n Hoofstuk met kovalente en ioniese bindings moes saam met Lewis-puntstrukture aangebied word. 'n Meer definitiewe hoofstuk oor wiskundige konsepte moes die eerste hoofstuk gewees het, insluitend logaritmes, indekse, standaardnotasie en betekenisvolle syfers, en 'n paar kort statistiese ontledings.

Organisasie/Struktuur/Vloeigradering: 2

Dit wil voorkom asof die skrywers hul eie organisasie/struktuur/vloeivoorkeure verkies het vir die algemene chemiekursus wat hulle in die verlede aangebied het! Hierdie teks moes op so 'n manier geskryf gewees het dat dit redelik maklik sou wees om die inhoud aan te pas om by 'n spesifieke instrukteur se voorkeure te pas. Sien my antwoord vir vraag 6. Sommige van die onderwerpe kon herorganiseer gewees het en gekombineer word aangesien sommige geskei blyk te wees. Die laaste hoofstuk wat organiese chemie behels, is aangepak en blykbaar gehaas om 'n omvattende handboek te maak.

Eenvoudig gestel daar is net te veel foute in vergelyking (beide chemiese en wiskundige) formatering om hierdie teks bruikbaar te maak. Sien my antwoord op vraag 1.

Gradering van grammatikale foute: 2

Die handboek bevat een grammatikale fout, waar konsekwent die skrywers sinne begin het met die woord "omdat". Dit sal wys wees vir die skrywers om 'n Engelse proefleser hierdie aanlyn handboek te laat lees en hierdie en alle grammatikale foute reg te stel. Ons moet toekomstige STEM-wetenskaplikes manuskripte en handboeke laat skryf wat vry is van grammatikale foute.

Kulturele relevansie-gradering: 5

Hierdie is 'n chemie handboek wat baie nuttig sal wees vir alle rasse aangesien chemie 'n universele wetenskap is.

As 'n instrukteur by 'n uitgebreide navorsings- en onderriginstelling met 'n beduidende minderheidsbevolking (34%) en 'n groot aantal eerstegenerasiestudente en militêre veterane, is die koste van 'n kollege-opleiding 'n beduidende kwessie. As sodanig is ons by ODU altyd op soek na maniere om die koste van hul opleiding te verlaag sonder om kwaliteit in te boet. Ek is baie opgewonde om te leer van die Oop Handboekbiblioteek as 'n metode om handboekkoste te verminder, en was hoopvol dat hierdie handboek aan die behoeftes van sulke studente sou voldoen het. Ongelukkig kan ek op hierdie oomblik, as gevolg van die beduidende formateringskwessies en die manier waarop die inhoud aangebied word, nie hierdie teks aanbeveel vir die instrukteurs wat op eerstejaarsvlak onderrig nie. As die probleme wat ek in hierdie resensie uitgelig het in die toekoms reggestel word, sal ek bereid wees om hierdie handboek by die Departement Chemie en Biochemie aan die Old Dominion Universiteit aan te beveel.

Beoordeel deur Krista Nishida, Kliniese Assistent Professor, Washington State University op 6/20/17

Daar is twee weergawes van hierdie teks, 'n aanlyn weergawe en 'n pdf-weergawe, met 'n beduidende verskil in kwaliteit tussen hulle. Die pdf-weergawe het nie 'n inhoudsopgawe, woordelys, bylaag of indeks nie, wat dit uiters moeilik maak om. lees meer

Beoordeel deur Krista Nishida, Kliniese Assistent Professor, Washington State University op 6/20/17

Omvattendheidsgradering: 3 sien minder

Daar is twee weergawes van hierdie teks, 'n aanlyn weergawe en 'n pdf-weergawe, met 'n beduidende verskil in kwaliteit tussen hulle. Die pdf-weergawe het nie 'n inhoudsopgawe, woordelys, bylaag of indeks nie, wat dit uiters moeilik maak om te navigeer, en die verwysingsaspek van 'n handboek uitlaat. Die aanlyn weergawe, aan die ander kant, bevat al hierdie dinge, en volg die inhoudsopgawe dienooreenkomstig. Die aanlyn kontroles laat jou toe om na die vorige hoofstuk/afdeling, die volgende hoofstuk/afdeling of terug na die inhoudsopgawe te klik, wat dit redelik maklik maak om te navigeer.

Inhoud Akkuraatheid gradering: 3

Weereens, daar is 'n verskil tussen die aanlyn weergawe en die pdf een. Die aanlyn weergawe is korrek geformateer, sodat wiskundige vergelykings en berekeninge gepas in lyn is en alle simbole, boskrifte, ens. korrek vertoon word. Hierdie formatering is verlore in die pdf-weergawe, wat dit moeilik maak om die voorbeelde te volg, selfs as 'n professor in die vak. Hierdie akkuraatheidskwessies is slegs van toepassing as gevolg van formatering in die pdf-weergawe. Ek het geen onakkurate inligting, berekeninge of vergelykings gevind toe ek deur die aanlyn weergawe gelees het nie.

Relevansie/Langlewendheid-gradering: 4

Aangesien algemene chemiekonsepte nie verander nie, vind ek geen langlewendheidskwessies nie.Die voorbeelde wat gegee word, is relevant tot die werklike wêreld, en sluit mooi aan by dinge wat die studente beter kan verstaan. Die enigste probleem is die formatering wat nodige opdaterings vir die pdf-weergawe sou wees.

Die teks self is duidelik en goed geskryf, maar weereens maak die formatering binne die pdf-weergawe dit moeilik om te verstaan ​​en te volg. Weereens, die aanlyn weergawe is baie beter, maar ek kan nie verwag dat al my studente aanlyn moet bly om hul handboek te lees nie.

Terminologie en raamwerk is konsekwent. Ek het geen betekenisvolle veranderinge gevind in hoe die materiaal aangebied is of die terme wat gebruik is nie.

Die aanlyn weergawe is maklik om in klein afdelings of stukke te ontleed, wat jou in staat stel om verskillende afdelings op verskillende tydstip toe te ken. Die pdf-weergawe sal onmoontlik wees, aangesien daar geen inhoudsopgawe is nie, en dit is proef en fout met baie blaai om uit te vind waar jy is. Daar is geen bykomende aanwysers of byskrifte van afdelingnommers of hoofstukke nie, behalwe aan die begin van elke hoofstuk of afdeling. As die voorbeelde of oefeninge in die afdelings en hoofstukke met die hoofstuk en afdeling genommer is, sou dit dit baie makliker maak.

Organisasie/Struktuur/Vloeigradering: 5

Die onderwerpe word in 'n logiese volgorde aangebied vir 'n tipiese wetenskap hoofvakgeoriënteerde kurrikulum. Die vloei is goed.

Navigasie en die koppelvlak op die aanlyn weergawe is goed. Dit laat die leser toe om te klik om terug te spring na die vorige hoofstuk/afdeling of vorentoe na die volgende, sowel as terug na die inhoudsopgawe, alles in een klik vanaf 'n kieslys wat boaan die venster bly. Soms, wanneer jy deur uitgewerkte voorbeelde met vergelykings of berekeninge blaai, is daardie boonste navigasiekieslys sigbaar, maar jy kan nie daarop klik nie. Hierdie probleem stop wanneer jy wegblaai van daardie areas af. Daar is ook beelde en figure binne die aanlyn weergawe wat as "permanent onbeskikbaar" verskyn. Die pdf-weergawe is baie moeilik om te navigeer, en die gebrek aan formatering laat die teks saamsmelt en is moeilik en eentonig om te lees. Die beelde wat " permanent onbeskikbaar" in die aanlyn weergawe is, verskyn wel in die pdf-weergawe, maar al die vergelyking en berekeningsformatering maak dat hulle in 'n lang string karakters verskyn, met die verlies van enige LaTeX- of html-formatering.

Gradering van grammatikale foute: 5

Ek het geen noemenswaardige grammatikale foute gevind nie.

Kulturele relevansie-gradering: 3

Terwyl ek niks gevind het wat kultureel onsensitief of aanstootlik was nie, het ek ook nie veel gevind wat hoegenaamd menslike kultuur toon nie.

Terwyl die algehele teks en inhoud van die handboek dieselfde is in beide weergawes, is die aanlyn weergawe 'n baie beter handboek as die pdf-weergawe. Die aanlyn weergawe het 'n paar probleme, soos die ontbrekende beelde/figure, maar die formatering en gemak van navigasie maak op vir daardie paar gevalle. Die pdf-weergawe se gebrek aan formatering, inhoudsopgawe, woordelys, indeks en bylaes maak dit 'n onbruikbare handboek. Nie almal is 24/7 aan die internet gekoppel nie, so totdat die pdf-weergawe die aanlyn een inhaal, sal ek dit nie met my studente gebruik nie.

Beoordeel deur Jeffrey Bodwin, Professor in Chemie, Minnesota State University Moorhead op 8/21/16

Daar blyk nie 'n indeks of woordelys in die .pdf-weergawe van die handboek te wees nie. Die handboek dek wel al die hoofonderwerpe tipies van 'n eerstejaar Algemene Chemie-kursus, asook sommige van die meer gewilde bykomende onderwerpe wat is. lees meer

Beoordeel deur Jeffrey Bodwin, Professor in Chemie, Minnesota State University Moorhead op 8/21/16

Omvattendheidsgradering: 3 sien minder

Daar blyk nie 'n indeks of woordelys in die .pdf-weergawe van die handboek te wees nie. Die handboek dek wel al die hoofonderwerpe tipies van 'n eerstejaar Algemene Chemie-kursus, asook sommige van die meer gewilde bykomende onderwerpe wat soms gedek word as daar genoeg tyd is. Alhoewel die teks redelik maklik vir sleutelwoorde gesoek kan word, sal die gebrek aan 'n indeks of woordelys dit moeilik maak vir 'n student om hierdie handboek te gebruik as hulle nie vertroud genoeg is met die onderwerp om toepaslike sleutelwoorde te kan kies om te soek nie.

Inhoud Akkuraatheid gradering: 4

Die inhoud blyk akkuraat in sy bedoeling te wees, maar die foute en weglatings in die .pdf-weergawe van die handboek lei daartoe dat dinge in 'n aantal hoofstukke verkeerd is (of baie moeilik vir 'n intreevlakstudent is om te interpreteer).

Relevansie/Langlewendheid-gradering: 4

Die voorbeelde in die handboek is beide tydloos en aktueel, en bied 'n goeie mengsel van "Hoe is dit ontdek?" en "Hoe gebruik ons ​​dit nou?" aansoek vir die student. Die implementering van opdaterings kan 'n uitdaging wees gegewe die statiese aard van die .pdf-formaat, maar behoort hanteerbaar te wees.

Die teks van hierdie handboek is duidelik geskryf en behoort redelik toeganklik vir intreevlakstudente te wees.

Die terminologie en stem van die handboek is konsekwent, hoewel baie van die formatering en tegniese foute probleme in hierdie konsekwentheid kan veroorsaak. Sien byvoorbeeld gevalle waar “delta” gebruik word of onderskrifte en boskrifte gebruik word.

Die handboek moet betroubaar modulêr wees, hoewel die foute dit moeilik maak om op enige manier te gebruik. Benewens die bladsynommers, moet die skrywers en/of uitgewer dit oorweeg om opskrifte op elke bladsy te plaas wat die spesifieke hoofstuk (en onderwerp) van die materiaal aandui.

Organisasie/Struktuur/Vloeigradering: 3

Die organisasie is gepas. Struktuur en vloei word aansienlik ontwrig deur die formatering en tegniese foute.

Dit is 'n teleurstellende voorbeeld van 'n aanlyn oop handboek. Die formatering is eenvoudig aaklig met baie ontbrekende figure, herhaalde gedeeltes van die teks, swak of verkeerd geformateerde figure of vergelykings en ander (vermoedelik tegniese) probleme wat die teks in wese onbruikbaar maak. Enige selfs vlugtige resensie van die teks deur die skrywers en/of die uitgewer sou baie van hierdie probleme voor publikasie opgevang het.

Gradering van grammatikale foute: 4

Daar is af en toe grammatikale en tipografiese foute deurgaans, maar dit beïnvloed nie die leesbaarheid van die teks noemenswaardig nie.

Kulturele relevansie-gradering: 4

Die figure wat in die .pdf-weergawe van hierdie handboek gebruik word, is feitlik sonder enige mense. Alhoewel dit oor- of onderverteenwoordiging op enige groep voorkom, is dit teleurstellend dat die skrywers nie kies om die menslike kant van chemie meer prominent te vertoon nie, soos wat ooreenstem met hul gestelde doelwitte om chemie meer verwant aan die student te maak. Dit sal ook 'n geleentheid wees om chemici en ander wetenskaplikes van tradisioneel onderverteenwoordigde groepe proaktief te laat posvat om as aspirasie-rolmodelle te dien vir die studente wat die handboek gebruik.

Hierdie oop handboek is teleurstellend. Averil het in die verlede 'n paar kwaliteit tekste geskryf, so ek is onseker of die probleme by die skrywer, of die uitgewer lê, of net die willekeurigheid van sagteware-interpretasie wanneer groot lêers op- en aflaai. Ek vermoed dat alle partye betrokke by die publikasie van hierdie oop handboek verantwoordelikheid dra vir die swak kwaliteit produk wat hulle verskaf het. Bydraes van hierdie swak gehalte doen 'n uiterste onguns aan die oop handboekgemeenskap deur te gee aan nee-sêers 'n voorbeeld van wat blykbaar slinks saamgevoegde inhoud is. Ek het die .pdf-lêer van hierdie handboek afgelaai en dit vanlyn oopgemaak. (Dit is die enigste formaat wat direk vanaf die Universiteit van Minnesota se oop handboek-webblad beskikbaar is.) As daardie modus van toegang die wortel is van sommige van die tegniese probleme/foute wat ek waarneem, dan vermoed ek dieselfde probleme sal alomteenwoordig wees met studente wat probeer om gebruik hierdie oop handboek. Ek het na die uitgewer se webwerf gegaan en gevind dat die .html-weergawe van die boek beter is (dit het 'n inhoudsopgawe/indeks, en baie van die probleme met syfers is opgelos), maar dit het net tot die middel van Hoofstuk 1 geneem om vind die boodskap "Jammer hierdie beeld is permanent onbeskikbaar" in die plek van wat Figuur 1.6 tot 1.9 moes gewees het. Die .docx-weergawe stem ooreen met die .pdf-weergawe met baie (miskien almal) dieselfde foute. Die verklaarde filosofie van die handboek is gesond, en ek waardeer die bedoeling daarvan. My benadering tot algemene chemie is soortgelyk en ek sal 'n betroubare handboek (veral 'n oop handboek) verwelkom wat goed by my voorkeure aansluit. Die tegniese foute in hierdie handboek is ooglopend en behoort onaanvaarbaar te wees. Ek sal dit nie oorweeg om hierdie oop handboek vir my klasse te gebruik nie, en verder sal ek die skrywers, die uitgewer en die Universiteit van Minnesota aanmoedig om hierdie inhoud van die web te verwyder tensy en totdat dit op 'n meer verantwoordelike wyse aangebied kan word

Beoordeel deur D.K. Philbin, Professor, Allan Hancock College op 15/7/14

Die teks is ontwerp om wetenskap en ingenieurswese hoofvakke te dien wat 'n eenjaarkursus in algemene chemie benodig en die teks bevat al die vereiste materiaal en onderwerpe om hierdie taak te verrig. In die voorwoord lys die skrywers agt spesifieke. lees meer

Beoordeel deur D.K. Philbin, Professor, Allan Hancock College op 15/7/14

Omvattendheidsgradering: 4 sien minder

<p> Die teks is ontwerp om wetenskap en ingenieurswese hoofvakke te dien wat 'n eenjaarkursus in algemene chemie vereis en die teks bevat al die vereiste materiaal en onderwerpe om hierdie taak te verrig. In die voorwoord lys die skrywers agt spesifieke doelwitte wat hulle met hierdie teks wil bereik en ek voel dat hulle wel hul doel bereik. Die teks bevat talle interessante &quot real world&quot voorbeelde van toegepaste chemie (vuurwerke en die samestelling daarvan is een van my gunstelinge) wat as effektiewe &quothooks&quot sal optree om studente se belangstelling vas te vang. Hierdie voorbeelde tesame met klaskamerdemonstrasies (verskeie soute opgelos in metanol en aangesteek, om die kleure van vuurwerke te verken) het bewys dat dit effektief is om studente se belangstelling vas te vang. Die teks het nie 'n inhoudsopgawe, indeks of 'n woordelys nie en die gebrek daaraan is 'n ernstige belemmering vir studente. Daar is 'n paar baie ernstige formateringskwessies wat moontlik die gevolg was van die omskakeling van 'n .doc- of .docx-formaat na 'n .PDF en hierdie foute maak dele van hierdie teks onbruikbaar. Dit is treffend duidelik in hoofstuk 14, Chemiese Kinetika, waar baie operateurs (e, boskrif, ens.) met leë blokkies vervang is. Die instrukteur sal aansienlike tyd moet spandeer om hierdie formaatfoute reg te stel en baie min tyd sal oorbly vir onderrig! Daar is ook formateringsprobleme met onderskrifte in chemiese formules wat NIE as onderskrifte verskyn nie, weer 'n formateringskwessie.</p>

Inhoud Akkuraatheid gradering: 4

<p> As mens al die formateringsfoute wat in die teks voorkom, ignoreer (sien vraag #1 hierbo), sal die akkuraatheid meer as voldoende wees. By die toekenning van die akkuraatheidtelling sluit ek NIE die formateringskwessies in nie.</p>

Relevansie/Langlewendheid-gradering: 4

<p> Die teks en sy&#39voorbeelde is beide relevant en tydloos die klassieke Haber-Bosch-proses vir die vervaardiging van ammoniak is maar een voorbeeld. Ek het die voorbeeld waardeer van die bestaan ​​van hoë vlakke van iridium in 66 miljoen jaar oue sedimente wat belangrike bewyse is vir die asteroïde-impak wat moontlik die uitsterwing van die dinosourusse veroorsaak het, iets wat my studente kan waardeer en daarmee kan verband hou. Die skrywer gebruik bogenoemde iridiumvoorbeeld in 'n baie mooi bespreking van die wetenskaplike metode. As instrukteur&#39s wat hierdie teks aanneem toegang tot die oorspronklike dokument (.doc of .docx) gehad het, sou vereiste opdaterings maklik en eenvoudig wees om die teks te wysig aangesien 'n .pdf-lêer te lastig sou wees.</p>

<p> Die teks het meer as voldoende duidelikheid, maar sommige van die voorbeeldberekeninge sal baat by addisionele formatering. 'n Voorbeeld is die bepaling van die empiriese formule van Penisillien, die berekeninge word op 'n lineêre wyse geskryf sodat die gemiddelde algemene chemiestudent verlore sou wees as hulle die voorbeeld wat gegee word, probeer volg. Ook die formateringsprobleme wat in vraag #1 bespreek is, maak baie vergelykings so verwarrend dat dit onverstaanbaar is vir 'n algemene chemiestudent</p>

<p> Die teks is redelik konsekwent in terminologie en aanbieding.</p>

<p> Die gebrek aan 'n inhoudsopgawe verhoed dat die teks maklik herorganiseer en/of herbelyn word. / / Al die tipiese onderwerpe vir 'n jaar lange algemene chemiekursus is teenwoordig en met 'n voldoende inhoudsopgawe sal die teks baie modulêr wees.</p>

Organisasie/Struktuur/Vloeigradering: 4

<p> Dit wil voorkom asof elke instrukteur hul voorkeurorganisasie/struktuur/vloeivoorkeure het vir die algemene chemiekursus wat hulle aanbied! Hierdie teks is so geskryf dat dit redelik maklik sal wees om die inhoud aan te pas om by die spesifieke instrukteursvoorkeure te pas.</p>

<p> Eenvoudig gestel daar is net soveel foute in vergelyking (beide chemiese en wiskundige) formatering om hierdie teks bruikbaar te maak.</p>

Gradering van grammatikale foute: 4

<p> Ek sien geen grammatikale probleme nie.</p>

Kulturele relevansie-gradering: 5

<p> Nie van toepassing nie. Dit is 'n chemie-teks.</p>

<p> Onderrig by 'n gemeenskapskollege met 'n beduidende minderheidsbevolking en 'n groot aantal eerstegenerasie studente waar die koste van 'n kollege-opleiding 'n beduidende kwessie is, is ek altyd op soek na maniere om die koste van hul opleiding te verlaag sonder om kwaliteit in te boet. Ek was opgewonde om te leer van die Oop Handboekbiblioteek as 'n metode om handboekkoste te verminder en aangesien 'n groot deel van my onderriglading die jaar lange algemene chemie-reeks onderrig is, was ek hoopvol dat hierdie teks aan my behoeftes sou voldoen. Ongelukkig, as gevolg van die beduidende formateringskwessies wat teenwoordig is, sal ek nie hierdie teks kan gebruik nie. As die probleme wat ek in hierdie resensie uitgelig het in die toekoms reggestel word, sal ek bereid wees om hierdie teks aan te neem en ek sal gretig wees om my studente se reaksie op 'n Oop Handboekbiblioteek-produk te hoor.</p>


Joernale

Lys outeurs in die volgorde waarin hulle in die oorspronklike teks verskyn, gevolg deur 'n punt. Periodes volg ook artikel- en tydskriftitel en volume of uitgawe-inligting. Skei die datum van volume en uitgawe met 'n kommapunt. Die ligging (gewoonlik die bladsyreeks vir die artikel) word deur 'n dubbelpunt voorafgegaan.

Skrywer(s). Artikel titel. Joernaal titel. Datumvolume (uitgawe): ligging.

Tydskriftitels word oor die algemeen afgekort volgens die lys van titelwoordafkortings wat deur die ISSN Internasionale Sentrum in stand gehou word. Sien Bylaag 29.1 in Wetenskaplike styl en formaat vir meer inligting.

Vir artikels met meer as 1 outeur word name deur 'n komma geskei.

Smart N, Fang ZY, Marwick TH. 'n Praktiese gids tot oefenopleiding vir hartversakingpasiënte. J-kaart misluk. 20039(1):49&ndash58.

Vir artikels met meer as 10 skrywers, lys die eerste 10 gevolg deur &ldquoet al.&rdquo

Pizzi C, Caraglia M, Cianciulli M, Fabbrocini A, Libroia A, Matano E, Contegiacomo A, Del Prete S, Abbruzzese A, Martignetti A, et al. Lae dosis rekombinante IL-2 veroorsaak sielkundige veranderinge: monitering deur Minnesota Multiphasic Personality Inventory (MMPI). Antikanker Res. 200222(2A):727&ndash732.

Volume met geen uitgawe of ander onderverdeling nie

Laskowski DA. Fisiese en chemiese eienskappe van piretroïede. Rev Environ Contam Toxicol. 2002174:49&ndash170.

Volume met uitgawe en bylaag

Gardos G, Cole JO, Haskell D, Marby D, Paine SS, Moore P. Die natuurlike geskiedenis van tardiewe dyskinesie. J Clin Pharmacol. 19888(4 Suppl):31S&ndash37S

Volume met aanvulling maar geen probleem nie

Heemskerk J, Tobin AJ, Ravina B. Van chemikalie tot dwelm: neurodegenerasie dwelm sifting en die etiek van kliniese proewe. Nat Neurosci. 20025 Suppl:1027&ndash1029.

Ramstrom O, Bunyapaiboonsri T, Lohmann S, Lehn JM. Chemiese biologie van dinamiese kombinatoriese biblioteke. Biochim Biophys Acta. 20021572(2&ndash3):178&ndash186.

Sabatier R. Heroriëntering van gesondheids- en maatskaplike dienste. VIGS STD Health Promot Exch. 1995(4):1&ndash3.


Kwartaalvraestel: Formaat van aanhalings en verwysings

Terwyl jy jou kwartaalvraestelle skryf, sal dit vir jou belangrik wees om te dokumenteer waar jy die inligting gekry het wat in jou verslag aangehaal is. Baie van die verwysings wat jy gebruik sal uit gepubliseerde bronne kom. Sommige kan afkomstig wees van elektroniese bronne soos die World Wide Web, Melvyl en Harvest databasisse wat beskikbaar is deur die UC Davis-biblioteek, CD-verwysings en dies meer, en sommige kan uit onderhoude kom. 'n Belangrike komponent van jou skryfwerk sal die doeltreffende gebruik van verwysingsmateriaal wees. Hierdie vaardigheid sal jou goed dien in die skryf van vraestelle van alle soorte, nie net dié wat vir klasse vereis word nie.

Vir hierdie klas sal ons die dokumentasiestyl van die American Psychological Association (APA, 2001) gebruik wat gewysig is met kursiefskrif wat vervang word met onderstreep. Hierdie formaat is baie soortgelyk aan dié van die Modern Language Association, en dit is die mees gebruikte style vir publikasie in die sosiale en natuurwetenskappe. Die algemene vorm van aanhalings in die liggaam van die teks is om die outeur en datum tussen hakies in te sluit (soos hierbo) en opsioneel die bladsynommer(s) na die datum in te sluit. Indien die skrywer se naam pas in die teks genoem is, is dit nie nodig om dit in die aanhaling te herhaal nie. Die reëls word in meer besonderhede, met voorbeelde, in afdeling 3 beskryf.

2. Basiese riglyne

Die doel van die kwartaalvraestel in ECS 15 is dat jy leer hoe om doeltreffende navorsing oor 'n onderwerp te doen en dit dan duidelik op te skryf, om te wys waar jy jou inligting gekry het.

'n Navorsingsvraestel vereis dat daar gesoek word na inligting wat relevant is tot 'n gegewe onderwerp, dit organiseer en dit effektief in geskrewe vorm aanbied. Mondelinge navorsingsverslae is ook nuttig, maar hierdie kursus dek dit nie.

In die volgende afdelings sal ons die manier aanbied waarop ons wil hê jy jou verwysings in die kwartaalvraestel vir hierdie kursus moet aanhaal. Die vereiste formaat voldoen aan die aanvaarde praktyke aangehaal in Li en Crane (1993), 'n verwysing wat tans as die beste gesag beskou word om elektroniese bronne aan te haal. Hierdie boek volg op sy beurt die basiese formaat vir die American Psychological Association (APA, 2001), wat 'n goeie formaat is (hoewel geensins die enigste aanvaarbare een in tegniese publikasies nie). Daar kan van jou verwag word om effens verskillende formate vir ander referate te gebruik, soos referate wat vir publikasie aan gekeurde tydskrifte ingedien word, wat elkeen tipies hul eie style het. Om te leer hoe om een ​​so 'n stel reëls te volg, is 'n moeite werd. Daar sal dus van jou verwag word om die formaat hieronder uiteengesit te gebruik.

3. In-teks Aanhaling na Verwysings

Wanneer jy 'n verwysing uit jou verwysingslys aanhaal, gebruik asseblief die volgende konvensies. Plaas die outeur(s) se vanne, die jaartal en opsioneel die bladsynommer(s) geskei deur kommas tussen hakies.

Vir een skrywer, gebruik die skrywer se van en jaartal geskei deur 'n komma. Byvoorbeeld: (Walters, 1994) of (Austin, 1996).

Vir twee tot vyf outeurs, gebruik hul vanne geskei deur kommas en met 'n ampersand "&" voor die heel van in die lys, dan die jaar geskei deur 'n komma. Byvoorbeeld: (Li & Crane, 1993) (Charniak, Riesbeck, McDermott & Meehan, 1994).

Vir meer as vyf skrywers, gebruik die eerste outeur se van en "et al." Byvoorbeeld: (Walters, et al., 1992).

Gebruik die jaar vir die datum. Indien daar twee verwysings deur dieselfde outeur(s) vir dieselfde jaar is, gebruik letters na die jaar: (Walters, 1993b).

As daar spesifieke bladsynommers vir 'n aanhaling is, voeg dit na die jaar by (Walters, 1994, pp. 31-49).

As jy die outeur se naam(ne) by die teks van 'n sin in die vraestel insluit, kan jy hulle name soos volg uit die hakies weglaat: "Austin (1996) sluit waardevolle verwysings na . " of "Die voorbeelde gegee deur Li en Crane (1993) op webadresse . ".

Moenie voetnote in hierdie klas vir aanhalings gebruik nie. Jy kan dit vir verduidelikende teks gebruik, maar nie vir verwysings nie. Laat die aanhaling dit maklik maak om die verwysing in die "Verwysings" afdeling te vind. Alle verwysings in daardie afdeling moet volledig genoeg wees sodat lesers 'n kopie vir hulself kan bekom.

4. Jou lys van verwysings

Skep 'n lys van verwysings, een vir elke item wat in die vraestel aangehaal word, in 'n afdeling genaamd "Verwysings". Hierdie afdeling gaan aan die einde van jou vraestel. Die verwysings moet alfabeties gerangskik word volgens die eerste skrywer se van, of (indien geen outeur gelys is nie) die organisasie of titel. As jy meer as een referaat deur dieselfde eerste outeur aanhaal, sorteer hulle volgens jaar van publikasie, vroegste jaar eerste. Moenie voetnote vir aanhalings gebruik nie.

Enkelspasieer die inskrywings in jou lys van verwysings. Begin by die linkerkantlyn vir die eerste reël van elke bibliografie-inskrywing. Elke bykomende reël van elke inskrywing moet 'n redelike hoeveelheid ingekeep word. Skei die inskrywings met 'n leë reël. Moenie die verwysings nommer nie. As u dit doen, beteken dit dat u al die verwysings moet hernommer wanneer u 'n nuwe verwysing invoeg.

4.1. Skrywer, datum en titel

Die algemene formaat vir die skrywer, titel en datum in jou verwysingslys is soos volg:

Die volgende verduidelik hierdie velde.

Skrywer

Eerste skrywer se van, gevolg deur die voorletters. As daar twee outeurs is, skei hulle name met "and". Vir drie of meer skrywers, skei almal behalwe die laaste skrywer se naam met kommas, en gebruik "and" voor die laaste skrywer se naam in die lys. As gepubliseer deur 'n agentskap sonder 'n outeur wat gegee word, lys die naam van die agentskap. Eindig met 'n tydperk. Byvoorbeeld:

Walters, R.F., Bharat, S.R. en Austin, A.A.

Charniak, E., Riesbeck, C., McDermott, D. en Meehan, J.

Sluit die datum tussen hakies in. Gebruik 'n datum wat voldoende spesifiek vir die item is. Gee byvoorbeeld die jaar van publikasie vir 'n boek, die jaar en maand van publikasie vir 'n maandelikse tydskrif of joernaal, en die jaar, maand en dag vir 'n koerant of dagblad. Eindig met 'n tydperk. Byvoorbeeld:

Titel

As die titel dié van 'n artikel is, gebruik die gewone lettertipe as dit die titel van 'n boek is, kursief dit. Hoofletter slegs die eerste letter van die eerste woord en eiename. As daar 'n onderskrif is, moet dit ook met 'n hoofletter begin. Eindig met 'n tydperk. Byvoorbeeld, 'n artikel se titel sal soos volg lyk:

en 'n boek se titel sal soos volg lyk:

4.2. Tydskrifte, Tydskrifte en Koerante

Die volgende is van toepassing op die aanhaling van die naam en identifiserende inligting vir joernale, tydskrifte, koerante en tydskrifte in die algemeen.

Titel

Wanneer jy die naam van 'n tydskrif, tydskrif of koerant aanhaal, skryf die naam in kursief, met alle woorde met hoofletters behalwe vir artikels, voorsetsels en voegwoorde.

Volume, nommer en bladsynommers

Gee die volumenommer in kursief, gevolg deur die uitgawenommer tussen hakies (indien daar 'n uitgawenommer is), en die bladsynommer(s). Vir tydskrifte, gaan bladsynommers vooraf met "p." (as die artikel op 'n enkele bladsy is) of "pp." (as die artikel op verskeie bladsye is). Byvoorbeeld:

Mededelings van die ACM, 27 (2), 141-195.

Journal of Advertising Research, 32, 47-55.

Uitgewer en ligging

Gee die stad en staat (indien in die Verenigde State), gevolg deur 'n dubbelpunt en die naam van die uitgewer, gevolg deur 'n punt. Byvoorbeeld:

Englewood Cliffs NJ: Prentice-Hall.

4.3. Onderhoude

As jy kies om enige persoonlike onderhoude in te sluit, verwys dit met die persoon se naam, hul professionele titel en werkgewer, en die datum, tyd en plek van die onderhoud. Byvoorbeeld:

4.4. Verwysings gevind in elektroniese vorm

Baie hulpbronmateriaal is beskikbaar deur Melvyl en Harvest, wat die elektroniese toegangspunte vir die UC Davis-biblioteek is. Meer is op CDROM, of op die internet. Dit kan dien as toepaslike verwysings vir navorsingsverslae en kwartaalvraestelle. Dit is egter belangrik om die bronne van hierdie dokumente te erken, al het jy dalk nog nooit " harde kopie" (gedrukte weergawes) van die lêer(s) wat jy wil aanhaal, gesien nie. Hierdie afdeling beskryf hoe jy verwysings moet aanhaal wat jy van elektroniese bewaarplekke gekry het.

Die basiese vorm van jou verwysing sal soortgelyk wees aan gedrukte verwysings, maar jy sal 'n paar belangrike bykomende inligting moet byvoeg: die tipe medium wat gebruik word, en die materiaal se beskikbaarheid.

In die algemeen, as jy 'n elektroniese lêer wil aanhaal, moet jy óf die term "[Aanlyn]" óf die term "[CDROM]" (in vierkante hakies) insluit voor die sluitingsperiode wat die titel van die werk wat aangehaal word, beëindig. As jy 'n deel van 'n groter werk aanhaal, moet jy die titel gee, gevolg deur 'n komma, die woord "In" gevolg deur die groter werk, en dan "[Aanlyn]" of "[CDROM]" byvoeg soos toepaslik, gevolg deur N tydperk.

Deur die beskikbaarheid van 'n elektroniese dokument aan te haal, behoort die leser genoeg inligting te gee om te weet waar om die lêer op te spoor en, indien nodig, die spesifieke gedeelte van die lêer wat aangehaal word. Elektroniese dokumente kan van verskeie tipes liggings af kom:

ftp: identifiseer die ftp-bediener, ligging (pad) en lêernaam

Internet (bv. wêreldwye web): gee die ligging en lêernaam die URL is voldoende

poslyste, nuusgroepe: identifiseer die bediener, metode van toegang en lêernaam moenie persoonlike e-pos aanhaal nie

In elke geval moet jy genoeg inligting gee om die leser te laat weet hoe om die inligting elektronies te bekom. Oor die algemeen is dit voldoende om die webwerf (Internet-styl bediener naam) waarop die inligting geleë is, die naam van die lêer en die volledige pad (lys van gidse) te gee wat wys hoe om daarby uit te kom, voldoende is.Byvoorbeeld:

[Aanlyn]. Beskikbaar: e-pos: [email protected] Boodskap: Kry POETICS VANDAG.

[Aanlyn] Beskikbaar: FTP: ftp.bio.indiana.edu, Plek: /usenet/bionet/neuroscience, Lêer: 9512.newsm.

[CD-ROM]. Beskikbaar: UMI-lêer: Besigheidstydskrifte Ondisk Item 91-11501.

5. Voorbeelde van volledige verwysings

Al die voorbeelde hierbo gegee kan opgesom word deur 'n paar verwysings aan te haal in die vorm wat ons graag wil hê jy moet gebruik. Hier is 'n paar voorbeelde wat in die teks aangehaal sal word as (Crosley, 1988), (Essinger, 1991, 28 Mei, pp. 97-99), (Armstrong & Keevil, 1991, p. 103), ensovoorts.

5.1. Gedrukte Boek

Crosley, L.M. (1988). Die argitektegids vir rekenaargesteunde ontwerp. Toronto: John Wiley & Seuns.

5.2. Tydskrifartikel

Essinger, J. (1991, 28 Mei). Net nog 'n instrument van jou handel. Rekeningkunde 108, pp. 91-125.

5.3. Joernaal artikel

Armstrong, P. en Keevil, S. (1991). Magnetiese resonansiebeelding-2: Kliniese gebruike. British Medical Journal 303 (2), 105-109.

5.4. Onderhoud

Computer, Christopher C. (1996, 10 Januarie) Professor, Departement Rekenaarwetenskap, Universiteit van Kalifornië - Davis, 15:00, Davis, Kalifornië.

5.5. Wêreldwye webadres

Austin, A. (1996) Geannoteerde lys van wêreldwye web tegniese skryfwerk en rekenaargesteunde komposisiehulpbronne [Aanlyn]. Beskikbaar: http://wwwcsif.cs.ucdavis.edu/~austina/cai.html.

Burke, J. (1992, Januarie/Februarie). Kindernavorsing en -metodes: Wat medianavorsers doen, Journal of Advertising Research, 32, RC2-RC3. [CD-ROM]. Beskikbaar: UMI-lêer: Besigheidstydskrifte Ondisk Item: 92-11501.


Ensiklopedie van Virologie

Encyclopedia of Virology, Derde Uitgawe gaan voort met sy sukses as die grootste enkele verwysingsbron van huidige navorsing in virologie. Uniek in die gebruik van bondige "mini-resensie"-artikels, hierdie geprysde werk dek biologiese, molekulêre en mediese onderwerpe rakende virusse in diere, plante, bakterieë en insekte. Nou in vyf volumes is hierdie nuwe uitgawe omvattend hersien en bygewerk om die 50% toename in geïdentifiseerde en aanvaarde virusse sedert die jaar 2000 te weerspieël. Met meer as 25% nuwe hoofstukke en meer as 1000 illustrasies, neem hierdie uitgawe die nuwe ontwikkelings in virologie-navorsing deur inligting in te sluit oor nuwe opkomende siektes soos voëlgriep, SARS en Wes-Nyl en die vermoë van sommige virusse om as agente van bioterrorisme gebruik te word. Geredigeer deur vooraanstaande viroloë Mahy en van Regenmortel, bly hierdie derde uitgawe die nommer een allesomvattende bron van inligting vir virologienavorsers, studente en verwysingsdepartemente van akademiese, mediese en korporatiewe biblioteke.

Encyclopedia of Virology, Derde Uitgawe gaan voort met sy sukses as die grootste enkele verwysingsbron van huidige navorsing in virologie. Uniek in sy gebruik van bondige "mini-resensie"-artikels, dek hierdie geprysde werk biologiese, molekulêre en mediese onderwerpe rakende virusse in diere, plante, bakterieë en insekte. Nou in vyf volumes is hierdie nuwe uitgawe omvattend hersien en bygewerk om die 50% toename in geïdentifiseerde en aanvaarde virusse sedert die jaar 2000 te weerspieël. Met meer as 25% nuwe hoofstukke en meer as 1000 illustrasies, neem hierdie uitgawe die nuwe ontwikkelings in virologie-navorsing deur inligting in te sluit oor nuwe opkomende siektes soos voëlgriep, SARS en Wes-Nyl en die vermoë van sommige virusse om as agente van bioterrorisme gebruik te word. Geredigeer deur vooraanstaande viroloë Mahy en van Regenmortel, bly hierdie derde uitgawe die nommer een allesomvattende bron van inligting vir virologienavorsers, studente en verwysingsdepartemente van akademiese, mediese en korporatiewe biblioteke.


Verwysings

Hulle is nie so beroemd soos Darwin of Curie nie, maar hierdie helde het ons lewens verbeter deur baanbrekende prestasies.

Albert Einstein: Die lewe van 'n briljante fisikus

Soveel meer as snaakse hare.

'n Beginnersgids vir tydreise

Deur Andrew May, How It Works-tydskrif

Leer presies hoe Einstein se relatiwiteitsteorie werk, en ontdek hoe daar niks in die wetenskap is wat sê dat tydreis onmoontlik is nie.

Robert Hooke: Engelse wetenskaplike wat die sel ontdek het

Deur Ailsa Harvey, How It Works-tydskrif

Robert Hooke was die Engelse polimaat wat die boustene van alle lewe ontdek het.

Die internasionale datumlyn, verduidelik

Die internasionale datumlyn is 'n konsep wat dikwels belaai is met misverstand en verwarring. Maar dit speel 'n belangrike rol in ons lewens en 'n sentrale rol in tydsberekening.

Swartbere: Die mees algemene beer in Noord-Amerika

Amerikaanse swartbere is die kleinste en mees algemene beer in Noord-Amerika. Hulle is hoogs aanpasbaar, met 'n dieet wat heuning en eland insluit.

Acetaminophen: Dosis, newe-effekte en oordosis

Acetaminophen behoort aan twee klasse medisyne: pynstillers (pynstillers) en antipiretika (koorsverminderers).

Wat is Juneteenth?

Die Amerikaanse vakansiedag Juneteenth word op 19 Junie gevier. Dit staan ​​ook bekend as Emancipation Day en Black Independence Day.

Om 'n baba te hê: Stadiums van swangerskap volgens trimester

Swangerskap duur ongeveer 40 weke en word in drie stadiums, of trimesters, verdeel, elk met unieke simptome en veranderinge in die moeder se liggaam en in fetale ontwikkeling.

Cottonmouth slange: Feite oor water moccasins

Deur Jessie Szalay, Patrick Pester

Cottonmouths, of watermoccasins, is giftige slange in Noord-Amerika wat wit bekke vertoon wanneer hulle bedreig word.

Wat is die Melkweg?

Vind uit al die wetenskap van die Melkweg, insluitend die grootte van ons tuissterrestelsel, wie dit ontdek het en hoe dit op 'n botsingsbaan met 'n ander sterrestelsel is.

Gemoedswisselings en mammabrein: Die emosionele uitdagings van swangerskap

'n Vrou se emosionele welstand en haar geestelike uitkyk speel belangrike rolle in swangerskap.

Lemurs: 'n Diverse groep bedreigde primate

Lemurs sluit 'n diverse groep primate in, van sonaanbiddende ringstertlemurs tot die eienaardige, nagtelike aye-aye.

Kweekhuisgasse: Oorsake, bronne en omgewingseffekte

Deur Tiffany Means, Marc Lallanilla

Kweekhuisgasse is atmosferiese gasse wat infrarooi straling absorbeer en hitte in die atmosfeer vasvang. Toenames in die uitstoot van hierdie gasse lei tot klimaatsverandering en aardverwarming.

Gesonke stede: Ontdek werklike 'Atlantis'-nedersettings wat onder die branders versteek is

Deur Nikole Robinson, How It Works-tydskrif

Verken die onderwater stede om te ontdek hoekom hulle nie die toets van tyd oorleef het nie.


Verskil tussen bibliografie en verwysings

Bibliografie vs Verwysings

Mense dink die meeste van die tyd nie dat daar enige verskil tussen bibliografie en verwysings is nie. Hulle verwar die twee dikwels om dieselfde te wees. Hulle is egter verskillend en word in verskillende kontekste met elke opstel of artikel of boek gebruik.

Bibliografie is 'n lys van al die materiaal wat geraadpleeg is tydens die skryf van 'n opstel of 'n boek. Verwysings, aan die ander kant, is dié waarna in jou artikel of boek verwys is.

Jy het dalk baie boeke, opstelle en webwerwe geraadpleeg om iets te skryf. Alhoewel jy dalk daarna verwys het terwyl jy 'n opskrif voorberei het, is die inhoud daarvan dalk nie in die werklike teks ingesluit nie. Dit is wat na bibliografie verwys. Verwysings is dié wat direk in jou werklike teks ingesluit is.

Terwyl verwysings direk in die teks aangehaal word, word bibliografie nie direk in die teks aangehaal nie. Alhoewel verwysings gebruik kan word om jou stelling of argument te ondersteun, het 'n bibliografie nie sulke rolle nie. As sodanig word verwysings gebruik om iets op 'n meer gesaghebbende manier te vestig. Lesers kan jou verwysings verwys en die korrektheid van jou stelling evalueer. Intussen ondersteun bibliografie nie jou argument nie maar jy verwys hulle net op 'n persoonlike manier.

'n Bibliografie sal alle navorsingsmateriaal bevat, insluitend boeke, tydskrifte, tydskrifte, webwerwe en wetenskaplike referate, waarna u verwys het. Verwysings bevat bron van materiaal soos aanhalings of tekste, wat eintlik gebruik is tydens die skryf van 'n opstel of boek.

Beide bibliografie en verwysings verskyn aan die einde van 'n dokument. Maar bibliografie kom na die verwysingslys. 'n Bibliografie kan almal bevat wat in die verwysingslys verskyn het, maar dit kan ook bykomende werke bevat.

Beide bibliografie en verwysings is alfabeties gerangskik. Maar 'n verwysingslys kan ook in Numeriese styl gerangskik word, wat beteken om die verwysings volgens die nommers in die teks te rangskik.

Terwyl u 'n bibliografie skryf, moet u die skrywers se naam en voornaam, jaar van publikasie, naam van die boek, publikasieplek en naam van uitgewers insluit. Wel, 'n verwysingsbladsy kan genoem word as 'n voetnoot waar jy net die boek of webwerf skryf en die jaar van publikasie of die datum wanneer jy na die webwerf gekyk het.

Opsomming
1. Bibliografie is 'n lys van al die materiaal wat geraadpleeg is tydens die skryf van 'n opstel of 'n boek. Verwysings, aan die ander kant, is dié waarna in jou artikel of boek verwys is.
2. Bibliografie is nie direk in die teks ingesluit nie. Verwysings is dié wat direk in jou werklike teks ingesluit is.
3.Beide bibliografie en verwysings is alfabeties gerangskik. Maar 'n verwysingslys kan ook in numeriese styl gerangskik word,


Lae van die vel

Alhoewel jy dalk nie tipies aan die vel as 'n orgaan dink nie, is dit in werklikheid gemaak van weefsels wat as 'n enkele struktuur saamwerk om unieke en kritieke funksies te verrig. Die vel en sy bykomstige strukture maak die Huidstelsel, wat die liggaam van algehele beskerming bied. Die vel bestaan ​​uit veelvuldige lae selle en weefsels, wat deur bindweefsel aan onderliggende strukture vasgehou word (Figuur 1). Die dieper laag vel is goed gevaskulariseer (het talle bloedvate). Dit het ook talle sensoriese, en outonome en simpatiese senuweevesels wat kommunikasie na en van die brein verseker.

Figuur 1. Die vel bestaan ​​uit twee hooflae: die epidermis, gemaak van diggepakte epiteelselle, en die dermis, gemaak van digte, onreëlmatige bindweefsel wat bloedvate, haarfollikels, sweetkliere en ander strukture huisves. Onder die dermis lê die hipodermis, wat hoofsaaklik uit los bind- en vetweefsel bestaan.


Materiale en metodes

Materiaal

TMRM en JC-1 probes was van Invitrogen Life Technologies (Carlsbad, CA, VSA en Dun Laoghaire, Ierland). Amersham™ ECL™ Prime Western kladreagens was van GE Healthcare Life Sciences (Waukesha, WI, VSA), voorafgemaakte akrielamiedgels, loop- en oordragbuffers was van GeneScript (Piscataway, NJ, VSA), RIPA buffer, BCA™ Protein Assay kit en vooraf gekleurde proteïenladder was van Thermo Fisher Scientific (Rockford, IL, VSA). CellTiter-Glo® ATP Assay was van Promega (Madison, WI, VSA). PhosphoStop Fosfatase Inhibeerder en volledige Protease Inhibeerder Cocktail Tablette was van Roche (Dublin, Ierland). Dulbecco's Modified Eagle's medium (DMEM), Roswell Park Memorial Institute (RPMI) media, sikloheksimied en al die ander reagense was van Sigma-Aldrich (St. Louis, MO, VSA). Primêre en sekondêre teenliggaampies word in Addisionele lêer 4 gelys. Plastiek en glasware was van Sarstedt (Ierland), Corning Life Sciences (Corning, NY), Greiner Bio One (Frickenhausen, Duitsland) en Pecon (Erbach, Duitsland).

Weefselkultuur en eksperimentele toestande

PC12-selle van ATCC (<40 gange) is in suspensie in RPMI 1640-medium aangevul met NaHCO gehou3, 2 mM L-glutamien, 10% perdeserum, 5% fetale beeserum, 100 U/ml penisillien en 100 μg/ml streptomisien, in 'n bevochtigde broeikas gestel op 5% CO2 en 37°C. Vir alle eksperimente is PC12-selle gesaai teen 4 tot 6 × 10 4 selle/cm 2 op 75 cm 2 flesse, 10 cm of 15 cm Petri-skottels en 96-put plate (almal bedek met kollageen IV teen 0,01 mg/ml) of 4.2 cm glasdekstrokies (PeCon, Erbach, Duitsland), bedek met 'n mengsel van kollageen IV en poli-D-lisien [50]. Selle is vir tot 3 dae in die adherente toestand gehou. In 'n sel monolaag O2 word meer eenvormig versprei as in klein klampe, algemeen vir PC12-selsuspensie [51], daarom is verwag dat dataveranderlikheid laer sou wees vir adherente selle.

OGD en OD eksperimente

Media vir OGD en O2 ontneming (OD) is soortgelyk aan [50] soos volg voorberei. Poeier DMEM (Sigma, katalogusnommer 5030) is hersaamgestel in gedeïoniseerde water, gebuffer met 20 mM HEPES (pH 7.2) en filter-gesteriliseer. Deur hierdie gewone DMEM te gebruik, is die eksperimentele medium saamgestel deur toevoeging van 10 mM glukose, 2 mM glutamien en 1 mM piruvaat (OD-medium) of slegs glutamien en piruvaat (OGD). Geen serum is bygevoeg nie. Media is vir 20 uur by 0% O geëquilibreer2 met behulp van die hipoksie-werkstasie (Coy Laboratory Products, Grass Lake, MI, VSA). Media deoksigenasie is gemonitor met behulp van vooraf gekalibreerde fosforescerende dOxyBead™-sensors (Luxcel Biosciences, Cork, Ierland) en OpTech™ O2 Platinum handverklikker (Mocon, MN, VSA) (Figuur A1 in Addisionele lêer 1).

Aanhangende selle gegroei in 'n gereelde CO2 broeikas is na die hipoksie-werkstasie (Coy) oorgeplaas en met 95% N geëquilibreer2 en 5% CO2 (0% O2) by 37°C. Groeimedium is vinnig vervang met gedeoksigeneerde OGD- of OD-media: 20 ml vir 15 cm Petri-bak, 10 ml vir 10 cm-bak, 1 ml vir 4.2 cm dekstrook, 100 μl vir 1 put van 'n 96-put plaat. Selle is dan vir 20 minute, 40 minute, 1 uur, 2 uur en 4 uur in anoksiese toestande geïnkubeer. Kontroleselle is blootgestel aan die geoksigeneerde OGD of OD media onder normoksie vir 1 uur. Op die tydpunte wat aangedui is, is selle vinnig uit die werkstasie onttrek en aan ontleding onderwerp.

Generering van ribo-seq en mRNA-seq biblioteke

Die ribosomale profileringstegniek is uitgevoer soos in Ingolië et al. [52] maar met 'n paar wysigings soos uiteengesit in Andreev et al. [31]. Biblioteke is op 'n Illumina HiSeq 2000-stelsel by die Beijing Genomics Institute (BGI) gerangskik.

Proteïenisolasie en Western blotting-analise

Standaardanalise van heelsel-lisate wat met RIPA-buffer voorberei is, is uitgevoer met behulp van western blotting-analise soos in Zhdanov et al. [50]. Kwantitatiewe data-analise is uitgevoer met die ImageJ-program met behulp van α-tubulien seine vir normalisering. Beelde is met Picasa-, Photoshop- en Illustrator-programme verwerk. Eksperimente is in drievoude uitgevoer.

ATP meting

Sellulêre ATP is gemeet met behulp van CellTiter-Glo® Assay (Promega), wat voorsiening maak vir die eindpunt hoë deurset kwantitatiewe analise van sellulêre energie toestand. Voorafgemengde kit-reagense (100 μl) is direk in die hipoksie-werkstasie by die selle gevoeg. Plate met sellisate is na normoksie oorgedra. Na intensiewe skud is die lysate oorgedra na wit 96-put plate (Greiner Bio One, Frickenhausen, Duitsland) en hul luminesensie is gemeet op 'n Victor 2 leser.

Meting van die mitochondriale membraanpotensiaal

Vir die monitering van die mitochondriale membraanpotensiaal (ΔΨm) het ons twee kommersiële fluoresserende probes, TMRM en JC-1, gebruik. Wanneer dit gebruik word teen nie-bluskonsentrasies (1 tot 20 nM), versamel TMRM vinnig in gepolariseerde mitochondria en word maklik vrygestel uit gedepolariseerde mitochondria. TMRM is ook sensitief vir die veranderinge in die plasmamembraanpotensiaal, daarom is addisionele kontroles nodig vir ΔΨm-analise. Met die ophoping in die gepolariseerde mitochondria, vertoon JC-1 'n verdeling na groen en rooi fluoresserende spektra. Laasgenoemde word slegs geproduseer deur hoogs gepolariseerde ('energiseerde') mitochondria, wanneer JC-1 J-aggregate vorm. Om gelyke laaitoestande te verseker, het ons die selle by 21% O gekleur2 vir 25 minute (1 μM JC-1 en 20 nM TMRM). Die TMRM-sonde is gedurende die hele eksperiment in die media by 20 nM gehou. Vir beeldvorming is die dekstrokies met selle in 'n mini-hipoksiekamer in ongeveer 1 ml van die suurstofryke of gedeoksigeneerde medium toegesluit, met behulp van drie silikonringtoerusting en 'n tweede dekstrokie, wat saamgeplak is om lugdig te wees met 'n metaalbasis met die hulp van die skroefdop soos getoon in Figuur A1D in Addisionele lêer 1. Na inkubasie van die selle soos beskryf in die Resultate afdeling, is ΔΨm dan vinnig gemonitor (binne 10 minute) op 'n wye veld fluoressensie mikroskoop (Zeiss, Duitsland). TMRM is opgewonde met behulp van 'n 590 nm 10 mW LED met emissies wat by 604 tot 644 nm versamel is. JC-1 was opgewonde by 488 nm en 590 nm, terwyl dit emissies by 510 tot 550 nm en 604 tot 644 nm onderskeidelik versamel het.

Aanvanklike verwerking van volgorde biblioteke

Cutadapt [53] is gebruik vir die verwydering van die adapter volgorde (CTGTAGGCACCATCAATAGATCGGAAGAGCACACGTCTGAACTCCAGTCA). Die lesings is dan in lyn gebring met rRNA en die ingevoerde 'spike-in' (ATGTACACGGAGTCGACCCGCAACGCGA) om leeswerk wat van hierdie bronne afkomstig is, te verwyder. Lesings is in lyn gebring met die rot RefSeq geenkatalogus wat op Januarie 2014 van NCBI afgelaai is [54] met strikdas [55]. Die belyningsparameters wat gebruik is, was (−a -m 100 -v 2 -norc), dit wil sê, lees is in lyn gebring met die positiewe string wat nie meer as twee wanpassings en nie meer as 100 afbeeldings per lees toelaat nie.

Differensiële geenuitdrukking analise

Vir differensiële uitdrukkingsanalise het ons die aantal leeswerk bereken wat ooreenstem met 'n ekson-unie van 'n geen [56]. Enige leesbelyning na enige van die RefSeq-transkripsies wat van dieselfde geen afkomstig is, is een keer getel, ongeag die aantal isovorme waarmee dit belyn is. So 'n geensentriese benadering behoort 'n meer akkurate voorstelling van geenuitdrukking te verskaf as belyning met die langste transkripsie, aangesien selfs die langste transkripsie nie alle eksons kan bevat nie. Ongeveer 2% meer lees is in lyn gebring met die ekson-verenigings van die gene in vergelyking met die belyning na die langste transkripsies. Vir sekere gene (insluitend Nnat, My 16, Hut 1) het ons meer as 'n tweevoudige toename in die aantal belynde ribo-seq en mRNA-seq-lesings waargeneem.

Ribo-seq-lesings is aan mRNA-koördinate toegeken op grond van die afgeleide ligging van die A-plek. Die A-plek ligging is gestel op 17 nukleotiede stroomaf van die 5'-punt van lees van lengte 29 tot 33 ingesluit en 18 vir lees van lengte 34 en 35. Ribo-seq-lesings van lengte minder as 29 of groter as 35 is weggegooi. Vir gene wat transkripsies met 'n geannoteerde koderingsgebied gehad het, het ons slegs die ribo-seq-lesings gebruik wat daarmee ooreenstem. Andersins is die ribo-volgorde-lees wat na die hele transkripsie gekarteer is ingesluit (let op dat vir die mRNA-volgorde, die lesings wat met die hele transkripsie belyn is, gebruik is). Sommige ribo-seq-lesings is na meer as een streek van 'n transkripsie gekarteer. Ons het hulle aan unieke liggings toegeken op grond van die volgende prioriteitsvolgorde: acORF, 5′-leier, 3′ UTR.

Ongeveer 80% van gekarteerde ribo-seq-lesings is gekarteer na 'n enkele geen, 9% gekarteer na twee gene en 4% gekarteer na drie. Vir die mRNA-volgorde-lesings is hierdie waardes onderskeidelik 84%, 8% en 3%. Dubbelsinnig belynde leesstukke wat na meer as drie liggings belyn is, is weggegooi. Die gewig van lees wat in lyn is met twee of drie liggings, is onderskeidelik met 2 en 3 verminder.

Normalisering (die herskaling van leestellings om die verskille te verwyder as gevolg van die totale aantal gekarteerde leeswerk) en differensiële analise is uitgevoer met 'n benadering soortgelyk aan die een wat ons voorheen gebruik het [31]. Die leestellings wat ooreenstem met 'n kenmerk in die monster k is vermenigvuldig met die herskaalfaktor x[k]/min(x[i]) waar x[k] is die nommer van alle volgorde-lesings wat ooreenstem met alle kenmerke binne die monster k, en min(x[i]) is die getal van alle leeswerk wat ooreenstem met alle kenmerke in die voorbeeld i wat die kleinste aantal lesings het. Hierdie herskaling is onafhanklik uitgevoer vir die mRNA-volgorde en ribo-volgorde data, maar beide replikate is saam genormaliseer om vergelyking tussen replikate moontlik te maak.

Om DE-gene te identifiseer, het ons Z-telling transformasie van logverhoudings uitgevoer [16]. Gene is gegroepeer in houers van 300 gebaseer op die minimale vlak van hul uitdrukking (minimale aantal mRNA-volgorde, ribo-volgorde of albei afhangende van die analise). Die parameters van uitdrukking vou-verandering verspreiding is gebruik om plaaslike Z-telling vir elke geen te bereken. Die geen is geklassifiseer as DE verhoog as (Z 1 + Z 2)/2 > T en DE het afgeneem as (Z 1 + Z 2)/2 < −T, waar Z 1 en Z 2 is Z-tellings vir dieselfde geen verkry in twee replikas en T is die drempel. Die drumpel T is ingestel op grond van die verlangde FDR. Die aantal vals positiewe is geskat as die aantal gene waarvoor (|Z 1| + |Z 2|)/2 > T wanneer Z 1 Z 2 < 0 (sien Figuur 2B vir 'n grafiese illustrasie van die prosedure).

As gevolg van wanbelynings, amplifikasie-vooroordele en veranderinge in verlengingstempo's tussen die toestande, is die totale aantal lesings wat na 'n geen gekarteer is, nie noodwendig 'n akkurate voorstelling van sy uitdrukkingsvlak nie. Byvoorbeeld, 'n sterk toestand-afhanklike ribosoom wat op 'n spesifieke plek stilstaan, kan lei tot valse opregulering. 'n Geen is slegs as robuust gereguleer beskou as dit as gereguleer opgespoor is na uitsluiting van acORF-koördinate wat ooreenstem met die drie hoogste digtheidspieke van die ribosoomdigtheid vir elk van sy transkripsies. Die ontleding van piekuitsluiting effek op opsporing van differensieel uitgedrukte gene word geïllustreer in Figuur A10 in Addisionele lêer 1. In hierdie beeld is die gene gegroepeer deur die Scipy koppelingsfunksie deur gebruik te maak van die 'enkele' koppelingskriteria en 'hamming' kolomafstandmetriek.

Analise van paarsgewyse ooreenkoms van ribo-volgorde profiele van individuele mRNA's

Die paarsgewyse ooreenkoms tussen twee acORF ribo-seq profiele is geassesseer deur Pearson se korrelasiekoëffisiënte vir plaaslike voetspoordigthede van vergelykende profiele te bereken. Slegs ondubbelsinnig belynde ribo-seq-lesings is vir hierdie analise gebruik. Die posisie van die lesings wat in lyn is met die acORF-gebied is by 'n kodon bepaal, eerder as op 'n nukleotiedvlak. Slegs die langste transkripsievariante van elke geen wat 'n gemiddelde acORF-digtheid gehad het wat meer as een voetspoor per nukleotied in beide vergelykende monsters gehad het, is in hierdie analise gebruik. Vir die ontleding in Figuur A8B in Addisionele lêer 1 is die proses herhaal deur gebruik te maak van belynings wat geproduseer is deur 'n ewekansige steekproefneming van 'n vaste aantal lesings vir elke mRNA uit die werklike data. In elke paarsgewyse vergelyking, vir die toestande met die hoër volgorde dekking, is ribo-seq leess gemonster vanaf die oorspronklike belyning totdat die aantal leess gelyk is aan dié vir 'n toestand met laer volgorde dekking. Die gemiddelde paarsgewyse Pearson se koëffisiënt van hierdie profiele is gebruik om die verspreiding te produseer.

Identifikasie van gene met lekkende terminasie

Die profiele van transkripsies wat 'n totale aantal ribo-seq-lesings gehad het wat ooreenstem met hul 3′ UTR groter as 20, is met die hand ondersoek. Dubbelsinnige belynings is ingesluit. Die seleksie is gemaak sonder vooraf kennis van die stopkodon identiteit en nukleotiedkonteks. Die konteks van beëindigingswebwerwe is gevisualiseer met behulp van 'n volgorde-logo wat met weblogo vervaardig is [30]. Die verhouding van ribo-seq leesdigtheid (Alignments by ORF/Length of ORF) by die acORF en stroomaf ORF is gebruik om stopkodon lees-deur doeltreffendheid te meet.

Identifikasie van vertaalde uORF'e

Die waarskynlikheid dat die verspreidings van hoogs getransleerde gene met en sonder 'n vertaalde uORF (Figuur 4A) uit dieselfde verspreiding gemonster word, is bereken deur Wilcoxon rangsom toets geïmplementeer met die rangsomme funksie in Scipy biblioteek. Om die genepoel vir diegene met regulatoriese uORF's te verryk, het ons die verskuiwing van die middelpunt van ribosoomdigtheid ontleed [31]. Om die middelpunt van ribosoomdigtheid te bepaal, het ons eers 'saamgeperste profiele' vervaardig, waar elke koördinaat van 'n mRNA-profiel wat nie 'n belyning in ten minste een van die tydpunte bevat het nie, verwyder is. Dit het die voordeel dat dit 'n meer robuuste resultaat lewer met 'n yl aantal leeswerk. Die middelpunt van ribosoomdigtheid is gedefinieer as die minimale koördinaat van 'n saamgeperste profiel waarteen die kumulatiewe aantal ribo-seq leess wat stroomop daarvan in lyn is, die kumulatiewe aantal leess stroomaf daarvan oorskry. Die verskuiwing van die middelpunt is gemeet relatief tot die lengte van die vertaalde streke van mRNA's, dit wil sê, gedeel deur die aantal koördinate met ten minste een ribo-volgende leesbelyning. Die verandering van middelpunt van digtheid is verkry vir alle geannoteerde koderingstranskripsies met meer as 64 ribo-volgorde leesbelynings. Profiele van meer as 200 transkripsies met die grootste gemiddelde verskuiwing van digtheid na die 5′ einde na 1 uur van OGD (Figuur 4B) is handmatig geëvalueer.

Aangesien die sterkste triplet periodisiteit waargeneem is met ribo-seq-lesings van 31 nukleotiede lank, is hierdie alleen gebruik vir die ontleding van die triplet-periodisiteitsein. Om gevalle met 'n atipiese periodisiteit te identifiseer, het ons die belynings na die eerste 50 koördinate van die acORF gebruik. Vir die meeste transkripsies is ongeveer 20% van lesings in lyn met die derde subkodonposisie, 'n hoër proporsie van ribo-seq leess wat by die derde subkodonposisie belyn is, beskou as 'n aanduiding van triplet periodisiteit distorsie. Transkripsies wat minder as 50 koördinate bevat met belynde ribo-volgorde-lesings is uitgesluit van hierdie analise.

Produksie van metageenprofiel by aanvangs- en beëindigingsterreine

'n Transkripsie wat gebruik word vir die generering van 'n metageenprofiel is gekies om aan die volgende kriteria te voldoen: 1) dit is die langste onder ander transkripsievariante vir die ooreenstemmende geen 2) dit het ten minste 100 gekarteerde belynings 3) sy lengte is groter as 600 nukleotiede 4) die lengte van beide sy 5′-leier en 3′ UTR is groter as 45 nukleotiede. Elke individuele transkripsieprofiel 45 nukleotiede stroomop van die aanvangsplek en 45 nukleotiede stroomaf van die terminasieplek is genormaliseer deur die gemiddelde geendigtheid voor aggregasie deur die bepaling van 'n posisie-spesifieke gemiddelde. Dit is omgeskakel na die gemiddelde aantal belynings per kodon.

Analise van biologiese weë

Die 3 000 gene wat gevind is om die grootste absolute gemiddelde ribo-seq Z-telling te hê na 60 minute van OGD (DE verhoog en DE verminder) is gebruik vir geenontologie en KEGG-wegverrykingsanalise deur DAVID [57] te gebruik. Die statistiese betekenisvolheid van geenverryking is gekorrigeer vir meervoudige toetsing deur gebruik te maak van die Benjamini-Hochberg metode. DE-gene wat gevind is om aan oksidatiewe fosforilering en die TCA-siklus te behoort, word uitgelig in Figure A4 en A5 in Addisionele lêer 1.

RHRE-bevattende en mTOR-sensitiewe mRNA's

Die lys van transasioneel gereguleerde PP242-responsiewe gene van Aanvullende Figuur 5 van Hsieh et al. [19] is gebruik as 'n stel mTOR-sensitiewe gene. Die stel transkripsies wat rHRE bevat is gebou uit Aanvullende data 2 van Uniacle et al. [8] vereis ten minste drie PAR-CLIP leeswerk wat die EPAS1/RBM4 teiken ondersteun.

Alle berekeninge en plotte is geproduseer met pasgemaakte python-skrifte met behulp van Matplotlib-biblioteek.

Data toegang

Sekwensies van ribo-volgens en mRNA-volgens cDNA-biblioteke is in die NCBI Genoom-uitdrukking Omnibus (GEO) onder toegangsnommer GSE60752 gedeponeer.


Kyk die video: Scribes References API (Oktober 2022).