Inligting

Is die hoeveelheid dNTP's tempo beperkend vir baie lang PCR-produkte?

Is die hoeveelheid dNTP's tempo beperkend vir baie lang PCR-produkte?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ek gebruik die Q5-stelsel en ek PCRing 'n produk wat 'n finale lengte van ongeveer 9500 basisse sal hê. Ek het opgemerk dat die produk daar is, maar baie flou. Dit lyk asof die onderlaag opgebruik is.

So my vraag is, kan die dNTP's koersbeperkend wees in 'n lang reaksie? Dit wil sê, kan al die dNTP's in die eerste PCR-siklusse opgebruik word en dalk nie beskikbaar wees vir die latere eksponensiële rondtes nie?

Dit blyk dat jy ongeveer 1000 keer die hoeveelheid dNTP's het as die hoeveelheid primer (200 µM in vergelyking met 0.2 µM). So miskien ... of is my basiese chemie af. Enige voorrang?


200uM dNTP's in 50ul reaksiemengsel kan meer as 10ug DNA produseer as alle dNTP's verbruik word, ongeag die lengte van PCR-produkte. Jy kan so laag as 5ng DNA-fragmente opspoor deur konvensionele elektroforese met EtBr. Jy kan waarskynlik 'n duidelike band sien wanneer jy meer as 100 ng van 'n DNS-fragment laai. Daarom is ek nie veel bekommerd oor die dNTP-konsentrasie nie.

Hoe langer PCR-produkte jy versterk, hoe moeiliker is dit om te versterk. Dan kry jy dalk nie genoeg doeltreffendheid om jou PCR-produkte op te spoor nie. Jy sal dalk 'n laer uitgloeitemperatuur wil probeer as jy geen nie-spesifieke bande kry met/sonder sommige bymiddels soos DMSO, betain, ens., of gebruik sterker ensieme. Touch-down PCR kan ook nuttig wees om spesifieke bande doeltreffend te kry.

Wanneer jy dNTP-konsentrasie verhoog, kan Mg++-effekte gedemp word omdat dNTP Mg++ kan chelaat soos Chris in die kommentaarkolom genoem het.


Sifting van die tempo-beperkende gene in die ω6 poli-onversadigde vetsuur biosintese pad in Nannochloropsis oceanica

Die Δ9 desaturase in Nannochloropsis oceanica steariensuur as die substraat verkies.

Die Δ9-desaturase was betekenisvol geassosieer met mono-onversadigde vetsuursintese.

Die Δ12, Δ5, en Δ17 desaturases was tempo-beperkende ensieme in poli-onversadigde vetsuur sintese.

Hoë stikstof en lae temperatuur behandelings het 'n rol gespeel in die sintese van poli-onversadigde vetsuur.

Lae stikstof en hoë temperatuur was voordelig vir die ophoping van mono-onversadigde vetsure.


Vooruitgang in Stralingsbiologie

Andrew R.S. Collins, Robert T. Johnson, in Advances in Radiation Biology, 1984

D Die relevansie van DNA-voorloperpoele om te herstel

Van die vier deoksiribonukleosiedtrifosfaat (dNTP) poele in S-fase muis embrioselle, is die dCTP poel die grootste en die dGTP poel verreweg die kleinste (Skoog en Nordenskjöld, 1971). Die hoeveelheid dGTP, voldoende vir slegs 15–30 sekondes se DNA-sintese, verminder baie vinnig met byvoeging van HU. Die sluiting van DNA-sintese wat deur HU veroorsaak word, volg baie noukeurig die kinetika van dGTP-poeluitputting. Veranderinge in die ander trifosfaatpoele is gevarieerd en kompleks, maar konsekwent met 'n inhibisie van verdere sintese deur die werking van HU op ribonukleotiedreduktase. Herstelsintese sal eweneens verwag word om op te hou wanneer die produksie van voorlopers geblokkeer word, maar die aantal nukleotiede wat nodig is vir herstel is klein in vergelyking met dié wat nodig is vir replikasie, en daarom behoort herstel-DNS-sintese vir 'n geruime tyd voort te gaan, teen 'n tempo wat voortdurend afneem soos die swembad uitgeput raak.

Betekenisvol is die vermoë om inhibisie deur HU van herstelinkorporasie in ongestimuleerde limfosiete wat met MMS behandel is te demonstreer (Tabel I Lieberman et al., 1971) korreleer met die uiters klein poele DNA-voorlopers (veral dTTP) in hierdie selle (Munch-Petersen) et al., 1973 Tyrsted, 1975). UV-geïnduseerde herstelinkorporering in soortgelyke selle was egter nie sensitief vir HU nie (Evans en Norman, 1968).

'n Spesiale geval word voorgestel deur S-faseselle wat herstel sowel as replikatiewe sintese ondergaan as hulle 'n gemeenskaplike voorloperpoel deel, herstel en replikasie behoort dieselfde vinnige en ernstige inhibisie te ondervind wanneer HU bygevoeg word. Ons het hierdie voorspelling in S-fase HeLa-selle getoets, wat herstel van repliserende DNA geskei het deur CsCl-gradiënt sedimentasie na inkubasie met [3H]BUdR, en gevind (Fig. 14 Downes en Collins, 1982) dat die inkorporering van 3H as gevolg van replikatiewe sintese is selektief geïnhibeer deur HU (met ara C). Dit blyk dus dat herstel en replikasie nie 'n gemeenskaplike poel deel nie, of dat die herstelpolimerase verskil van die replikatiewe polimerase deur 'n hoër affiniteit vir dNTP's te hê.

Fig. 14 . Herstel replikasie in S-fase HeLa selle weerstand teen inhibisie deur HU en ara C. CsCl gradiënt sedimentasie van DNA geïsoleer na inkubasie van UV-bestraalde (10 J m −2) (Δ, ▴) of onbestraalde (O, •) selle met BUdR en [3 H]timidien, met (•, ▴) of sonder (O, Δ) HU (10 −2 M) en ara C (10 −4 M). Sedimentasie van links na regs. Die pieke in (A) verteenwoordig BUdR-gemerkte gerepliseerde DNA. (B) is 'n vergrote aansig van die boonste deel van die gradiënte, wat 'n piek toon by breuk 12 as gevolg van herstel inkorporasie van BUdR in normale-digtheid DNA. Hierdie piek word duidelik nie verminder deur HU en ara C nie.

(Uit Downes en Collins, 1982, met toestemming van IRL Press Ltd.)

Replikatiewe DNA-sintese word blykbaar uitgevoer deur 'n ensiemkompleks, waarna verwys word as "replitase", wat onder andere DNA-polimerase α, ribonukleotiedreduktase en timidienkinase (Baril) bevat et al., 1974 Reddy en Pardee, 1980). Hierdie kompleks versamel in die kern tydens S-fase (Reddy en Pardee, 1980). In gepermeabiliseerde selle is ribonukleosied difosfate (rNDP's) bo dNTP's verkies as substrate vir DNA-sintese, en Reddy en Pardee (1980) stel voor dat replitase rNDP's, via ribonukleotied reduktase, na die presiese plek van replikasie in die kern kanaliseer. Ciarrocchi et al. (1979) rapporteer dat replikatiewe sintese, in 'n soortgelyke gepermeabiliseerde selstelsel, timidien bo dTTP as substraat verkies het (terwyl herstelsintese optimaal was met dTTP). Hierdie bevinding stem ooreen met dié van Reddy en Pardee, aangesien timidienkinase 'n komponent van replitase is. Herstelsintese in gepermeabiliseerde selle na bleomisienbehandeling is relatief onsensitief vir inhibisie deur HU, in vergelyking met replikatiewe sintese (Castellot) et al., 1979). 'n Sintese van hierdie bevindinge dui daarop dat replikasie die gekoördineerde fosforilering en reduksie van rNDP's (of fosforilering van deoksiribonukleosiede) behels onmiddellik voor polimerisasie (vandaar die uiterste sensitiwiteit daarvan vir HU, wat deur die blokkering van die ribonukleotied reduktase komponent moontlik kan veroorsaak dat die hele kompleks funksioneer ) en gebruik nie normaalweg die sel se dNTP-poel nie, terwyl herstelsintese heeltemal goed uitgevoer kan word deur die bestaande trifosfate te gebruik.


Resultate

Ons het 'n prototipe instrument gebou om temperatuursiklus 1- tot 5-μL-monsters in 0.4-2.0 s deur hitte-oordrag vanaf warm of koue water (sien aanlyn Aanvullende Fig. 1). Monsters in dun kapillêre buise of staalnaalde is meganies tussen waterbaddens omgedraai om die verlangde temperatuursiklusprofiel te verkry. Die PCR oplossing temperatuur is gemeet deur 'n fyndraad termokoppel in 'n parallelle beheerbuis.

'n 45-bp-fragment van die enkelkopie-geen KCNE1 (kalium spanning-omheinde kanaal, Isk-verwante familie, lid 1) is geamplifiseer vanaf menslike genomiese DNA deur óf uiterste PCR óf konvensionele vinnige-siklus PCR op 'n karrousel LightCycler® instrument (Fig. 1). Vyf-en-dertig siklusse van uiterste PCR het 28 s (0.8 s/siklus) vereis, terwyl vinnige-siklus-PKR in 12 min (20.6 s/siklus) voltooi is. Uiterste PCR is voltooi voordat 2 siklusse op die vinnige siklus-instrument voltooi kon word (Fig. 1A). Beide metodes het amplikone met soortgelyke smeltkurwes en sterk, spesifieke bande op gelelektroforese geproduseer, alhoewel uiterste PCR groter opbrengs as vinnige-siklus-PKR getoon het (Fig. 1, B en C). Die reaksiekomponente vir ekstreme en vinnige siklus-PKR was identies behalwe vir die hoeveelheid polimerase en primers. Robuuste PKR wat 0.8-s-siklusse gebruik, het onderlaagkonsentrasies ≥10 μmol/L en 'n polimerasekonsentrasie ≥1 μmol/L vereis. Hoë polimerase en primer konsentrasies is gerapporteer om opbrengs te verhoog in vinnige-siklus en real-time PCR (4, 16). Ten spyte van hoë polimerase en primer konsentrasies, het uiterste PCR slegs die spesifieke produk gegenereer. Lae molekulêre gewig primer bande was sigbaar in beide reaksies met en sonder templaat. Wanneer geëvalueer elke 10 siklusse, produk was eerste sigbaar by 30 siklusse, platoing by 40-60 siklusse (Fig. 1D). By die genomiese sjabloonkonsentrasies wat gebruik word, is Cq-waardes by hoë doeltreffendheid gewoonlik in die lae 20's, so ons sou verwag dat gelbande afwesig kan wees teen 20 siklusse, veral met kleurstofopsporing van 'n klein 45-bp produk.

DNA-amplifikasie van 'n 45-bp-segment van KCNE1 deur 35 siklusse van uiterste PCR (<30 s) en konvensionele vinnige-siklus PCR (12 min) 'n 20-voudige toename in [primer] (10 vs 0.5 μmol/L) en 'n 16-voudige toename in [polimerase] (1.0 vs. 0,064 μmol/L) het 'n 26-voudige vermindering in amplifikasietyd toegelaat.

(A), Monster temperatuur teenoor tyd vir 35 siklusse van uiterste PCR (0.8 s/siklus in rooi) en vinnige-siklus PCR (20.6 s/siklus in blou, verkry op 'n karrousel LightCycler). (B), Hoë-resolusie smelt van PCR-produkte geamplifiseer vanaf menslike genomiese DNA en geen-sjabloonkontroles (NTC's). Die Tm van die uiterste PCR-produk is effens minder as dié van die vinnige siklus produk as gevolg van 'n verskil in gliserol konsentrasies (1.3% vs 0.1%, vol/vol, onderskeidelik) wat voortspruit uit die polimerase stoor buffers. Die y-as-etiket, afgekort as −dF/dT, is die negatiewe eerste afgeleide van fluoressensie met betrekking tot temperatuur. (C), Agarose gel elektroforese na uiterste (0.8 s siklusse) en vinnige siklus (20.6 s siklusse) PCR. Die onderste bande korreleer met hoë onderlaagkonsentrasies. (D), Agarose gel elektroforese na 10-60 siklusse van uiterste PCR.

(A), Monster temperatuur teenoor tyd vir 35 siklusse van uiterste PCR (0.8 s/siklus in rooi) en vinnige-siklus PCR (20.6 s/siklus in blou, verkry op 'n karrousel LightCycler). (B), Hoë-resolusie smelt van PCR-produkte geamplifiseer vanaf menslike genomiese DNA en geen-sjabloonkontroles (NTC's). Die Tm van die uiterste PCR-produk is effens minder as dié van die vinnige siklus produk as gevolg van 'n verskil in gliserol konsentrasies (1.3% vs 0.1%, vol/vol, onderskeidelik) wat voortspruit uit die polimerase stoor buffers. Die y-as-etiket, afgekort as −dF/dT, is die negatiewe eerste afgeleide van fluoressensie met betrekking tot temperatuur. (C), Agarose gel elektroforese na uiterste (0.8 s siklusse) en vinnige siklus (20.6 s siklusse) PCR. Die onderste bande korreleer met hoë onderlaagkonsentrasies. (D), Agarose gel elektroforese na 10-60 siklusse van uiterste PCR.

Die effek van polimerase en primer konsentrasies in PCR met <1-s siklusse is bestudeer deur gebruik te maak van 'n 49-bp fragment van IL10RB (interleukin-10 reseptor, β), getoon as beide 2-dimensionele (Fig. 2A) en 1-dimensionele (Fig. 2, B en C) data. Produkopbrengs is na 35 siklusse bepaal, met 'n gemiddelde siklustyd van 0.73 s tussen 92 °C en 63 °C. Slegs met onderlaagkonsentrasies ≥5 μmol/L en polimerasekonsentrasies ≥1 μmol/L is PCR-produkte opgespoor. Deur gebruik te maak van 19-gauge hipodermiese naalde as reaksiehouers, 20 μmol/L primers en 8 μmol/L polimerase, is die tyd om die 49-bp fragment te versterk verder verminder tot 16 s deur gebruik te maak van 35 siklusse tussen 92 °C en 65 °C ( Fig. 2D). Verder was genotipering deur hoë-resolusie smelt suksesvol op 'n 58-bp segment van IL10RB flankeer 'n A>G variant na 'n 38-s PCR met 10 μmol/L primers en 2 μmol/L polimerase (sien aanlyn Aanvullende Fig. 3).

Uiterste PCR-versterking van 'n 49-bp-segment van IL10RB.

(A), Polimerase en primer optimalisering vir produk opbrengs na 35 siklusse van 0,73 s elk. PKR produk opbrengs is gemeet as die piek van afgeleide smeltkurwe plotte. (B), Afgeleide smeltkurwes demonstreer die effek van onderlaagkonsentrasie op produkopbrengs wanneer 4 μmol/L polimerase gebruik word. (C), Agarose-gel wat die effek van polimerasekonsentrasie op amplifikasie-opbrengs toon deur 10 μmol/L van elke onderlaag te gebruik. (D), Sestien-sekonde versterking van die 49-bp segment van IL10RB (35 siklusse, 0.45 s/siklus) deur gebruik te maak van 19-gauge hipodermiese naalde as reaksiehouers met 20 μmol/L van elke onderlaag en 8 μmol/L polimerase. NTC, geen-sjabloonbeheer. -dF/dT, negatiewe eerste afgeleide van fluoressensie met betrekking tot temperatuur.

(A), Polimerase en primer-optimering vir produkopbrengs na 35 siklusse van 0,73 s elk. PKR produk opbrengs is gemeet as die piek van afgeleide smeltkurwe plotte. (B), Afgeleide smeltkurwes demonstreer die effek van onderlaagkonsentrasie op produkopbrengs wanneer 4 μmol/L polimerase gebruik word. (C), Agarose-gel wat die effek van polimerasekonsentrasie op amplifikasie-opbrengs toon deur 10 μmol/L van elke onderlaag te gebruik. (D), Sestien-sekonde versterking van die 49-bp segment van IL10RB (35 siklusse, 0.45 s/siklus) deur gebruik te maak van 19-gauge hipodermiese naalde as reaksiehouers met 20 μmol/L van elke onderlaag en 8 μmol/L polimerase. NTC, geen-sjabloonbeheer. -dF/dT, negatiewe eerste afgeleide van fluoressensie met betrekking tot temperatuur.

Optimale polimerase en primer konsentrasies is ook bestudeer met 'n 102-bp fragment van NQO1 met behulp van 1.93-s siklusse tussen 92 °C en 72 °C (sien aanlyn Aanvullende Fig. 4). Soortgelyk aan die 49-bp IL10RB teiken, het amplifikasie beide verhoogde primers (≥2 μmol/L) en polimerase (≥0.5 μmol/L) vereis. Soos die fragmentgrootte egter toeneem, is langer uitgloei-/verlengtye nodig vir volledige verlenging, en laer reagenskonsentrasies kan gebruik word.

Die uiterste PCR-prototipe is verder aangepas om optika vir intydse monitering in te sluit (sien aanlyn Aanvullende Fig. 2 en Aanvullende Video). Die kwantitatiewe prestasie van uiterste PCR vir die 102-bp fragment van NQO1 [NAD(P)H dehidrogenase, kinoon 1] (Fig. 3) en die 45-bp fragment van KCNE1 (sien aanlyn Aanvullende Fig. 5) is beoordeel deur gebruik te maak van 'n verdunningsreeks van menslike genomiese DNA. Met 'n dinamiese reeks van ten minste 4 logs, was die versterkingsdoeltreffendheid bereken vanaf die kalibrasiekrommes 95.8% vir NQO1 en 91,7% vir KCNE1, soortgelyk aan konvensionele PCR. Kontrolereaksies sonder templaat het nie na 50 siklusse versterk nie. Enkelkopie-herhalings (gemiddelde kopiegetal van 1,5 kopieë per reaksie) was soortgelyk in amplifikasiekrommevorm en intensiteit aan hoër konsentrasies (Fig. 3 en aanlyn Aanvullende Fig. 5). By 'n gemiddelde kopiegetal van 0.15 kopieë/reaksie was 2 reaksies positief uit 17 (wat albei kombineer NQO1 en KCNE1 proewe), met 'n berekende verwagting van 0,13 kopieë/reaksie deur binomiale uitbreiding (uCount for digitale PCR, https://dna.utah.edu/ucount/uc.php verkry op 7 Mei 2014).

Doeltreffendheid en sensitiwiteit word nie deur uiterste PCR benadeel nie.

(A), Fluoresensie versus siklusgetal. (B), Cq teenoor log10 (aanvanklike sjabloon kopieë) plotte vir amplifikasie van 'n 102-bp fragment van NQO1 (50 siklusse, 1,93 s/siklus). Reaksies is in viervoud uitgevoer met 2 μmol/L polimerase en 8 μmol/L van elke onderlaag. Die berekende doeltreffendheid was 95,8%.

(A), Fluoresensie versus siklusgetal. (B), Cq teenoor log10 (aanvanklike sjabloon kopieë) plotte vir amplifikasie van 'n 102-bp fragment van NQO1 (50 siklusse, 1,93 s/siklus). Reaksies is in viervoud uitgevoer met 2 μmol/L polimerase en 8 μmol/L van elke onderlaag. Die berekende doeltreffendheid was 95,8%.

Ons het ook die verlengingstyd wat benodig word vir verskillende produklengtes ondersoek deur gebruik te maak van intydse PCR (Fig. 4). Om moontlike verwarrende effekte van verskillende primers te vermy, sintetiese sjablone van 100–500 bp met algemene hoë smelttemperatuur (Tm, 77 °C) primers is gebruik. Optimale konsentrasies van primers en polimerase is eers bepaal vir die 300-bp produk deur gebruik te maak van 'n 4-s gekombineerde uitgloei/verlenging segment met 4.9-s siklusse (Fig. 4A). Identiese onderlaag (4 μmol/L) en polimerase (2 μmol/L) konsentrasies is toe vir alle produklengtes gebruik, en minimum verlengingstye is bepaal (sien aanlyn Aanvullende Fig. 6). Vir elke produklengte het verhoogde uitgloei-/verlengtye gelei tot verlaagde fraksionele Cq-waardes totdat geen verdere verandering waargeneem is nie, wat die minimum verlengingstyd wat benodig word vir doeltreffende PCR weerspieël. Byvoorbeeld, amplifikasiekurwes deur gebruik te maak van die KAPA2G FAST polimerase vir die 500-bp produk word in Fig. 4B getoon. Die minimum verlengingstyd deur gebruik van KAPA2G FAST polimerase was 3 s, in vergelyking met 7 s deur gebruik van KlenTaq1 ('n delesie mutant van Taq polimerase). Langer produkte het langer verlengingstye vereis (Fig. 4C). Vir KlenTaq1-polimerase word ongeveer 1 s benodig vir elke 60 bps, terwyl vir KAPA2G FAST, 1 s benodig word vir elke 158 bps.

Vereiste verlengingstye hang af van PCR-produklengte en die tipe polimerase wat vir amplifikasie gebruik word.

(A), Polimerase en primer optimalisering vir die amplifikasie van 'n 300-bp sintetiese templaat (20 siklusse, 4.9 s/siklus). ’n Gekombineerde uitgloei/verlengingstap van 4 s by 76 °C is vir amplifikasie gebruik. (B), Fluoresensie vs siklusgetal plotte vir PCR-amplifikasie van 'n 500-bp sintetiese sjabloon met behulp van KAPA2G FAST polimerase en 1- tot 5-s verlengingstye. (C), Minimum waargenome verlengingstye benodig vir doeltreffende amplifikasie van 100- tot 500-bp sintetiese sjablone deur 2 μmol/L polimerase en 4 μmol/L van elke onderlaag te gebruik. Die verlengingslengtes is kleiner as die produklengtes om rekening te hou met die onderlaag. 'n Benaderde vergelyking wat produkgrootte in verband bring (bl) in basispare tot die voorspelde minimale verlengingstyd (t) in s is t = 0.016bl − 0.2 met 2 μmol/L KlenTaq-polimerase en 4 μmol/L van elke onderlaag by 76 °C. -dF/dT, negatiewe eerste afgeleide van fluoressensie met betrekking tot temperatuur.

(A), Polimerase en primer optimalisering vir die amplifikasie van 'n 300-bp sintetiese templaat (20 siklusse, 4.9 s/siklus). ’n Gekombineerde uitgloei/verlengingstap van 4 s by 76 °C is vir amplifikasie gebruik. (B), Fluoresensie vs siklusgetal plotte vir PCR-amplifikasie van 'n 500-bp sintetiese sjabloon met behulp van KAPA2G FAST polimerase en 1- tot 5-s verlengingstye. (C), Minimum waargenome verlengingstye benodig vir doeltreffende amplifikasie van 100- tot 500-bp sintetiese sjablone deur 2 μmol/L polimerase en 4 μmol/L van elke onderlaag te gebruik. Die verlengingslengtes is kleiner as die produklengtes om rekening te hou met die onderlaag. 'n Benaderde vergelyking wat produkgrootte in verband bring (bl) in basispare tot die voorspelde minimale verlengingstyd (t) in s is t = 0.016bl − 0.2 met 2 μmol/L KlenTaq-polimerase en 4 μmol/L van elke onderlaag by 76 °C. -dF/dT, negatiewe eerste afgeleide van fluoressensie met betrekking tot temperatuur.

Hoë Mg 2+ konsentrasies fasiliteer uiterste PCR. Wanneer 'n 60-bp fragment van AKAP10 ['n Kinase (PRKA) ankerproteïen 10] is geamplifiseer vir 35 siklusse met 20 μmol/L primers en 8 μmol/L polimerase, geen produk is waargeneem op gels by 2–3 mmol/L, minimale produk by 4 mmol/L, en 'n groot hoeveelheid spesifieke produk teen 5–7 mmol/L MgCl2 (sien aanlyn Aanvullende Fig. 7). Teen 5 mmol/L MgCl2, was die minimum siklustyd vir doeltreffende amplifikasie 0.42 s (sien aanlyn Aanvullende Fig. 7), wat demonstreer dat spesifieke, hoë-opbrengs 60-bp produk in <15 s van menslike genomiese DNA verkry kan word (35 siklusse in 14.7 s).


Pankreaskanker Weerstand teen Gemcitabine

Gemcitabine en Chemoreweerstand

Chemoweerstand is 'n primêre bron van behandelingsmislukking onder pankreas-adenokarsinoompasiënte met gemcitabien. Die meeste van die pasiënte word weerstandig teen die middel na opeenvolgende siklusse van behandelings wat lei tot mislukking van chemoterapie, wat die meganismes agter die chemoweerstand duidelik maak. Dit het verpligtend geword om die voorspellende merkers van beide verworwe en inherente chemoweerstand te identifiseer om beter behandelingsopsies met gemcitabien te beplan.

Die modulasie van sellulêre ensieme onder die gemcitabienmetabolisme en vervoer kan die aktiwiteite van geneesmiddel in vitro beïnvloed [27-30]. Die sellulêre ensieme hENT1, RRM1, dCK en RRM2 word in die gemcitabienmetabolisme aangeteken. Die eksperimentele bewyse ondersteun in die modulering van die effekte van gemcitabien met selektiewe kombinasie van middels, waardeur die sukseskoers van behandeling in pankreaskankergevalle verbeter word. 'n Transkripsie-analise is uitgevoer in ouer-sellyne en weerstandbiedende subklone van hENT1, RRM1, dCK en RRM2 en wat deurlopend aan gemcitabien blootgestel is vir die bepaling van voorspellende merkers wat vir gemcitabien-weerstand kodeer. Hierdie data het getoon dat die verworwe en inherente chemoreweerstand van kwaadaardige selle teen die middel gemcitabien bevestig word deur die geenuitdrukkings van dCK, RRM1, RRM2 en hENT1 te balanseer. Die uitdrukkingsverhouding van hierdie gene het beduidend gekorreleer met die weerstand teen die middel gemcitabien in kankerselle, insluitend selle wat gemcitabien-weerstand verkry het, wat daarop dui dat 'n afname in die verhouding die inherente en verworwe chemoweerstand van kankerselle teen gemcitabien kan beïnvloed en 'n punt om te verstaan die doeltreffendheid van gemcitabien in individuele pankreaskankerpasiënte. Die uitdrukkingsverhouding kan 'n insiggewende merker wees in die voorspelling en monitering van die pankreaskankerpasiënt se reaksies op gemcitabien.

'n Studie wat in vitro op kankersellyne uitgevoer is, het gerapporteer dat hENT1 'n primêre gemcitabien-vervoerder in pankreaskankerselle is [31]. Daar word aanvaar dat die selpopulasie met 'n lae oorvloed van hENT1 gemcitabien-bestand kan wees as gevolg van minimale intrasellulêre akkumulasie. Die inhibisie van hENT1 in pankreaskankerselle word gerapporteer om weerstand teen gemcitabien te lewer [27]. Ander studies het veronderstel dat hENT1-geenuitdrukking glad nie verminder is tydens gemcitabien-weerstandsontwikkeling nie en nie gekorreleer is met IC50-waardes van die geneesmiddel binne agt sellyne nie. Hierdie verslae kan voorstel dat die uitdrukking van hENT1 alleen nie die weerstand teen gemcitabien weerspieël nie. Die toename in uitdrukkingspatrone van hENT1 in PCI-G4000, PK1-G4000 en KLM1-G4000 subklone is 'n aanpassing by 'n hoë vlak van chemoweerstand teen gemcitabien.

Vorige verslae in diermodelle het 'n dCK-mutasietekort getoon as 'n sleutelmeganisme agter gemcitabienweerstand in kankerselle met verworwe weerstand [32-34]. Maar dCK geenuitdrukking vlakke was verhoog in subklone, wat weerstand teen lae gemcitabien konsentrasies was en nie waarneembaar was binne subklone met hoë weerstand nie, dit wil sê, PK1-G4000 en PCI43-G4000. Daarbenewens kan dCK geenuitdrukking alleen nie met gemcitabiensensitiwiteit tussen agt kankersellyne korreleer nie. dCK-tekort wat in ander verslae beskryf word, was gebaseer op eksperimente wat uitgevoer is op gemcitabienklone wat hoogs weerstandbiedend was en verskil van kliniese instellings. Sulke data postuleer dat dCK-tekort betrokke kan wees by 'n hoë graad van gemcitabien-verworwe weerstand, nóg in lae graad weerstandbiedende selle nóg in ouerselle.

Dit is bekend dat RR-uitdrukking die gemcitabien-chemoreweerstand onder menslike tumorselle bepaal [35]. Die kunsmatige ooruitdrukking van RRM2 ontwikkel gemcitabien-chemoreweerstand [29]. Verhoogde vlakke van RR verhoog die dNTP-poelgrootte, dus is die inkorporering van gemcitabientrifosfaat in sellulêre DNA geïnhibeer [36]. Die dNTP-poele wat uitgebrei is, reguleer die aktiwiteite van dCK deur 'n negatiewe-terugvoer-weg. Resultate van 'n studie het getoon dat die RRM1 mRNA uitdrukkingsvlak verhoog is in KLM1 gemcitabien-weerstandige selle as in ouerselle. Hierdie resultaat ondersteun die verslag dat RRM1 'n merker is om sy weerstand teen gemcitabien onder sellyne van longkanker te voorspel [37]. KLM1 gemcitabien-weerstandige selle het nie 'n tekort aan dCK gerapporteer nie, terwyl die gebrek aan dCK in PK1 en PCI43 gemcitabien-weerstandige selle gerapporteer is. Dus, hierdie data toon dat RRM1 gekorreleer kan word met die verworwe weerstand teen gemcitabien, in selle wat dCK-tekort het. Daar is gevind dat RRM2 mRNA verhoog is in PCI43 gemcitabien-weerstandige selle, nie in KLM1 en PK1 gemcitabien-weerstandige subklone nie. In agt pankreas karsinoom getoetsde selle het die selle met 'n hoë vlak van inherente weerstand teen gemcitabien nie hoë vlakke van RRM1 en RRM2 uitdrukkings vertoon nie. Hierdie resultate het voorgestel dat 'n toename in RRM1 of RRM2 uitdrukkings korreleer met verworwe chemoreweerstand en nie die inherente chemoreweerstand met gemcitabien beïnvloed nie. Tydens gemcitabien-weerstandsontwikkeling dui toename in RRM1 of RRM2 uitdrukking, bykomend tot 'n afname in dCK, aan dat selle gemanifesteer word om die skade te inhibeer deur gemcitabien inkorporasie binne gemcitabien-weerstandige selle.

Ribonukleotiedreduktase is 'n sentrale ensiem wat die dNTP-sintesetempo beheer [36]. Tioredoksien is 'n fisiologiese faktor in ribonukleotiedvermindering, wat verpligtend is vir die in vitro RR-reaksie [38]. In gis het mutante sonder tioredoksien aansienlik lae dNTP-vlakke wat die idee bevestig dat tioredoksien in vitro as RR-reduktant kan funksioneer. Thioredoxin word opgemerk as 'n geen waarvan die uitdrukkingsvlakke verhoog word in pankreaskankerselle waar Smad7 oor die algemeen ooruitgedruk word [39]. Thioredoxin staan ​​bekend as stroomaf van Smad7-weg, wat optree om groei te bevorder en apoptose-weerstand onder pankreaskankerselle te veroorsaak. Toekomstige studies is nodig om te ondersoek of tioredoksien in gemcitabien-weerstandige kankerselle afgereguleer word of nie.

Vorige ontleding van genomika van pankreaskanker is met die chirurgiese en lykskouingsmonsters uitgevoer weens die moeilikheid om weefselmonsters te verkry sonder chirurgiese proses. Om hierdie probleem te oorkom, word EUS-FNAB uitgevoer om tumorselle te kry as veilige metode in die diagnose van pankreaskanker [40]. Onlangs het navorsers die genetiese analise gedemonstreer wat uitgevoer is met behulp van EUS-FNAB-monsters vir die bepaling van die kankerstadium en om die diagnostiese akkuraatheid te verbeter [41, 42]. Die opsporing en kwantifisering van hENT1, dCK, RRM1 en RRM2 mRNA is vinnig gedoen deur gebruik te maak van die ligfietsryer PCR saam met die SYBR Groen fluoressensie. Die analitiese strategieë van ligte siklus-PCR- en EUS-FNAB-monsters het chemoweerstand van pankreaskanker tydens gemcitabienbehandeling geëvalueer. Kwantitatiewe RT-PKR analise het die balans tussen vier geenuitdrukkingvlakke getoon en gekorreleer met inherente en verworwe weerstand teen die gemcitabien in kankerselle. Die weerstand van pankreaskankerselle teen middel gemcitabien kan bepaal word deur die verhoudings van uitdrukkings van hierdie gene binne pankreaskankerselle te bestudeer. Die verhoudings van geenuitdrukking kan 'n nuttige merker wees in die voorspelling en monitering van die doeltreffendheid van hierdie gemcitabienterapie onder pankreaskankerpasiënte. Verdere studies is aan die gang wat pankreaskankerweefsels wat deur EUS-FNAB versamel is, gebruik om die prominensie van die uitdrukkingsverhouding in gemcitabienbehandeling vir pankreaskanker te verduidelik.


MATERIALE EN METODES

Hantering van Xenopus oösiete en mikro-inspuiting eksperimente

X. laevis oösiete en eiers is in OR2-buffer (82,5 mM NaCl, 2,5 mM KCl, 1 mM CaCl) gestoor2, 1 mM MgCl2, 1 mM Na2HPO4, 5 mM 4-(2-hidroksietiel)-1-piperasienetaansulfonsuur, pH 8.3) by 16°C (Wallace) et al., 1973). Oösiete is tot eiers verouder deur 20 μg/ml progesteroon by te voeg en oornag by 16°C te inkubeer. X. laevis eiers is geselekteer vir sigbare kiemblasies afbreek. Kern- en sitoplasmiese inspuitings is uitgevoer met behulp van 'n Eppendorf mikro-inspuiter. Tot 50 nl (500 ng/μl) Drosha-koderende mRNA is in sitoplasmas ingespuit. Pri- en pre-miRNAs is teen 5-10 nl per kern of sitoplasma ingespuit. RNA's is teen konsentrasies van 200-500 ng/μl ingespuit.

Vir kerninspuitings is oösiete gesentrifugeer met die dierpaal wat opwaarts wys teen 800 × g vir 20 min. Dit lei daartoe dat die kiemblasie sigbaar word as 'n helder kol in die dierlike halfrond.

Onttrekking van totale RNA is uitgevoer met behulp van Invitrogen (Carlsbad, CA) TRIzol reagens volgens die vervaardiger se protokol. RNA is geskei op 10% 29:1 akrielamied:bis-akrielamied gels wat 8 M ureum in 1× Tris/boraat/EDTA (TBE) bevat het.

Kwantifikasies van verwerkte versus onverwerkte bande is op 'n fosfobeelder gedoen in drie onafhanklike eksperimente met behulp van Bio-Rad Quantity One sagteware. Sorg is gedra dat geen versadigde pixels in die blootstelling ingesluit is nie.

Kloning van miRNA-variante wat 'n T7-promotor bevat

Om DNA-konstrukte te produseer wat in vitro deur T7 RNA-polimerase getranskribeer kan word, het ons miRNA-volgordes met PCR geamplifiseer vanaf 1 μg menslike genomiese DNA. Om die transkripsie te stabiliseer, het ons 'n kunsmatige 40-nt-lange poli(A) stert aan die 3'-kant van die pri-miRNA-volgorde ingevoeg.

PCR-produkte is in Promega (Madison, WI) pGEM-Teasy vektor gekloneer en geverifieer deur volgordebepaling.

Die volgende volgordes is gekloon (T7-promotorvolgordes word in vetdruk getoon):

TAATACGACTCACTATAGGACATCTCCATGGCTGTACCACCTTGTCGGGTAGCTTATCAGACTGATGTTGACTGTTGAATCTCATGGCAACACCAGTCGATGGGCTGTCTGACATTTTGGTATCTTTCATCTGACCATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

TAATACGACTCACTATAGGGTCTTGGGTTTATTGTAAGAGAGCATTATGAAGAAAAAAATAGATCATAAAGCTTCTTCAGGAAGCTGGTTTCATATGGTGGTTTAGATTTAAATAGTGATTGTCTAGCACCATTTGAAATCAGTTCTTGGGGGAGACCAGCTGCGCTGCACTACCAACAGCAAAAGAAAAAAAAAAAAAAAAAAAAAAAAAA

TAATACGACTCACTATAGGAGTTCTGTGACACTTAGACTCTGAATATGATAGCAGTCAGTGCACTACAGAACTTTGT

TAATACGACTCACTATAGGGTCTTGGGTTTATTGTAAGAGAGCATTATGAATAGTCTTTTAAATCAAAGTTCTGTGACACTTAGACTCTGAATATGATAGCAGTCAGTGCACTACAGAACTTTGTTTTGGGAGTCTGGCTGCGCTGCACTACCAACAGCAAAAGAA

TAATACGACTCACTATAGAAGACTATATTTTCAGGGATCATTTCTACAGTGCACTACTAGAGAAGTTTCTGTGAACTTGTAGAGCACCGGAAACCATGAGCAGGAAGTGCAGCGTTCTCTCCTGAGCATGAAGCCGGCTCTTGGTGGCTTCGCTGCAACTGCCATTGGCCATTGATGATCGTTCTTCTCTCTTCTCTGGGAGAGCAAGAGGT

TAATACGACTCACTATAGGTGCTCATTTTGGCAGCACATATACTAAATTAGAACACTGCAGAGAAGATTAGCATGGCCCCTGCACAAGGATGACAATAAAAATTAAAAAATGAATTT

T7 in vitro transkripsie

Vir in vitro transkripsie is die plasmied wat die Drosha-sjabloon bevat gelineariseer aan die 3'-kant. T7 in vitro transkripsie met behulp van 500 ng templaat DNA is uitgevoer in 10 mM dithiothreitol, 1 × Stratagene (La Jolla, CA) transkripsiebuffer, 0,3 mM GpppGTP (cap), 0,5 mM CTP, 0,5 mM UTP, 0,5 mM ATP, 1 μl (40 U) RNase inhibeerder, en T7 RNA polimerase. Vir afgeslote transkripsies, is 0.1 mM GTP bygevoeg na 'n 10-min pre-inkubasie met die cap analoog. Die reaksie is vir 2 uur by 37°C geïnkubeer, gesuiwer deur gebruik te maak van Sephadex G-25 kolomme, en presipiteer. Vir die produksie van radio-gemerkte RNA is 0.1 mM ATP en 30 μCi van [α- 32 P]ATP by die nukleotiedmengsel gevoeg terwyl alle ander nukleotiede op 0.3 mM gelaat is.

Die in vitro transkripsies is geskei op 10 of 15% 29:1 AA:bis-AA gels (8 M ureum in 1× TBE). Die nat gel is aan x-straalfilms blootgestel, en toepaslike bande is uitgesny en geëlueer in 400 μl elueringsbuffer (500 mM NH)4OAc, 0,2% SDS, 100 mM EDTA) oornag. Geëlueerde monsters is oor Sephadex G-25-kolomme gesuiwer en gepresipiteer.

Noordelike klad

Northern blots is gedoen soos beskryf (Pall en Hamilton, 2008). Kortliks, totale RNA is uit 35 oösiete of eiers geïsoleer. Die gelyke hoeveelheid oösiet en eier totale RNA is bevestig deur RiboGreen fluorometriese kwantifisering. Geïsoleerde RNA's is op 'n 15% poliakrielamiedgel geskei. Gels were blotted onto Hybond N+ membrane (GE Healthcare, Freiburg, Germany) using a semidry blotting technique. For hybridization, oligonucleotides xtr-miRNA-101, 5′-CTTCAGTTATCACAGTACTGTA-3′, and xtr-miRNA-148a, 5′-ACAAAGTTCTGTAATGCACTGA-3′, were 5′-end labeled with 20 μCi of [γ- 32 P]ATP using T4 polynucleotide kinase according to manufacturer's protocol. Hybridization was carried out as described (Pall and Hamilton, 2008). Blots were exposed to phosphoimager screens, and signals were detected using an FX Pro phosphoimager. Quantification and integration of signals of equally sized squares were done using Quantity One Software.

Immunoprecipitation of recombinant Drosha

Oocytes and eggs (10 cells) injected with N-terminally tagged 7xmyc-Drosha-poly(A) RNA were homogenized, and 100 μl of NET-2 (150 mM NaCl, 50 mM Tris, pH 7.4, 0.05% NP-40) buffer was added. The mixture was spun for 5 min at 14,000 rpm, and the supernatant was transferred to a fresh tube. An aliquot of one cell (10 μl) was transferred to a fresh tube and saved for Western blotting (input control).

The α-myc antibody 9E10 was coupled to Sepharose A beads (4 mg of beads in 5 ml of 9E10) overnight at 4°C. The coupled beads were washed four times in NET-2 buffer and resuspended in 500 μl of NET-2 buffer. Supernatants of cell extracts were added to the resuspended antibody-coupled beads and incubated for 1 h at 4°C on a rotating wheel. The beads were washed four times with NET-2 buffer and resuspended in 500 μl of NET-2 buffer. An aliquot of one cell (50 μl) was transferred to a fresh tube for Western blotting (purification control). The remaining immunoprecipitate was washed in 500 μl of 6.4 mM MgCl2 and used for Drosha in vitro processing assay.

Drosha in vitro processing assay

Capped, in vitro–transcribed RNA encoding myc-tagged Drosha was injected in oocytes, and half of the cells were matured to eggs. Cells were lysed, and lysates were used to immunoprecipitate the translated Drosha protein using α-myc antibody coupled to protein A– Sepharose following the protocol described by Steitz (1989). The precipitated material was used for an in vitro processing assay with protein still coupled to beads as described at www.narrykim.org/in_vitro_Drosha_processing.pdf.

After processing, the cleaved RNA was boiled in 8 M urea and loaded on a 10% urea polyacrylamide gel.

Cloning of processed pre-miRNAs

Nuclear or cytoplasmic RNA isolations were run on polyacrylamide gels next to radioactively labeled markers. After a short exposure of the wet gel to film, the region of interest was excised, and RNAs were extracted by macerating the gel in 500 mM NH4Ac and 0.1% SDS with overnight incubation. Extracted RNAs were precipitated, and cDNA synthesis was done with a primer overlapping the template by eight nucleotides. cDNA synthesis was first performed at 16°C and then extended at room temperature. After cDNA synthesis, PCR was performed with the primer used for cDNA synthesis and a 5′ primer overlapping the cDNA again by eight nucleotides. PCR products were gel purified, cloned, and sequenced. Of 24 clones sequenced, 3 contained the correct and expected sequence.

Reverse transcription quantitative PCR

For the quantification of Drosha, total RNA prepared from stage VI oocytes and unfertilized eggs was DNase I digested (1 U/μl, 10 U Fermentas) and reverse transcribed using M-MLV Reverse Transcriptase (Thermo Scientific, Waltham, MA) and random hexamers in a total volume of 20 μl. Real-time PCR was performed on a Bio-Rad iQ5 Mastercycler, using GoTaq SYBR Green qPCR master mix (Promega, Madison, WI) and the following primers. Drosha: sense, 5′-CCTTTATCGCTGCCCTTTAT-3′ antisense, 5′-CCATCTGGGGGAAGTTATAT-3′. Smn2: sense, 5′-ATAGGAGACACGTGTAATGC-3′ antisense 5′-GAGGATCTTTGCTTTGATGC-3′. The PCR program was 40 cycles of 95°C/15 s, 57.5°C/30 s, and 72°C/1 min, preceded by denaturation at 95°C/3 min. The relative difference in expression of Drosha was calculated by the ΔΔCt method using Smn2 as a reference gene.

Poly(A) length assay

This assay was performed according to Murray and Schoenberg (2008). We used the oligo(dT) adapter 5′-GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT in combination with the mRNA-specific primer 5′-CCTTTATCGCTGCCCTTTAT.

Kloning van Xenopus Drosha

To clone full-length Xenopus Drosha, a 5′ and 3′ RACE protocol was applied using primers in a region that was found conserved from fish to mammals. The forward primer taggccacaatcagagaat and the reverse primer ccatctgggggaagttatat were used for the anchored PCR on cDNA isolated from X. laevis poly(A) RNA (Zhang and Frohman, 1997). The ends of the Drosha cDNA were subsequently cloned using 5′ and 3′ RACE protocols as published (Zhang and Frohman, 1997). The resulting fragments were assembled and verified by sequencing.

Western blotting

The same numbers of Xenopus oocytes and eggs from two different frogs were manually defolliculated and homogenized, and the insoluble fraction was removed by centrifugation. The soluble fraction was denatured by addition of 2× Laemmli buffer and heating to 95°C for 5 min (Laemmli, 1970). The equivalent of 1.5 oocytes or eggs was run on 6% SDS polyacrylamide gels, and proteins were blotted to nitrocellulose and detected as follows: detection of Drosha was achieved with a human- and mouse-specific antibody that cross-reacts with Xenopus Drosha (D28B1 rabbit monoclonal antibody 3364 Cell Signaling Technology, Beverly, MA). To control for equal loading, the same blot was also incubated with α-tubulin antibody (Sigma-Aldrich, St. Louis, MO). As secondary, an anti-rabbit AP antibody (31340 Pierce) was used. Myc-tagged Drosha was detected with the anti-myc monoclonal antibody 9E10 and a labeled, secondary anti-mouse antibody.


Bespreking

Ensuring the quality of ASQ reactions

Genomic DNA preparation

The quality and amount of DNA template are critical factors in determining the specificity of ASQ reaction and genotype scoring. Although we have used NaOH-treated crude DNA preparations without any complication, there are differences in the quality of crude preparations, especially when using end-point analysis. To control the quality of DNA preparations, it is important to adhere to the same treatment regimen for each treatment. After NaOH treatment, the tissue needs to be vortexed or vigorously flicked to make each sample a homogeneous solution. Once the tissue has been thoroughly homogenized (although still cloudy), Tris buffer (pH 8) has to be added to the samples to neutralize NaOH and prevent extensive nicking of genomic DNA.

Assessing the quality of each ASQ assay

To assess the quality of DNA templates in a reaction (96-well plate), a dilution series of genomic DNA of known genotype is used (see Supplementary Figs. S4–S9 for standard curves for each locus). The spurious amplification can be detected by comparing the amplification of the dilution series against the amplification of NTCs. Any amplifications occurring beyond the mean Ct or below the mean fluorescence value of NTCs should be considered nonspecific amplification. The dilution series provides the relative amount of DNA at which specific amplification terminates and spurious amplification arises. The dilution series is useful because DNA is generally used without accurate quantification in crude preparations. Samples may show nonspecific reactions for various reasons, including evaporation, poor DNA quality, low DNA quantity, or a high concentration of PCR inhibitors such as excess salts, polysaccharides, hemoglobin, immunoglobulin G, and proteinases. 39,40 Those samples with spurious amplification should be discarded from genotype calling.

While we have successfully used crude preparation of approximately 3 ng of genomic DNA, the lowest amount of DNA template that can be used would vary depending on the quality of DNA preparation and the specificity of the reaction. We anticipate that lower quantities of DNA template would work if purified DNA samples are used. We did not test purified DNA templates because the purpose of developing the ASQ system was to perform a rapid and accurate genotyping in the most versatile and convenient way.

Analyzing assays accurately

Choosing between a Ct value and end-point reading method

With ASQ, genotype scoring can be accomplished with either threshold cycle (Ct) or end-point fluorescence reading. Beginning with the Ct value method is easier to optimize the assay conditions. In the Ct value method, fluorescence values are read in each cycle of the second tier amplification (Table 3). Because the increasing fluorescence values are acquired at each cycle, we can determine the cycle at which spurious reaction arises and the sensitivity of the reaction using the NTCs and a dilution series. A total of 40 cycles in the second-tier amplification were used during this optimization process, and a decreased number of cycles can be used once the assay is optimized. The end-point reading method can shorten the reaction time because the reading is conducted only one time after a completion of the reaction. After optimization, the end-point reading in routine ASQ applications would save time and can be done on a standard thermal cycler.

Other applications and considerations

Combining ASQ in nested PCR

It is often necessary to process samples for both RNA extraction and DNA genotyping. If the model system is a larger animal or cell culture, different portions of the sample can be allotted for either RNA or DNA preparation. In smaller animal models such as larval zebrafish and fruit flies, the amount of tissue is often limited and the reagents used to neutralize RNase can strongly inhibit PCR. In such case, we have performed ASQ genotyping using a nested PCR approach. We used a pair of “outer” primers for the first PCR that generates a bigger amplicon flanking allele-specific primer/reverse primer binding ranges. In this application, 1 μl (or any small volume) of each sample prepared for RNA extraction was diluted at 1:25 in 24 μl of PCR-grade water. The first PCR was performed with this DNA sample and outer primers. Subsequently, the first PCR product was diluted at 1:100 and the diluted PCR product was used as DNA source for ASQ genotyping. The nested PCR successfully lowers the amount of PCR inhibitors such as guanidine thiocyanate in RNA extraction buffer 41 while increasing the amount of DNA template for ASQ. In this application, lower Ct values were observed compared with the genomic DNA preparation, implying that the products for the first PCR contained a higher concentration of DNA than genome DNA.

Size of the amplicons

The size of the amplicon generated between an allele-specific primer and reverse primer varied widely ranging from 165 bp (nr3c1) to 365 bp (nod2) without affecting the accuracy of genotype scoring (Supplementary Table S2). This dynamic range should assist in designing a reverse primer with a proper annealing temperature in AT or GC-rich regions.

Dealing with SNPs and 1 bp deletion or insertion

Designing a pair of ASPs (wild-type vs. mutant) at an SNP site is more challenging than designing an assay for indel sites. Because of the mechanism of ASQ, the locus of ASPs is fixed at the site of the SNP. The guidelines, described in the Materials and Methods section such as modifying the length of ASPs and changing the directionality of ASPs and a reverse primer, should be generally sufficient to produce a successful assay. However, if correct genotype calling fails after exhausting these basic options, an alternative primer designing can be applied. This guideline exploits the fact that one mismatch at the 3′ end of the primer might not be sufficient to prevent an nonspecific extension, whereas two consecutive mismatches at the 3′ end of the primer increase the possibility of preventing an extension. 21,42 The penultimate nucleotide in the ASPs can be intentionally made to be the same nucleotide on the binding strand instead of being complementary. This way, the ASPs (wild-type vs. mutant) will have two mismatches at the 3′-end on the opposite allele. When the ASPs designed with the penultimate-site mismatch are tested, it is strongly recommended to perform gradient PCR to determine the most effective annealing temperature during the first-tier PCR. We applied this method to the il-6 locus and could acquire stronger signals and better clusters (Supplementary Fig. S3 Table 1).


Materiale en Metodes

Ethics statement

This study was performed according to the Helsinki II Declaration and was approved by the medical ethics committee of Jiangsu Cancer Hospital. Sixty clinical blood samples were obtained from breast cancer patients at Jiangsu Cancer Hospital. Written informed consent was obtained from all subjects.

Primer design and synthesis

All primers were designed using the Primer Premier 5.0 program. For point mutation detection, an allele-specific primer matching the wild-type sequence and a common primer matching both wild-type and mutant sequences were designed. In addition, three blocked primers were synthesized by blocking the 3'-terminal nucleotide with 3'-Pi or-Amino C6(-NH2), or replacing it with ddCTP. The blocked primers have same sequences as the allele-specific primer. All primers were synthesized commercially by BioSune Biotechnology Co., Ltd. (Shanghai, China).

Construction of various mutants

The wild-type template was obtained by constructing a recombinant pMD18-T plasmid (TaKaRa, Dalian China) containing a fragment of human genomic DNA. To evaluate the applicability of the proofreading PCR method, a series of mutant plasmids containing single-base mutations (including point mutations, deletions and insertions) at different positions were constructed using site-directed mutagenesis technology. All plasmids containing the wild-type fragment and various mutations were used as the templates after purification and confirmation via direct sequencing.

Detection of various mutants

Both the wild-type and mutant templates (plasmids) were amplified using an allele-specific 3'-ddC-blocked forward primer and an unblocked reverse primer. The PCR amplifications were performed in a total volume of 20 μL with 2 μL of (10×) Taq PCR buffer, 0.2 mM deoxynucleotide-triphosphate (dNTPs), 1 ng of template, 0.15 units (U) of KOD FX DNA polymerase (TOYOBO, Osaka, Japan), 1 U of Taq DNA polymerase (TaKaRa, Dalian, China) and 0.3 μM each of reverse primer and 3'-ddC-blocked forward primer. The reactions were carried out under cycling conditions of pre-denaturation at 94°C for 2 min, followed by 30 cycles of denaturation at 94°C for 20 s, annealing at 62.2°C for 20 s and extension at 72°C for 25 s (the annealing temperature used for the amplification of Mu*8 was 62.9°C). The PCR products were visualized via 1.5% agarose gel electrophoresis.

Confirmation test using human cancer cell lines and clinical samples

To further evaluate the detection efficiency of the modified PR-PCR in realistic samples, two breast cancer cell lines HCC1937(ATCC#CRL-2336) and MCF-7(ATCC#HTB-22), purchased from the Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences (Shanghai, China) and 60 clinical blood samples obtained from breast cancer patients were prepared. HCC1937 that carries a homozygous TP53 mutation in codon 306 (p.R306X, c.916C>T) was used as the mutant sample, while MCF-7 that does not carry this mutation was used as the wild-type sample [25]. Both cell lines were cultured following ATCC protocols.

Genomic DNA (gDNA) was extracted from both cell lines using the MiniBEST Universal Genomic DNA Extraction Kit (TaKaRa, Dalian, China) following the manufacturer’s instructions. For the 60 blood samples, gDNA was extracted using the TIANamp Blood DNA Kit (TIANGEN, Beijing, China) according to the manufacturer’s instructions. The extracted gDNA was eluted into 70 μL of (1×) TE buffer (pH 8.0) and then quantified using a Nanodrop-1000 Spectrophotometer (Thermo Fisher Scientific, Wilmington, DE).

For the clinical samples, the modified PR-PCR was performed in a total volume of 25 μL reaction mixture including 20 ng of gDNA, 3.75 μL of (5×) PrimeSTAR buffer, 1.25 μL of (5×) Taq PCR buffer, 0.2 mM dNTPs, 0.2 U of PrimeSTAR HS DNA polymerase, 0.7 U of Taq DNA polymerase, 1 μL of DMSO and 0.3 μM each of reverse primer, fusion-blocked forward primer and adaptor. The reactions were carried out under cycling conditions of pre-denaturation at 94°C for 2 min 40 cycles of denaturation at 98°C for 10 s, annealing at 59°C for 20 s and extension at 72°C for 18 s. The PCR products were visualized via 1.5% agarose gel electrophoresis.

To confirm the results obtained from the modified PR-PCR, a 430 bp fragment of the TP53 gene containing the P72R mutation was amplified via routine PCR (S2 Table). The PCR products were purified and sent to BioSune Biotechnology Co., Ltd. for sequencing.

Detection of rifampin-resistant mutations in Mycobacterium tuberculosis (TB)

Three rifampin-resistant (S479, S643, and S748) and three rifampin-sensitive (N15, N7, and N9) TB strains were isolated from the Huzhou Center for Disease Control and Prevention. Rifampin resistance and susceptibility of TB strains was determined using the proportional method on Löwenstein-Jensen medium with serial dilutions of rifampin, in accordance with the Deutsches Institut für Normung (DIN) guidelines (DIN 58943–8).

Two most common rifampin-resistant mutations, H526Y (CAC>TAC) and S531L (TCG>TTG) [26] in the rpoB gene of TB were detected using the modified PR-PCR. All reactions were performed in a total volume of 20 μL containing a mixture of 2 μL of (10×) Taq PCR buffer, 0.2 mM dNTPs, 1 U of Taq DNA polymerase, 0.15 U of PrimeSTAR HS DNA polymerase, 5 ng of gDNA (equal to approximately 1×10 6 copies of the TB genome) and 0.3 μM each of 3'-blocked forward primer and common reverse primer. The PCR cycling conditions consisted of pre-denaturation at 95°C for 1 min, followed by 35 cycles of denaturation at 95°C for 15 s, annealing at 59°C for 15 s and extension at 72°C for 15 s.

To confirm the results obtained from the modified PR-PCR, a 493 bp fragment of the rpoB gene encompassing the two mutation sites from six TB strains was sequenced using the 454 GS-FLX system (Roche Diagnostics Corporation). Approximately 1×10 9 molecules of the final normalized, adaptor and sequencing key-ligated 493 bp amplicon were prepared and sequenced according to the published Roche 454 GS FLX Titanium protocols.


Erkennings

We thank Victoria Reckamp for expert assistance with the preparation of this paper. This work was supported by National Institutes of Health Grants AG00425 (to J.O.H.), K01 DK063051 (to J.M.H.), and Diabetes Research and Training Grant P60 DK20579-28. P.G.-R. was supported by an American Diabetes Association Mentor-Based Postdoctoral Fellowship. C.H. was initially supported by an American Diabetes Association Mentor-Based Postdoctoral Fellowship and subsequently by National Institutes of Health Individual National Research Service Award 1F32DK076410.


BESPREKING

Finding genes in large chromosomal regions has been approached in three ways: exon trapping, DNA sequencing analysis, and direct hybridization selection. Exon trapping works when the gene in question contains splicing sites that are efficiently recognized by the host cell (6–8). But it fails when introns are absent or the intron–exon borders are not recognized and exon trapping yields a background of false candidates derived from cryptic splice sites. DNA sequencing is effective when the gene in question has homology to a known expressed sequence. Even without homology, computational methods for predicting genes also have promise (4). But DNA sequencing on a massive scale is still costly. Direct hybridization selection (1) has also found use, but it diminishes in usefulness with rare messages and suffers from the vagaries of physical selection methods and background problems with repetitive sequences. We have described an additional approach to this problem: an effective protocol for selecting cDNA fragments that are homologous at one of their ends to one of the ends from a collection of genomic fragments. This method should work whenever a cDNA population is available that contains transcripts from the gene in question.

A protocol (end ligation coincident sequence cloning, EL-CSC) similar to ours, has been presented by Brookes et al. (14). Like ours, their protocol is based upon heteroduplex formation between DNA fragments made from two populations, and the use of ligation (with what they call “capture oligonucleotides”) to distinguish heteroduplex from homoduplex. Unlike our procedure, their method requires heteroduplex formation at both ends between cDNA and genomic fragments, because both ends of the heteroduplex must be ligated. Thus, cloning of cDNA fragments that span introns is much less likely. In our procedure, we use a selection adaptor that allows us to generate an RNA intermediate, and so we can isolate heteroduplexes that have formed at only one end. Moreover, EL-CSC uses physical trapping through biotin–avidin complex formation to enrich for products. We have experienced difficulty with protocols incorporating such methods and have avoided them in RICH. The report of Brookes et al. (14) does not contain sufficient information to enable us to make quantitative comparisons of our methods nor have we found their procedure used in the published literature.

Although the yield of c-MYC fragments in the RICH products was very satisfactory, the yield of PTEN products was less so. An additional prescreening of RICH products from PTEN was needed: namely, the verification of the adaptors and the Sau3AI sites that should be present upon proper priming and ligation. We believe that this is due to the reduced level of expression of the PTEN gene compared with c-MYC. Moreover, an analysis of our products from the PTEN BAC revealed a higher proportion of repeat-containing sequences than were found for c-MYC, presumably for the same reason.

Not all fragments from the same cDNA will have the same yield. For example, the 880-bp fragment from c-MYC was not obtained as a RICH product. We speculate this may be due to the difficulty of obtaining long transcripts from the SP6 polymerase. Also, we did not clone the 520-bp fragment of PTEN that was seen upon Southern blotting to be present in reduced amount. Most strikingly, we do not observe very short fragments in the RICH products. Possibly, this deficit is partially due to the slower kinetics of hybridization of shorter fragments (15). Gel fractionation before cloning might overcome some of these problems of underrepresentation. Alternatively, these limitations can be overcome by using different restriction endonucleases during the protocol.

We have introduced one variation in our method: amplifying genomic DNA fragments before use. This step was incorporated for two reasons. (i) If genomic fragments are amplified and not cleaved, it should be unnecessary to partially fill-in the ends of restriction endonuclease cleaved cDNA, because the selection adaptor cannot be ligated to PCR-amplified genomic DNA. Thus, with this variation, any restriction endonuclease can be chosen, if used both for cDNA cleavage and amplification of genomic fragments, overcoming limitations in the discovery of cDNAs that might result from the use of Sau3AI discussed above. (ii) With genomic amplification the user can initiate the search for transcripts with very small amounts of genomic DNA. In fact, we have performed RICH starting from small amounts of gel-purified BAC DNA. It may be possible to extend this method to gel-purified yeast artificial chromosome DNAs.

We cannot obtain the 3′ or 5′ ends of cDNA transcripts with RICH because only cDNA fragments with restriction endonuclease cleavage sites at both ends can be selectively amplified. However, RICH can be used in reverse (rapid isolation of genes by hybridization to transcripts, RIGHT) to identify genomic clones with homology to cDNAs. The directional modifications of genomic fragments and cDNAs used in RICH can be essentially reversed, rendering genomic fragments that form heteroduplex with cDNA the only selectable RIGHT products. When unamplified cDNAs are used, the RIGHT protocol should yield the 3′ and 5′ ends of a transcription unit. In addition, RIGHT might facilitate the confirmation of cDNAs found by RICH and aid in the determination of intron-exon boundaries.