Inligting

Hoe is aminosure neutraal by fisiologiese pH?

Hoe is aminosure neutraal by fisiologiese pH?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Aminosure met nie-ioniseerbare sykettings is zwitterione wanneer hulle by fisiologiese pH, pH 7.4, is. Dit is wat my boek sê. Maar ek verstaan ​​nie hoekom nie. Die Pka vir 'n karboksielgroep is ongeveer 3 en die pKa vir 'n aminogroep is ongeveer 9. Die iso-elektriese punt moet dus rondom ( 9+3) /2 = 6 wees vir 'n aminosuur met geen ioniseerbare syketting nie. By pH 7.4 sal dit effens negatief wees, nie waar nie?

Wat presies is 'n basiese aminosuur? Is dit 'n aminosuur wat 'n PI-waarde van meer as 7 het?

Dankie.


Jy is reg, meeste van die aminosure het pI rondom 6, so hulle is effens negatief by pH 7.

Die iso-elektriese punt hang af van die amino- en karboksielsuurgroepe en die groepe van die syketting. Bv. lisien het 'n aminogroep op die syketting, so dit het 'n pI van 9,74.


As 'n aminosuur twee aminogroepe en net een karboksielgroep (soos arginien en lisien) het, dan is hulle positief gelaai (++ vs. -) by neutrale pH. Aan die ander kant, as aminosure twee karboksielgroepe en slegs een aminogroep het (soos glutamiensuur en asparaginsuur), is hulle negatief gelaai by pH7 (-- vs. +). Jy is nie korrek dat die groepe werklik neutraal is nie. Die karboksielgroep is negatief gelaai in 'n oplossing wat baie hoër is as die pKa van die karboksielgroep (wat pH 2.48 vir arginien is). Dieselfde geld vir die aminogroepe (pKb is by pH 11.5 vir arginien). Dus, by pH 9.5 is die verhouding van die positief gelaaide aminogroep tot 'n neutrale aminogroep 100:1 (by die pKb sal dit 50:50 wees). By 'n pH van 4,48 sal die karboksielgroep van arginien 1:100 negatief gelaai wees, teenoor neutraal. Dus, by pH7 is al die karboksielgroepe negatief gelaai (COO-) en al die aminogroepe (2 daarvan) is ten volle positief gelaai (NH3+). Netto lading is plus 1, in die geval van arginien by pH7.


By pH 7.4 is 'n karboksielgroep meestal teenwoordig as COO-, terwyl 'n aminogroep teenwoordig is as NH3+. Wanneer 'n molekule dus albei groepe het, soos 'n aminosuur, is die molekule as geheel neutraal. Aangesien dit 'n Zwitterion (gelyke + en - ladings) is, kan die waterstof ook flip-flop tussen amino- en karboksielgroepe. Maak die molekule 'werklik' neutraal aangesien beide groepe nie gelaai is nie.

'n Basiese aminosuur het 'n basiese groep soos 'n aminogroep (Arginine) op sy syketting.


Tegnies ja, die meeste aminosure sal effens negatief gelaai wees by fisiologiese pH. Maar ons moet verstaan ​​wat dit beteken. Kom ons neem alanien as 'n voorbeeld. Enige individuele alanienmolekule kan óf ongelaai wees óf 'n heelgetal netto lading hê - dit is óf geprotoneerd óf dit is nie. Jy sal nooit 'n "gedeeltelik gelaaide" alanienmolekule vind nie. As jy egter 'n klomp alanienmolekules in oplossing fisiologiese pH het, sal hulle nie almal presies dieselfde optree op presies dieselfde tyd nie. Een molekule kan 'n geprotoneerde N-terminus hê terwyl 'n ander 'n gedeprotoneerde N-terminus het. By fisiologiese pH is die C-terminus feitlik heeltemal gedeprotoneer, so ons moet net aandag gee aan die N-terminus. Ons kan die Henderson-Hasselbach-vergelyking gebruik om uit te vind watter persentasie alanienmolekules 'n geprotoneerde (positief gelaaide) N-terminus sal hê en watter persentasie gedeprotoneer is. pH = pKa + log(gedeprotoneer/geprotoneer). As ons ons bekende getalle vervang, kry ons 7.4 = 9.5 + log (gedeprotoneerd/geprotoneerd)

Daarom -2.1 = log(deprot/prot) en 10^-2.1 = deprot/prot = 0.008. Dit beteken dat uit 1000 alanienmolekules, ongeveer 8 van hulle gedeprotoneer is en dus negatief gelaai is. Die ander 992 is zwitterione. So vir alle doeleindes is alanien neutraal by fisiologiese pH.


9.3: Aminosure, proteïene en pH

Benewens om te ondersoek hoe die byvoeging van 'n sterk suur of basis 'n bufferoplossing beïnvloed, kan ons ook kyk na die effek van pH op 'n spesifieke suur of basis. Dit is veral belangrik in biologiese stelsels waar daar baie swak suur- of basisgroepe is wat deur die pH beïnvloed kan word. Byvoorbeeld, proteïene bevat beide swak suur &ndashCOOH en swak basies &ndashNH2 groepe. 'n 1.0-M oplossing van 'n eenvoudige karboksielsuur soos asynsuur het 'n pH van

2.8 dit blyk dat die meeste karboksielsure op 'n soortgelyke manier optree. As ons die pH manipuleer, byvoorbeeld deur 'n sterk basis by te voeg, reageer die asynsuur met die basis om 'n asetaatioon te vorm. Gebaseer op die Henderson&ndash Hasselbalch-vergelyking, wanneer [asetaat] = [asynsuur], is die pH gelyk aan die suur&rsquos pKa, wat 4,74 is. Soos die pH toeneem, moet die konsentrasie van asetaat ook toeneem, tot met pH

7 (ongeveer normale fisiologiese pH). Op hierdie stadium is die konsentrasie van asynsuur inderdaad baie klein. Die verhouding van basis tot suur is ongeveer 200/1. Dit wil sê, by fisiologiese pH's word groepe soos karboksielsure gedeprotoneer en bestaan ​​in die karboksilaat (negatief gelaaide) vorm.

Omgekeerd, as ons na die aminogroep kyk (&ndashNH2) van 'n proteïen, is dit eintlik die basisdeel van 'n gekonjugeerde suur-basispaar waarin die suur die geprotoneerde vorm is &ndashNH3 + . Die pKa van 'n &ndashNH3+ groep is tipies

9. By 'n pH van 9 is daar gelyke hoeveelhede van die geprotoneerde (&ndash NH2) en ongeprotoneerde vorms (&ndashNH3 + ). As ons dus die pH verander deur 'n suur by te voeg, sal die konsentrasie van &ndash NH3 + vorm neem toe namate die basisvorm &ndashNH2 is geprotoneer. By pH

7 daar is min van die &ndashNH2 vorm oorbly.

Interessant genoeg beteken dit dat 'n aminosuur (getoon in die figuur) nooit bestaan ​​in 'n toestand waar beide die amino (&ndashNH)2) groep en die karboksielsuur (&ndashCO2H) terselfdertyd bestaan. Die &ldquoneutrale&rdquo spesie is in werklikheid die een waarin &ndashNH3 + /&ndashCO2 &ndash teenwoordig is. Hierdie zwitterion (dit is 'n neutrale molekule met 'n positiewe en negatiewe elektriese lading op verskillende plekke, van die Duitse zwitter, wat &ldquotussen&rdquo beteken) is die oorheersende vorm by fisiologiese pH.

'n Proteïen bestaan ​​hoofsaaklik (soms uitsluitlik) uit polimere van aminosure, bekend as polipeptiede. In 'n polipeptied is die amino (&ndashNH2) en karboksielsuur (&ndashCO2H) groepe aminosure word aan mekaar gebind om 'n peptiedbinding te vorm (sien figuur).

Die resulterende amiedgroep (peptiedbinding) is nie suur of basies onder fisiologiese toestande 182 . Dit gesê, baie van die aminosure wat in proteïene voorkom, het suur (asparagiensuur of glutamiensuur) of basiese (lisien, arginien of histidien) sykettings. Die pH van die omgewing beïnvloed die konformasies van die proteïenmolekule en die interaksies tussen hierdie gelaaide sykettings (die spontane inheemse konformasies van die molekule word proteïenvouing genoem). Veranderinge van die &ldquonormal&rdquo-omgewing kan lei tot veranderinge in proteïenstruktuur, en dit kan weer biologiese aktiwiteit verander. In sommige gevalle word proteïenaktiwiteit deur omgewings-pH gereguleer. In ander gevalle kan veranderinge in pH lei tot proteïen verkeerd vou (of denaturasie, wat in lewende organismes ontwrigting van selaktiwiteit of dood kan veroorsaak). Byvoorbeeld: as hierdie groepe geprotoneer of gedeprotoneer is, kan die elektroniese omgewing in daardie streek van die proteïen drasties verander, wat kan beteken dat die proteïen nie net sal verander hoe dit met ander spesies in wisselwerking tree nie, maar die vorm daarvan kan verander om te minimaliseer afstootlike interaksies of produseer nuwe aantreklike interaksies. Klein veranderinge in proteïenvorm kan diepgaande uitwerking hê op hoe die proteïen in wisselwerking tree met ander molekules en, as dit 'n katalisator is, die doeltreffendheid en spesifisiteit daarvan. Trouens, daar is gevalle waar omgewings-pH gebruik word om proteïenaktiwiteit te reguleer.


Klassifikasie

Benewens die amino- en karboksielgroepe, het aminosure 'n syketting of R-groep wat aan die &alfa-koolstof geheg is. Elke aminosuur het unieke eienskappe wat voortspruit uit die grootte, vorm, oplosbaarheid en ionisasie eienskappe van sy R-groep. As gevolg hiervan het die sykettings van aminosure 'n groot effek op die struktuur en biologiese aktiwiteit van proteïene. Alhoewel aminosure op verskeie maniere geklassifiseer kan word, is een algemene benadering om hulle te klassifiseer volgens of die funksionele groep op die syketting by neutrale pH nie-polêr, polêr maar ongelaai, negatief gelaai of positief gelaai is. Die strukture en name van die 20 aminosure, hul een- en drieletter-afkortings, en sommige van hul kenmerkende kenmerke word in Tabel (PageIndex<1>) gegee.

Tabel (PageIndex<1>): Algemene aminosure wat in proteïene gevind word
Algemene naam Afkorting Struktuurformule (by pH 6) Molêre massa Kenmerkende kenmerk
Aminosure met 'n niepolêre R-groep
glisien gly (G) 75 die enigste aminosuur wat nie 'n chirale koolstof het nie
alanien ala (A) 89 &mdash
valien val (V) 117 'n vertakte ketting aminosuur
leusien leu (L) 131 'n vertakte ketting aminosuur
isoleusien ile (ek) 131 'n noodsaaklike aminosuur omdat die meeste diere nie vertakte aminosure kan sintetiseer nie
fenielalanien phe (F) 165 ook geklassifiseer as 'n aromatiese aminosuur
triptofaan trp (W) 204 ook geklassifiseer as 'n aromatiese aminosuur
metionien ontmoet (M) 149 syketting funksioneer as 'n metielgroepskenker
prolien pro (P) 115 bevat 'n sekondêre amiengroep waarna verwys word as 'n &alfa-iminosuur
Aminosure met 'n polêre maar neutrale R-groep
serine ser (S) 105 gevind op die aktiewe plek van baie ensieme
threonien thr (T) 119 vernoem na sy ooreenkoms met die suikerdrie
sisteïen cys (C) 121 oksidasie van twee sisteïenmolekules lewer sistien
tirosien tyr (Y) 181 ook geklassifiseer as 'n aromatiese aminosuur
aspersie asn (N) 132 die amied van asparaginsuur
glutamien gln (Q) 146 die amied van glutamiensuur
Aminosure met 'n negatief gelaaide R-groep
asparaginsuur asp (D) 132 karboksielgroepe word geïoniseer by fisiologiese pH ook bekend as aspartaat
glutamiensuur glu (E) 146 karboksielgroepe word geïoniseer by fisiologiese pH ook bekend as glutamaat
Aminosure met 'n positief gelaaide R-groep
histidien sy (H) 155 die enigste aminosuur waarvan die R-groep 'n pK heta (6.0) naby fisiologiese pH
lysien lys (K) 147 &mdash
arginien arg (R) 175 amper so sterk basis soos natriumhidroksied

Die eerste aminosuur wat geïsoleer is, was asparagien in 1806. Dit is verkry uit proteïene wat in aspersiesap voorkom (vandaar die naam). Glysien, die belangrikste aminosuur wat in gelatien voorkom, is vernoem na sy soet smaak (Grieks glykys, wat &ldquosoet&rdquo beteken). In sommige gevalle is 'n aminosuur wat in 'n proteïen voorkom, eintlik 'n afgeleide van een van die algemene 20 aminosure (een so 'n afgeleide is hidroksiprolien). Die wysiging vind plaas na die aminosuur is saamgestel in 'n proteïen.


DMCA-klagte

As jy glo dat inhoud wat deur middel van die webwerf beskikbaar is (soos omskryf in ons diensbepalings) een of meer van jou kopiereg skend, stel ons asseblief in kennis deur 'n skriftelike kennisgewing ("oortredingskennisgewing") te verskaf wat die inligting bevat wat hieronder beskryf word aan die aangewese agent hieronder gelys. Indien Varsity Tutors aksie neem in reaksie op 'n Oortredingskennisgewing, sal dit 'n goeie trou poging aanwend om die party te kontak wat sodanige inhoud beskikbaar gestel het deur middel van die mees onlangse e-posadres, indien enige, wat deur sodanige party aan Varsity Tutors verskaf is.

Jou oortredingskennisgewing kan aangestuur word na die party wat die inhoud beskikbaar gestel het of aan derde partye soos ChillingEffects.org.

Neem asseblief kennis dat jy aanspreeklik sal wees vir skadevergoeding (insluitend koste en prokureursfooie) as jy wesenlik wanvoorstel dat 'n produk of aktiwiteit jou kopiereg skend. As jy dus nie seker is dat inhoud wat op die webwerf geleë is of daaraan gekoppel is, jou kopiereg skend nie, moet jy dit oorweeg om eers 'n prokureur te kontak.

Volg asseblief hierdie stappe om 'n kennisgewing in te dien:

Jy moet die volgende insluit:

'n Fisiese of elektroniese handtekening van die kopieregeienaar of 'n persoon wat gemagtig is om namens hulle op te tree 'n Identifikasie van die kopiereg wat beweer word dat dit geskend is 'n Beskrywing van die aard en presiese ligging van die inhoud wat jy beweer dat dit jou kopiereg skend, in voldoende detail om Varsity Tutors toe te laat om daardie inhoud te vind en positief te identifiseer, byvoorbeeld ons benodig 'n skakel na die spesifieke vraag (nie net die naam van die vraag nie) wat die inhoud bevat en 'n beskrywing van watter spesifieke gedeelte van die vraag – 'n prent, 'n skakel, die teks, ens – jou klagte verwys na jou naam, adres, telefoonnommer en e-posadres en 'n Verklaring deur jou: (a) dat jy te goeder trou glo dat die gebruik van die inhoud wat jy beweer dat dit jou kopiereg skend, is nie deur die wet, of deur die kopieregeienaar of sodanige eienaar se agent gemagtig is nie (b) dat al die inligting vervat in jou Oortredingskennisgewing akkuraat is, en (c) onder straf van meineed, dat jy óf die kopieregeienaar of 'n persoon wat gemagtig is om namens hulle op te tree.

Stuur jou klagte aan ons aangewese agent by:

Charles Cohn Varsity Tutors LLC
101 S. Hanley Rd, Suite 300
St. Louis, MO 63105


Metodes

Materiaal

3H-gemerkte aminosure was van Amersham. Ampicillien, G418, higromisien B, fleomisien, M-199 (medium-199) en nie-gemerkte L-aminosure was van Sigma. Fetale bees serum (FBS) was van Biological Industries. Alle ander reagense was van analitiese graad.

Leishmania-selkultuur

'n Klonale lyn van L. donovani 1SR is in alle eksperimente gebruik 25 . Om die klonale aard van die sellyn te verseker, is vars kulture geënt met behulp van enkelkolonies promastigote wat van M-199 agarplate geneem is. Promastigote is gegroei teen 26 ଌ in M-199 aangevul met 10% FBS.

Western klad analise

Western klad analise is uitgevoer soos voorheen beskryf 9 . Kortliks, 10 8 log fase promastigotes selle is geoes, twee keer gewas in yskoue fosfaat gebufferde sout (PBS) en hersentrifugeer. Die resulterende korrel is gehersuspendeer in Laemmli buffer en dan gesoniceer vir 2 s om denaturasie te verseker. Voorbereiding van sout-onttrekte membrane is uitgevoer soos beskryf in 26. Totale proteïen is aan SDS/PAGE (mini-PROTEAN Bio-Rad Laboratories) onderwerp voordat dit na 'n nitrosellulose membraan oorgedra is. Membrane is geblokkeer met 10% (w/v) nie-vet gedroogde afgeroomde melkpoeier in PBST (PBS wat 0.1% Tween 20 bevat), geïnkubeer met anti-LdAAP24 of anti-HA (1:2000 verdunning) teenliggaampies vir 1 h by kamertemperatuur (22 ଌ), gewas en dan geïnkubeer met sekondêre bok anti-konyn HRP (peperwortelperoksidase) teenliggaampies (1:10000 verdunning).

Immunofluoressensie-ontledings

Vir immunofluoressensie is middel-log promastigote twee keer in PBS gewas en dan gefixeer in 1% formaldehied/PBS op 'n skyfie vir 10 min voor permeabilisering deur blootstelling aan 0.2% Triton X-100/PBS vir 10 min. Selle is geïnkubeer met blokkeeroplossing [10% (v/v) nie-vet gedroogde afgeroomde melkpoeier/PBST] vir 30 min by kamertemperatuur, geïnkubeer met anti-LdAAP24 of anti-HA teenliggaampies (1:200 verdunning) vir 1& #x02009h en dan geïnkubeer met sekondêre poliklonale bok anti-konyn IgG fluoresserende teenliggaampies (1:500 verdunning Dy-light 549 Red Jackson) vir 1 h in die donker by kamertemperatuur. Laastens is selle in PBST gewas en aangevul met 5 μl DAPI (4′,6-diamidino-2-phenylindole 0.5 μg/ml Fluka). Fluoresentasie-ontledings is uitgevoer met behulp van 'n konfokale fluoresserende mikroskoop (Axiovert 200M Zeiss).

Kloning en uitdrukking

PCR-versterkte LdAAP24 (oop leesrame (ORF's) LinJ10.0760 en LinJ10.0770), sowel as afgekapte weergawes van die vervoerder se ORF's is gekloon in Leishmania uitdrukkingsvektore pNUS-HnB 27 tussen die XhoI- en KpnI-terreine. Die oplosbare N-terminus is gekloneer in pNUS-HnD 27 tussen die XhoI en KpnI plekke. Alle konstrukte behalwe 𹐘LdAAP24 is gemerk met 'n HA-merker by die C-terminus. Om seker te maak dat die verwagte topologie van elke konstruksie onaangeraak is, gebruik ons ​​TMHMM 2.0 (http://www.cbs.dtu.dk/services/TMHMM/) 28 . Primers vir alle konstrukte verskyn in Tabel S1. Vir seleksie is selle gekweek in promastigotes medium wat óf phleomycine óf blasticidien antibiotika bevat. Suksesvolle uitdrukking is bekragtig deur western klad-analise.

RNA-volgordebepaling

RNA-volgorde-biblioteke is voorberei met behulp van twee metodes. Splice Leader (SL) RNA-volgorde-biblioteke, wat die 5′ einde van mRNA's verryk, is voorberei soos elders beskryf (http://www.ncbi.nlm.nih.gov/pubmed/?term=23382545). PolyA RNA-volgorde biblioteke, wat verryk is vir die 3′ einde van mRNA's, is op 'n soortgelyke wyse voorberei, verwag dat 'n oligo(dT) primer (TCCGATCTCTTTTTTV) gebruik is vir die eerste string sintese, 'n ewekansige heksameer primer (TCCGATCTGANNNNNNN) vir tweede string sintese en PCR amplifikasie is uitgevoer met behulp van seq-primer-CT (AATGATACGGCGACCACCGACACTCTTTCCCTACACGACGCTCTTCCGATCTCT) en R-primer-GA (CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTGA). Die biblioteke is georden met behulp van die Genome Analyzer IIx (Illumina) by die Hoë Deurset Genomika Eenheid by die Universiteit van Washington om 36-nt lang enkel-end lees te genereer. Lesings is in lyn gebring met die L. donovani BPK282A1 en L. infantum JPCM5 verwysingsgenome in TriTrypDBv5.0 met behulp van Bowtie2 29.

Vervoertoetse

Vervoertoetse van radio-gemerkte prolien en alanien is uitgevoer soos beskryf in 8. L. donovani promastigote is tot logaritmiese fase gekweek, twee keer in yskoue Earl’s buffer gewas en tot 10 8 selle/ml gekonsentreer. Die selsuspensie is gemeng met reaksiemengsel (Earl’s buffer, 5 mM glukose, 10 mM Tris en 10 mM suksinaat) by die relevante pH tot 'n finale volume van 600 μl. Selle is dan vooraf geïnkubeer by 30 ଌ vir 10 min. Vervoer is begin deur die selsuspensie te meng met 'n gespesifiseerde konsentrasie van nie-gemerkte aminosure en 3 H L-aminosuur substrate in Earl’s buffer by die relevante pH. By 30, 60, 90, 120 en 180 sekondes is 100 μl van die mengsel verwyder en direk op 24 mm GF/C glas mikrofiber filters (Whatman 1822 024) geplaas. Filters is twee keer in yskoue Earl’s buffer by die betrokke pH gewas en in skittervloeistof geweek. Opname van 3 H is bepaal deur vloeistofscintillasietelling.


Chiraliteit

Al die aminosure behalwe glisien is chirale molekules. Dit wil sê, hulle bestaan ​​in twee opties aktiewe asimmetriese vorme (genoem enantiomere) wat die spieëlbeelde van mekaar is. (Hierdie eienskap is konseptueel soortgelyk aan die ruimtelike verhouding van die linkerhand tot die regterhand.) Een enantiomeer word aangedui met d en die ander l . Dit is belangrik om daarop te let dat die aminosure wat in proteïene gevind word, byna altyd net die l-konfigurasie besit. Dit weerspieël die feit dat die ensieme wat vir proteïensintese verantwoordelik is, ontwikkel het om slegs die l-enantiomere te gebruik. Om hierdie byna universaliteit weerspieël, word die voorvoegsel l gewoonlik weggelaat. Sommige d-aminosure word in mikroörganismes aangetref, veral in die selwande van bakterieë en in verskeie van die antibiotika. Dit word egter nie in die ribosoom gesintetiseer nie.


Inhoud

Alle aminosure het 'n karboksielterminus (genoem die C-terminus) en 'n aminoterminus (genoem die N-terminus), maar hulle verskil in hul oorblywende groepe. Aminosure word aan mekaar gebind deur 'n kovalente binding wat 'n peptiedbinding genoem word [6] . Aminosure bevat beide 'n karboksielgroep (COOH) en 'n aminogroep (NH2). Die kern-aminosuurstruktuur is:

Waar (R) die syketting uniek is aan elke verskillende aminosuur. Groot aminosure vorm die rigiede gebied van die polipeptiedruggraat terwyl die klein aminosure die buigsame streke van die polipeptied vorm wat die proteïen in sy driedimensionele vorm laat vou. Op die peptiedruggraat is daar buigsame rotasie rondom die peptiedbinding en daar is 'n rigiede planêre peptied wat deur 'n gedeeltelike dubbelbinding veroorsaak word. Dit is wat die polipeptiede se primêre volgorde laat vou tot 'n alfa-heliks wat een string opgerol is. 'n Beta-string is twee stringe wat tot 'n antiparallelle heliks opgerol is. Die kern van die polipeptied bestaan ​​uit die hidrofobiese aminosure soos fenialanien, tirosien en triptofaan [8]. Hierdie drie aminosure is ook aromaties en is die grootste aminosure. Die ander hidrofobiese aminosure, maar is nie aromaties nie, is: prolien, valien, isoleusien, leusien en metionien.

Aminosure word chiraal genoem omdat die alfa-koolstof aan vier verskillende groepe verbind is. Hulle kan bestaan ​​as een van twee spieëlbeelde waarna verwys word as die Levorotatory L-isomeer en die Dextrotatory D-isomeer met slegs die L-vorm van die aminosuur-isomeer teenwoordig in proteïene [9].

Aminosure in oplossing by neutrale pH bestaan ​​hoofsaaklik as dipolêre ione, of zwitterione. In die dipolêre vorm word die aminogroep geprotoneer en die karboksielgroep gedeprotoneer. Die ionisasietoestand van 'n aminosuur wissel met pH [10] . 'n Reeks aminosure wat deur peptiedbindings verbind word, vorm 'n polipeptiedketting, en elke aminosuureenheid in 'n peptied word 'n oorblyfsel genoem. Twee aminosure kan 'n kondensasiereaksie ondergaan om 'n dipeptied te vorm, wat gepaard gaan met die verlies van 'n watermolekule [11] .

Die algemene aminosure word volgens hul sykettings gegroepeer [12] . Byvoorbeeld, suur, basies, ongelaaide polêr en nie-polêr.

Vir basiese sykettings is die aminosure: Lysine (K), Arginine (R) en Histidine (H).

Vir suurkantettings is die aminosure: Asparaginsuur (D) en Glutamiensuur (E) (gevorm deur die byvoeging van 'n proton by die aminosure aspartaat en glutamaat).

Vir ongelaaide polêre sykettings is die aminosure: Asparagine (N), Glutamien (Q), Serine (S), Threonine (T) en Tyrosien (Y).

Proline (P)

Prolien staan ​​ook bekend as 'n aminosuur. wat algemeen in dierlike proteïene voorkom. Dit is nie noodsaaklik vir die menslike dieet nie, aangesien dit in die liggaam gesintetiseer kan word uit glutamiensuur [13]. Anders as ander aminosure wat in die transformasie in polipeptiede voorkom, kan prolien in die cis-vorm in peptiede bestaan. Prolien word dikwels aan die einde van α-heliks of in draaie of lusse aangetref [14] . Proline is die enigste sikliese aminosuur. Dit is as gevolg van Proline wat 'n vreemde, sikliese struktuur het wanneer dit peptiedbindings vorm, dit veroorsaak 'n buiging in die aminosuurketting. Daarom staan ​​prolien ook bekend as alfa-heliksbreker (die ander alfa-heliksbreker is Glycine) [15].

Aminosure in vertaling

Tydens die vertaling van mRNA bind aminosure aan die ribosoom terwyl dit die mRNA lees en met behulp van die inligting wat gegee word, produseer dit 'n spesifieke aminosuurvolgorde deur peptiedbindings te vorm tussen die karboksielgroep van een aminosuur en die aminogroep van 'n ander via 'n kondensasie reaksie. Dit produseer 'n polipeptiedketting. Die 30S subeenheid bind eerstens aan die mRNA, en die 50S subeenheid bind tweede om die 70S inisieerderkompleks te vorm [16].

Sisteïen (C)

Die aminosuur Sisteïen het baie toepassings en speel 'n belangrike rol in proteïenstruktuur. Dit is hoofsaaklik as gevolg van sy tiolgroep. Die tiol (wat bestaan ​​uit 'n swael- en waterstofatoom) is baie vatbaar vir oksidasie, wat sisteïen toelaat om disulfiedbindings met ander molekules, insluitend ander sisteïene, te vorm. Die gevolglike produk van twee gekoppelde sisteïene word sistien genoem. Wanneer dit aan ander sisteïene gebind word, verhoog die disulfiedbinding die stabiliteit van die proteïen aansienlik. Aangesien dit egter 'n oksidasiereaksie is, is dit eksklusief vir ekstrasellulêre proteïene met 'n paar uitsonderings. Dit is omdat die binnekant van die sel hoogs verminderend is wat die disulfiedbinding hoogs onstabiel maak.

Aromatiese Aminosure

Aromatiese Aminosure is die grootste van die aminosure en sluit in fenielalanien (F), tirosien (Y) en triptofaan (W). Hulle kan almal ultraviolet lig absorbeer, maar sommige kan meer absorbeer as ander, tirosien en triptofaan absorbeer meer as fenielalanien wat beteken dat triptofaan die hoofmolekule is wat lig in die proteïen absorbeer. Aromatiese aminosure is ook hidrofobies en is dus in die kern van die proteïen geleë om te verseker dat hulle nie naby water is nie. Mense kan nie fenielalanien of triptofaan sintetiseer nie, en kan slegs tirosien van fenielalanien maak, dit beteken dat aromatiese aminosure 'n noodsaaklike komponent van ons dieet is aangesien ons dit in sekere proteïene benodig, maar dit nie self sintetiseer nie. Aromatiese aminosure bevat 'n aromatiese ring [17] . Fenielalanientekort kan verwarring, depressie, gebrek aan energie en verminderde wakkerheid veroorsaak. Dit kan in 'n tabletvorm gekoop word om enige tekort aan te vul [18] . 'n Onvermoë om oortollige fenielalanien af ​​te breek, word fenielketonurie genoem. Om dit te bekamp word 'n lae fenielalanien dieet gebruik en vermy aspartaam ​​versoeters wat soos fenielalanien lyk en kan afbreek om dit te produseer.


Groep II: Polêre, ongelaaide aminosure

Groep II-aminosure is serien, sisteïen, treonien, tirosien, asparagien en glutamien. Die sykettings in hierdie groep beskik oor 'n spektrum van funksionele groepe. Die meeste het egter ten minste een atoom (stikstof, suurstof of swael) met elektronpare beskikbaar vir waterstofbinding aan water en ander molekules. Die chemiese strukture van Groep II-aminosure is:

Twee aminosure, serien en treonien, bevat alifatiese hidroksielgroepe (dit wil sê 'n suurstofatoom gebind aan 'n waterstofatoom, voorgestel as ―OH). Tirosien het 'n hidroksielgroep in die aromatiese ring, wat dit 'n fenoldivaat maak. Die hidroksielgroepe in hierdie drie aminosure is onderhewig aan 'n belangrike tipe posttranslasionele modifikasie: fosforilering (sien onder nie-standaard aminosure). Soos metionien, bevat sisteïen 'n swaelatoom. Anders as metionien se swaelatoom, is sisteïen se swael egter baie chemies reaktief (sien onder sisteïen oksidasie). Asparagine, wat eers uit aspersies geïsoleer is, en glutamien bevat albei amied R groepe. Die karbonielgroep kan funksioneer as 'n waterstofbinding-aannemer, en die aminogroep (NH2) kan as 'n waterstofbindingskenker funksioneer.


Zwitterions en Aminosure

'n Zwitterioon is 'n molekule met funksionele groepe, waarvan ten minste een 'n positiewe en een 'n negatiewe elektriese lading het. Die netto lading van die hele molekule is nul.

Aminosure is die bekendste voorbeelde van zwitterione. Hulle bevat 'n amiengroep (basies) en 'n karboksielgroep (suur). Die -NH2 groep is die sterker basis, en dus neem dit H + van die -COOH-groep op om 'n zwitterioon te laat (d.w.s. die amiengroep de-protoneer die karboksielsuur): 1

Die (neutrale) zwitterion is die gewone vorm van aminosure wat in oplossing voorkom. Afhangende van die pH, is daar twee ander vorme, 'n anioon en 'n katioon:

Dit stem ooreen met die gedrag van 'n diprotiese suur:

met twee dissosiasie stappe beheer deur twee suur konstantes K1 en K2.

Wanneer 'n aminosuur in water oplos, reageer die zwitterioon met H2O-molekules – wat as beide 'n suur en 'n basis optree. Maar, anders as eenvoudig amfoteries verbindings wat slegs 'n kationiese of anioniese spesie kan vorm, 'n zwitterioon het gelyktydig beide ioniese toestande.

Die eenvoudigste aminosuur is glisien (NH2-CH2-COOH), wat ons met HGly afgekort, of korter met HA met A = Gly-. Sy struktuurformule hierbo getoon het die kortste syketting R = H. Die drie spesies is:

[0] = [H2A + ] = [H2Gly + ]: NH3 + -CH2-KOER (glisinium katioon)
[1] = [HA] = [HGly] : NH3 + -CH2-COO - (neutraal zwitterion)
[2] = [A - ] = [Gly - ] : NH2-CH2-COO - (glisinaat anioon)

Die twee suurkonstantes (in vergelyking met koolsuur) is:

glisien: pK1 = 2.35 pK2 = 9.78
koolsuur: pK1 = 6.35 pK2 = 11.33

Die pH-afhanklikheid van die drie spesies (afgekort deur [j]=[0], [1], [2]) word getoon in die vorm van die ooreenstemmende ionisasie breuke aj = [j]/CT:

Titrasiekurwes. Die titrasiekurwes wys waarmee gebeur glisien soos jy die pH verander deur óf 'n sterk suur (HCl) óf 'n sterk basis (NaOH) by te voeg:

In die linker diagram, vier hoeveelhede CT van glisien word oorweeg. Die berekeninge word gedoen met die analitiese formules wat hier of in die pdf aangebied word. Die kolletjies in die regterdiagram is numeriese berekeninge met aqion.

Bufferkapasiteit en bufferintensiteit

Die wiskundige beskrywing van bufferkapasiteite en -intensiteite is dieselfde as vir gewone sure (behalwe die offset Z=1). Die diagramme hieronder toon die bufferkapasiteit (blou titrasiekurwe) saam met die ooreenstemmende bufferintensiteit β (groen) en sy afgeleide dβ/dpH (rooi). Dit word gedoen vir twee gevalle: oneindig hoë gekonsentreerde glisien en vir CT = 500 mM.

Die klein kolletjies is die nulle van dβ/dpH, wat die uiterstes van die bufferintensiteit β aandui en buigpunte van die titrasiekurwes aandui. Die blou titrasiekurwe in die vorige linkerdiagram is dieselfde as in die laaste diagram behalwe dat die x- en y-as omgeruil word.

Meer voorbeelde vir zwitterioniese sure word hier gegee.

R dui die syketting aan (glisien: R = H, alanien: R = CH3, en so aan). ↩


Aminosure: konsep, klassifikasie en reaksies

Aminosure is die boustene van proteïene. Onder die duisende aminosure wat in die natuur beskikbaar is, bevat proteïene slegs 20 verskillende soorte aminosure, almal van hulle is L-alfa-aminosure. Dieselfde 20 standaard aminosure maak proteïene in al die lewende selle, kan dit óf 'n virus, bakterieë, gis, plant of menslike sel wees. Hierdie 20 aminosure kombineer in verskillende volgordes en getalle om verskillende soorte proteïene te vorm.

Die aantal proteïene wat uit hierdie 20 aminosure verkry kan word, kan uit 20 faktoriaal bereken word, dit wil sê, 20 x 19 x 18 x 17 x 16 x ………… x 2 x 1 = 2.4 x 10 18 . By mense alleen is daar meer as 100 000 verskillende tipes proteïene.

Die algemene formules vir 'n aminosuur kan geskryf word as ‘R-CH-NH2—KOER’. Afhangende van die ‘R’-groep teenwoordig in die aminosuur word dit dienooreenkomstig genoem. Die 20 aminosure wat in die proteïene voorkom, staan ​​bekend as primêre of standaard aminosure. Benewens hierdie, word sommige ander aminosure ook in proteïene aangetref soos 4-hidroksiprolien, 5-hidroksilisien, 6-IV-metiellisien, gamma-karboksiglutamiensuur en desmosien, al hierdie is afgeleides van standaard aminosure.

Klassifikasie van Aminosure:

I. Afhangende van die heffing:

Aminosure kan breedweg in drie hoofgroepe geklassifiseer word:

1. Neutrale aminosure:

Daardie aminosure wat geen lading op die ‘R’ groep bevat.

Hulle word verder in die volgende kategorieë geklassifiseer:

Daardie aminosure wie se ‘R’-groep 'n ketting van koolstofatome bevat—Gly, Ala, Ser, Thr, Val, Leu, lie, Asn, Gin.

Daardie aminosure waarvan die ‘R’-groep 'n benseenring het—Phe, Tyr, Trp.

Die “R”-groep het 'n heterosiliese ring, dit wil sê enige van die ringstrukture wat verskillende atome bevat—Pro, His.

(d) Swael bevat:

Daardie aminosure wat 'n swaelatoom bevat-Cys, Met.

Daardie aminosure wat 'n negatiewe lading of 'n suurgroep bevat-Asp, Glu.

Daardie aminosure wat 'n positiewe lading of 'n basiese groep bevat - Arg, Lys en His.

II. Afhangende van die oplosbaarheid in water:

Die aminosure kan ook in twee verskillende kategorieë gegroepeer word, afhangende van hul oplosbaarheid in water. Hulle is-

1. Hidrofobiese aminosure:

Aminosure wat onoplosbaar is in water staan ​​bekend as hidrofobiese aminosure. Hulle is—Ala, Val, Leu, leuen, Pro, Met, Phe, Trp.

2. Hidrofiliese aminosure:

Aminosure wat in water oplosbaar is, staan ​​bekend as hidrofiliese aminosure. Hulle is—Gly, Ser, Thr, Cys, Tyr, Asp, Asn, Glu, Gin, Lys, Arg, His.

III. Afhangende van hul voedingsvereistes:

Die aminosure word in twee groepe geklassifiseer.

1. Essensiële aminosure:

Is dié wat nie deur die menslike liggaam gesintetiseer kan word nie en daarom moet hulle deur die dieet geneem word. Daar is 10 essensiële aminosure. Onder hierdie aminosure staan ​​arginien en histidien bekend as semi-essensiële aminosure.

2. Nie-essensiële aminosure:

Hierdie sure is dié wat in die menslike liggaam gesintetiseer kan word en word nie in die dieet benodig nie. Dit sluit in gly, ala, ser, pro, tyr, cys, asp, asn, glu, gin.

Reaksies van aminosure:

Fisiese karakters van aminosure:

Aminosure het 'n suurgroep (-COOH-groep), d.w.s. 'n proton, skenker. Hulle het ook 'n basiese groep (—NH2 groep), dit wil sê 'n proton, aanvaarder. 'n Verbinding wat in staat is om beide protone te skenk en te aanvaar en dus as 'n suur of 'n basis kan optree, staan ​​bekend as amfoteriese molekule. Aminosure het beide anione en katione in oplossing en sulke verbindings word zwitterione genoem.

2. Iso-elektriese pH (pH 1 ):

Die pH waarteen die positiewe lading op die aminosuur (of enige ander molekule) gelyk is aan die negatiewe ladings, staan ​​bekend as iso-elektriese pH. By hierdie pH sal die netto lading nul wees en dus beweeg dit nie na positiewe (anode) of na negatiewe (katode) elektrode wanneer dit aan 'n elektriese veld onderwerp word nie. By pH 1 bestaan ​​al die molekules in zwitterioonvorm.

Chemiese eienskappe:

1. Reaksies as gevolg van aminogroep:

Hierdie toets identifiseer of bespeur aminosure. As aminosure met ninhidrien verhit word, vorm hulle 'n persblou gekleurde verbinding, wat kolorimetries gemeet word.

(b) Reaksie met salpetersuur:

Dit is 'n metode waardeur aminosure gemeet word afhangende van die hoeveelheid stikstof wat vrygestel word.

(c) Reaksie met karbonielverbindings (RCHO):

Die aminogroep in die aminosure reageer met karbonielverbindings wat 'n Schiff’s-basis vorm.

(d) Reaksie met Sanger’s reagens:

Aminosure reageer met Sanger’ se reagens, dit wil sê, 1-fluoro-2, 4-dinitrobenseen, wat 'n geelkleurige kompleks vorm. Hierdie reagens word gebruik om die IV-terminale aminosuur in die proteïene op te spoor.

Edmann’ se reagens is fenielisotiosianaat, wat ook gebruik word om die N-terminale aminosuur in 'n proteïen op te spoor. Dit vorm 'n pers gekleurde afgeleide.

(f) Reaksie met dansielchloried:

Dansielchloried, dit wil sê 1-dimetiel-amino-naftaleen-5-sulfonielchloried vorm 'n fluoresserende afgeleide van die N-terminale aminosuur van proteïene. Dit is nog 'n reagens beskikbaar vir die opsporing van N-terminale aminosuur.

(g) Kondensasie van twee aminosure om diketopiperasien te vorm:

Twee aminosure reageer met aminogroepe van elke aminosuur en die karboksielgroepe van die ander aminosuur en vorm 'n diketopiperasien.

2. Reaksie as gevolg van karboksiel:

(a) Reaction with hydrazine:

Hydrazine is used to detect the C-terminal amino acid in proteins. It forms a complex with the amino acid by reacting with the carboxylic group.

3. Reaction due to both amino and carboxylic group:

Due to the presence of both amino (basic) and carboxylic (acid) groups in amino acids, the amino group of one amino acid reacts with the carboxylic group of another amino acid to form a peptide bond.

Polymerization of amino acids in a similar manner gives a polypeptide chain.

The bond linking two amino acids is known as a peptide bond. It is formed due to reaction between an amino group of one amino acid and carboxylic group of another amino acid.

The group forming the peptide bond is known as peptide group. It has a double bond character and hence is very rigid in nature.

Polypeptide or peptide:

A chain made up of two or more amino acids, linked by a peptide bond is known as a polypeptide or just a peptide.

Difference between a peptide and a protein:

A peptide is that which has less than 50 amino acids or whose molecular weight is less than 5000 Daltons. A protein is that which has more than 50 amino acids or whose molecular weight is more than 5000 Daltons. This differentiation is based upon the immunolog­ical property of the two units. Peptides are non-immunogenic, whereas proteins are immunogenic.

N-terminal and C-terminal of a protein:

The end of a protein or polypeptide where the amino group is free in known as N-terminal end and that amino acid whose amino group is free is known as N-terminal amino acid. Sanger’s, Edmann’s and Dansyl chloride are the reagents used to determine the N-terminal amino acids.

The end of the protein or polypeptide whose carboxylic group is free is known as C-terminal end and that amino acid whose carboxylic group is free in the protein is known as C-terminal amino acid. Hydrazine is used to detect the C-terminal amino acid. While representing a protein on paper, the N-terminal amino acid is written first (on the left) and the C-terminal amino acid is the last one (written at the right side of the paper).

Peptides of physiological importance:

It is a tripeptide made up of Glu, Cys and Gly. It is found in RBC and other tissues and functions to prevent oxidation of —SH groups of many enzymes.

(b) Bradykinin and kallidin:

These are small polypeptides containing 9 and 10 amino acids respectively. They are formed by partial hydrolysis of plasma protein due to snake poisoning (venom). They are powerful vasodepressors and inhibitors of heart function. Others are tyrocidin, gramicidin, glucagon, insulin, oxytocin, etc.

The structure of protein can be studied under four different levels of organization, viz., primary, secondary, tertiary and quaternary.