Inligting

Kan Pfx-polimerase slegs een 3' A-oorhang byvoeg?

Kan Pfx-polimerase slegs een 3' A-oorhang byvoeg?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ek probeer om 'n PCR-produk wat met Pfx-polimerase geamplifiseer is, in pGemT-vektor te kloneer. Ek moes die PCR-produk A-stert met Taq-polimerase, aangesien Pfx slegs stomp eindprodukte genereer. My ligasiereaksie was suksesvol, maar toe ek die rye gekry het, is daar 'n ekstra T tussen die 3'end-T van pGem en die beginkodon van my produk. Dit gebeur net in die 3'-kant van pGemT (of 5'-kant van my produk). Kan Pfx-polimerase PCR-produkte genereer met net een 3'end oorhang? of Kan Taq-polimerase twee opeenvolgende dATP tydens die A-stert byvoeg?

Skryf asseblief vir my jou gedagtes so gou moontlik, dit het twee keer gebeur en dit is al 'n pyn :(

GGC CGC GGG A-T-T-T-G ATG GGA AGC ATG AAG

Die twee T's in vetdruk behoort aan pGemT, die T Italic is die ekstra T wat ek van die volgorde-reaksie gekry het. Na die T in kursief kan jy die 5'end van my insetsel vind. Die tweede T (vetgedruk) van pGemT is die een wat afbind met die oorhang A wat deur die A-stertprotokol bygevoeg is.


DNA-polimerase

A DNA-polimerase is 'n lid van 'n familie van ensieme wat die sintese van DNS-molekules van nukleosiedtrifosfate, die molekulêre voorlopers van DNS, kataliseer. Hierdie ensieme is noodsaaklik vir DNS-replikasie en werk gewoonlik in groepe om twee identiese DNS-duplekse van 'n enkele oorspronklike DNS-dupleks te skep. Tydens hierdie proses "lees" DNS-polimerase die bestaande DNS-stringe om twee nuwe stringe te skep wat ooreenstem met die bestaande. [1] [2] [3] [4] [5] [6] Hierdie ensieme kataliseer die chemiese reaksie

DNA-polimerase voeg nukleotiede by die drie prima (3')-punte van 'n DNA-string, een nukleotied op 'n slag. Elke keer as 'n sel verdeel, word DNS-polimerases benodig om die sel se DNS te dupliseer, sodat 'n kopie van die oorspronklike DNS-molekule na elke dogtersel oorgedra kan word. Op hierdie manier word genetiese inligting van geslag tot geslag oorgedra.

Voordat replikasie kan plaasvind, wikkel 'n ensiem genaamd helikase die DNS-molekule uit sy diggeweefde vorm, en breek in die proses die waterstofbindings tussen die nukleotiedbasisse. Dit maak die dubbelstring-DNS oop of "ontrits" om twee enkelstringe DNA te gee wat as sjablone vir replikasie in die reaksie hierbo gebruik kan word.


Kan Pfx-polimerase slegs een 3' A-oorhang byvoeg? - Biologie

Die Polimerase Kettingreaksie (PCR) kan gebruik word om vinnig DNS-fragmente vir kloning te genereer, mits 'n geskikte bron van sjabloon DNS bestaan ​​en voldoende volgorde-inligting bekend is om die ontwerp van primers spesifiek vir die verlangde amplikon moontlik te maak. Anders as tradisionele kloning, bied PCR die vermoë om DNS-fragmente wat van 'n lae oorvloed kan wees in 'n komplekse monster soos genomiese DNS, of cDNA's wat ooreenstem met seldsame mRNA-transkripsies, maklik te kloneer. PCR-produkte kan op tradisionele maniere verteer en afgebind word, direk (stomp of TA-punte) gelig word, of gebruik word in ligasie-onafhanklike kloning (LIC) of naatlose kloningstoepassings, soos Gibson Assembly ® of NEBuilder HIFI DNA Assembly (NEBuilderHiFi.com).

Tydens 'n tipiese PCR word templaat-DNA (wat die streek van belang bevat) gemeng met deoksinukleotiede (dNTP's), 'n DNA-polimerase en primers. Primers is kort segmente van komplementêre DNA wat basispaar met die sjabloon DNA, stroomop van die streek van belang, en dien as werwingsplekke vir die polimerase. PCR behels 'n reeks temperatuursiklusse wat outomaties beheer word deur die gebruik van 'n termosikleerder wat beide die reaksietemperatuur en die duur van elke temperatuurstap presies beheer, wat doeltreffende amplifikasie verseker (vir meer besonderhede oor PCR, sien DNA Amplifikasie).

Vir roetine, robuuste PCR-reaksies EenTaq DNA Polimerase is die mees algemene keuse van ensiem. Hierdie polimerase laat oorwegend sjabloon-onafhanklike enkel adeniene (A) aan die 3&rsquo einde van die PCR produk. Vir hoë-getrou PCR, moet 'n proeflees DNA polimerase gebruik word. Sulke ensieme skep nie enkelbasisoorhange nie, wat stomp eindpunte laat. 'n Oorweging van die punte van PCR-produkte, insluitend hul fosforileringstatus, is belangrik vir daaropvolgende kloningstrategieë (sien Eindmodifikasie). Wanneer PCR-inleiders beperkingsensiemplekke insluit, kan die PCR-produkte op tradisionele wyse verteer en geligeer word.

Vektormolekules vir kloning kan ook deur PCR geproduseer word. Beperkingsplekke wat in die primers ingesluit is, laat die generering van taai punte (enkelstreng-oorhange) toe om kloning van beperkingsfragmente te fasiliteer. Andersins kan 'n stomp-einde vektor geproduseer word deur PCR met behulp van 'n hoë-getrouheid proeflees polimerase of deur stomp van die enkelbasis 3&rsquo oorhang geproduseer deur Taq polimerase. Omgekeerde transkripsie van RNA na eerste string komplementêre DNA (cDNA) gevolg deur PCR (RT-PCR) laat kloning toe van dubbelstring DNA molekules wat ooreenstem met die geentranskripsies (vir mRNA, sien die cDNA sintese).

Kies tipe:

Feature Artikels

Lees oor die verwantskap tussen Polimerasestruktuur en funksie wanneer DNS gekopieer word.


RESULTATE

Gespalkte end-tot-end afbinding van enkelstrengs DNA met behulp van T4 DNA ligase

Om die doeltreffendheid van gespalkte end-tot-end afbinding van enkelstrengs DNA met T4 DNA-ligase in die afwesigheid van haarnaaldstrukture, het ons 'n afbindingskema ontwerp waar die splinteroligonukleotied met 'n gebiotinileerde adaptoroligonukleotied (die skenker) gehibridiseer word, wat die daaropvolgende immobilisering van ligasieprodukte op krale moontlik maak en die splinter verwyder deur ligte hittebehandeling .

Ons het eers die doeltreffendheid van die ligasiereaksie bepaal deur 'n poel van 60 nt oligonukleotiede met ewekansige volgordes ('60N') as aanvaarders te gebruik, wat analoog is aan die situasie in biblioteekvoorbereiding waar die inset-DNS uit stringe van onbekende volgorde bestaan. Onder optimale toestande, T4 DNA-ligase het 1 pmol (~6 × 10 11 molekules) van die 60N-poel byna heeltemal omgeskakel na ligasieprodukte. Merkwaardige doeltreffendheid is ook waargeneem met hoër 60N insethoeveelhede. Trouens, afbindingsdoeltreffendheid was selfs hoër as wat met CircLigase behaal is (Figuur 2). Ons het soortgelyke resultate verkry met die gebruik van ander ewekansig ontwerpte adapter/splinterreekse (Aanvullende Figuur S1), wat die robuustheid van die benadering onderstreep. Ligeringsdoeltreffendheid het slegs afgeneem wanneer aanvaardermolekules van 'n gedefinieerde volgorde gebruik is in plaas van 'n poel van oligonukleotiede, soos verwag as gevolg van die beperkte beskikbaarheid van splinters met voldoende volgorde komplementariteit tot die aanvaarder (Aanvullende Figuur S2).

'n Vereenvoudigde metode van enkelstrengige biblioteekvoorbereiding

Om te evalueer of gespalkte enkelstrengige afbinding met T4 DNA-ligase kan CircLigase vervang in enkelstrengige biblioteekvoorbereiding, ons het biblioteke geskep met beide afbindingstrategieë deur 'n DNS-ekstrak van 'n >50 000 jaar oue grotbeer te gebruik. Dit is belangrik om daarop te let dat CircLigase 'n aktiwiteitsoptimum van ongeveer 60°C ( 14) toon, terwyl gespalkte enkelstrengige DNA-ligasie met T4 DNA-ligase word by 'n laer temperatuur (37°C) uitgevoer. Aangesien verlaagde temperatuur teoreties interaksies tussen DNS-stringe kan bevorder wat met afbinding kan inmeng, het ons biblioteke van vier verskillende volumes (1, 3, 9 en 27 μl) DNS-ekstrak voorberei om die sensitiwiteit van die reaksie vir wisselende konsentrasies van inset DNS te bepaal.

Gebaseer op biblioteekkwantifisering deur kwantitatiewe PCR en volgordebepaling op Illumina se MiSeq-stelsel, het ons die informatiewe volgorde-inhoud in elke biblioteek (Aanvullende Tabel S3) bereken, dit wil sê die som van nukleotiede wat in beeragtige rye van lengte 35 of meer bestaan. Hierdie maatstaf verontagsaam molekules wat te kort is om sekerlik na die verwysingsgenoom gekarteer te word en kompenseer vir die laer inligtingsinhoud in kort reekse. Vir klein volumes uittreksel het ons die verwagte lineêre toevoer/afvoer verhouding met beide metodes waargeneem (Figuur 3A). Interessant genoeg het ons egter 'n afname in biblioteekopbrengs waargeneem met die hoogste insetvolumes van ekstrakte (9 en 27 μl) vir CircLigase, maar nie T4 DNA ligase biblioteke. CircLigase biblioteke met hoër insetvolumes word ook beïnvloed deur ander vooroordele, insluitend langer insetselgroottes, laer GC-inhoud en hoër frekwensies van C tot T substitusies aan hul 3΄-kant (Figuur 3B–D) as dié wat deur T4 DNA ligase. Die uitgesproke asimmetrie in C tot T substitusies, wat voortspruit uit deaminering van sitosien na uracil in antieke DNA (30), dui op 'n minder doeltreffende afbinding van 3΄ sitosiene in vergelyking met timiene deur CircLigase in die teenwoordigheid van hoë konsentrasies DNA. Hierdie vooroordele kan wees as gevolg van versadiging van die CircLigase-reaksie met DNA (31) of 'n laer sensitiwiteit van die gespalk-ligasieskema vir inhiberende stowwe wat saam uit die been onttrek word.

Effekte van enkelstrengige ligasieskemas op biblioteekkenmerke. (A) Insiggewende volgorde inhoud van biblioteke voorberei met CircLigase en T4 DNA-ligase as 'n funksie van die insetvolume van antieke DNA-ekstrak wat vir biblioteekvoorbereiding gebruik word. (B) Gemiddelde GC-inhoud van die volgordes wat met die twee ligasieskemas verkry is. Let daarop dat die gemiddelde GC-inhoud dié van 'n tipiese soogdiergenoom oorskry omdat die meeste volgordes afkomstig is van mikrobiese DNA, wat die dominante bron van DNA in die meeste antieke bene is. (C) Fragmentgrootteverspreiding in die biblioteke soos afgelei van oorvleueling-saamgevoegde gepaarde-end-lesings. Kort artefakte in die biblioteek wat van uiters min inset-DNA voorberei is (wat ooreenstem met ~1 mg been) is hoofsaaklik as gevolg van die inkorporering van splinterfragmente. (D) Frekwensies van skade-geïnduseerde C tot T substitusies naby die 5΄ en 3΄ eindes van rye.

Effekte van enkelstrengige ligasieskemas op biblioteekkenmerke. (A) Insiggewende volgorde inhoud van biblioteke voorberei met CircLigase en T4 DNA-ligase as 'n funksie van die insetvolume van antieke DNA-ekstrak wat vir biblioteekvoorbereiding gebruik word. (B) Gemiddelde GC-inhoud van die volgordes wat met die twee ligasieskemas verkry is. Let daarop dat die gemiddelde GC-inhoud dié van 'n tipiese soogdiergenoom oorskry omdat die meeste volgordes afkomstig is van mikrobiese DNA, wat die dominante bron van DNA in die meeste antieke bene is. (C) Fragmentgrootteverspreiding in die biblioteke soos afgelei uit oorvleueling-saamgevoegde gepaarde-end-lesings. Kort artefakte in die biblioteek wat van uiters min inset-DNA voorberei is (wat ooreenstem met ~1 mg been) is hoofsaaklik as gevolg van die inkorporering van splinterfragmente. (D) Frekwensies van skade-geïnduseerde C tot T substitusies naby die 5΄ en 3΄ eindes van rye.

Nog 'n stap in enkelstrengige biblioteekvoorbereiding met potensiaal vir verbetering is die sintese van die tweede string, wat uitgevoer word met Bst polimerase in die oorspronklike protokol, wat dus daaropvolgende stomp-end herstel vereis om nukleotiede te verwyder wat bygevoeg is deur die terminale transferase aktiwiteit van die ensiem. Omdat dit wenslik is om beide reaksies in een stap uit te voer, het ons bykomende biblioteke gegenereer uit twee ou DNS-ekstrakte sowel as 'n kontrole-oligonukleotied met Bst polimerase en twee proeflees-ensieme: T4 DNA-polimerase en die Klenow-fragment van E coli DNA-polimerase I. Laasgenoemde ensiem is reeds onlangs in enkelstrengige biblioteekvoorbereiding gebruik ( 22), maar sonder om data aan te bied wat die prestasie daarvan vergelyk met Bst polimerase. Daarbenewens het ons ingesluit Sulfolobus DNA-polimerase IV (Dpo4) in die eksperiment. Soortgelyk aan Bst polimerase, Dpo4 het nie 3΄-5΄ eksonuklease-aktiwiteit nie, maar inkorporeer nukleotiede oor 'n wye reeks DNA-letsels en kan dus besonder doeltreffend wees om hoogs beskadigde antieke DNA-molekules te kopieer (32). Om eksonukleolitiese afbraak te voorkom, het ons drie kragaftakkerverbindings in die 3΄-terminus van die verlengingsonderlaag ingebring vir die gebruik daarvan met T4 DNA-polimerase en Klenow-fragment. Die opbrengs van biblioteekmolekules het relatief min onder die polimerases gewissel, met effens hoër winste van molekules in die biblioteke wat voorberei is met polimerases wat 3΄-5΄ eksonuklease-aktiwiteit ontbreek (Bst polimerase en Dpo4) (Aanvullende Figuur S3a en Aanvullende Tabel S3). Ondersoek van die volgorde-belynings het geen verhoogde substitusiefrekwensies behalwe van C na T aan die lig gebring nie, insluitend in die biblioteke wat met Dpo4 voorberei is. Ons het dus geen sein opgespoor wat die teenwoordigheid van voorheen onopgespoorde tipes skade in antieke DNA sou voorstel wat tot valse inkorporasies van nukleotiede kan lei as gevolg van die letsel-omleidingsvermoë van hierdie ensiem nie. Ons het egter aansienlike verskille in die frekwensies van C tot T-substitusies naby die 5΄-punte van volgordebelynings opgespoor, veral met T4 DNA-polimerase, wat gelei het tot 'n uitgesproke ontneming van C na T substitusies tussen die tweede en ongeveer die tiende belyningsposisie. Dit dui daarop dat laasgenoemde ensiem minder doeltreffend is in die inkorporering van nukleotiede oor uracils wat naby die 5΄ einde van templaatstringe geleë is (Aanvullende Figuur S3b). Aangesien polimerase keuse slegs 'n klein impak op biblioteekopbrengste gehad het, het ons gekies om te vervang Bst polimerase met die Klenow-fragment om een ​​reaksiestap uit die protokol uit te skakel.

'n Vergelyking van biblioteekvoorbereidingsmetodes op gedegradeerde DNA

Om die werkverrigting van ssDNA2.0 met dié van CircLigase-gebaseerde biblioteekvoorbereiding te vergelyk, het ons DNS-biblioteke van verskeie bronne voorberei: verskeie antieke bene, weefsels wat vir 5 tot 11 jaar in formalien gestoor is, sirkulerende selvrye DNS en geskeerde genomiese DNS. Daarbenewens het ons in hierdie vergelyking die twee dubbelstring-metodes ingesluit wat die meeste in vorige studies van antieke DNA gebruik is. Die eerste is 'n metode wat oorspronklik ontwikkel is vir die volgordebepaling van hoë-gehalte DNA deur 454 Lewenswetenskappe (33) en later aangepas is vir die gebruik met hoogs gedegradeerde DNA (23, 24). Dit is gebaseer op die afbinding van 'n adaptermengsel aan stomp-end herstelde ou DNA-fragmente met behulp van T4 DNA-ligase (Figuur 1C). Alhoewel die helfte van die molekules met identiese adapters gelaat word en dus ontoeganklik is vir stroomafwaartse amplifikasie en volgordebepaling, is die metode robuust, relatief goedkoop en dus wyd gebruik in antieke DNS-studies, veral dié wat groot getalle monsters behels (34, 35) ). Die tweede dubbelstring-metode is oorspronklik deur Illumina (36) voorgestel en maak staat op T/A-oorhangligasie van 'n vurkagtige adapter, of, in die implementering van New England Biolabs se NEBNext Ultra II DNA Library Prep Kit vir Illumina wat gebruik word hier, 'n klokvormige adapter (Figuur 1D). Die Illumina-metode maak rigtinggewende afbinding en 'n groter mate van vereenvoudiging moontlik, bv. deur sommige of al die reaksies te kombineer sonder intermitterende suiweringsstappe. Dit word wyd gebruik vir biblioteekvoorbereiding van hoë-gehalte DNA, maar verteenwoordig 'n minder ideale keuse vir hoogs afgebreekte DNA, aangesien dit grootte-selektiewe suiwering vereis om adapter dimere te verwyder. Die metode dra ook die risiko vir die vorming van chimeriese artefakte wanneer dit met kort DNA-fragmente gebruik word (37).

Die inhoud van insiggewende nukleotiede is soortgelyk in die biblioteke wat voorberei is met ssDNA2.0 en die CircLigase-gebaseerde metode vir alle monsters (Figuur 4). Albei metodes presteer konsekwent beter as die beste dubbelstringmetode wanneer dit met hoogs afgebreekte DNA gebruik word. Met ssDNA2.0 is insiggewende volgorde-opbrengste gemiddeld 11,6 keer hoër vir die antieke DNA-ekstrakte en 1,4 keer vir selvrye DNA. In ooreenstemming met vorige verslae (9, 10), verhoog enkelstrengige biblioteekvoorbereiding ook die proporsie van gekarteerde volgordes in die antieke DNA-biblioteke (Aanvullende Figuur S5), wat sodoende die las van mikrobiese kontaminasie in volgordebepaling verminder. Opvallend is dat biblioteekopbrengste van formalien-gefixeerde DNA ~150- tot ~3100-voudig hoër is met enkelstrengige biblioteekvoorbereiding, wat meervoudige dekking genoomvolgordebepaling moontlik maak van ekstrakte wat andersins feitlik geen volgorde-inligting oplewer nie. Biblioteekopbrengste van die gedegradeerde DNS-monsters is die laagste met die Illumina-metode, wat ten minste deels te wyte is aan 'n verlies aan kort molekules (sien Aanvullende Figuur S4 vir volgordelengteverdelings). Daar moet ook op gelet word dat die spesifieke implementering van Illumina-tipe biblioteekpreparaat wat hier gebruik word, biblioteekopbrengste van antieke DNA verminder as gevolg van uracil-DNA-glikosilase behandeling, wat amplifikasie van DNA-stringe wat uracils bevat voorkom, waarvan ongeveer die helfte voortduur deur die stomp- einde herstel stap ( 30).

Uitvoering van enkel- en dubbelstring-biblioteekvoorbereidingsmetodes deur gebruik te maak van DNA uit verskillende bronne. Die insiggewende volgorde-inhoud van elke biblioteek word verskaf in persentasie van dit wat verkry is met die beste presterende metode vir elke monster. Daarbenewens is die aantal kerngenome wat in elke biblioteek teenwoordig is, bereken deur die insiggewende volgorde-inhoud te deel deur die grootte van die verwysingsgenoom wat vir kartering gebruik word.

Uitvoering van enkel- en dubbelstring-biblioteekvoorbereidingsmetodes deur gebruik te maak van DNA uit verskillende bronne. Die insiggewende volgorde-inhoud van elke biblioteek word verskaf in persentasie van dit wat verkry is met die beste presterende metode vir elke monster. Daarbenewens is die aantal kerngenome wat in elke biblioteek teenwoordig is, bereken deur die insiggewende volgorde-inhoud te deel deur die grootte van die verwysingsgenoom wat vir kartering gebruik word.

Alle biblioteekvoorbereidingsmetodes het aansienlike getalle biblioteekmolekules geproduseer, selfs in die afwesigheid van inset-DNA (Aanvullende Tabel S3). Hierdie artefakte word hoofsaaklik veroorsaak deur die inkorporering van onvolmaakte gesintetiseerde adaptor-oligonukleotiede in die biblioteke. ssDNA2.0 is meer geneig tot die vorming van artefakte as CircLigase-gebaseerde biblioteekvoorbereiding, aangesien dit 'n bykomende oligonukleotied gebruik om enkelstrengige ligasie te bemiddel. Deur die blokkeermodifikasies van die splinteroligonukleotied in die loop van ons eksperimente te verander, was ons in staat om artefakvorming in biblioteekvoorbereiding agtereenvolgens te verminder tot ~4 × 10 7 molekules (Aanvullende Tabel S3). Hierdie getal is effens hoër as die ~2 × 10 7 molekules verkry met CircLigase-gebaseerde biblioteekvoorbereiding en die ~1 × 10 7 en ~3 × 10 7 artefakte wat met die twee dubbelstringmetodes gegenereer is, maar laer as die ~1 × 10 8 molekules wat voorheen gerapporteer is vir die CircLigase-metode (4), wat aandui dat nie net die chemiese struktuur van oligonukleotiede nie, maar ook bondel-tot-batch variasie in oligonukleotiedsintese bydra tot artefakvorming. Aangesien baie meer biblioteekmolekules verkry word uit dieselfde hoeveelheid monster-DNA met enkelstrengige biblioteekvoorbereiding, is artefakte in laer proporsies in hierdie biblioteke teenwoordig (Aanvullende Tabel S3), wat die geskiktheid van enkelstrengige biblioteekvoorbereiding verder beklemtoon vir werk met klein hoeveelhede hoogs afgebreekte DNA.

Vir die antieke DNA-biblioteke het ons konsekwent laer deaminering-geïnduseerde C tot T substitusiefrekwensies by die 3΄-punte in die ssDNA2.0 waargeneem in vergelyking met die CircLigase-biblioteke (Aanvullende Figuur S6). Alhoewel hierdie sein gedeeltelik te wyte kan wees aan voorkeurligasie van uracils deur CircLigase soos hierbo beskryf, het ons ook 'n onderverteenwoordiging van timiene waargeneem binne die laaste ses posisies van ssDNA2.0-volgordes (Aanvullende Figuur S7), wat in lengte presies ooreenstem met die hibridisasieplek van die splinteroligonukleotied. Hierdie sein dui daarop dat DNS-stringe met timienryke 3΄-punte - en moontlik ook dié met uracil-ryke punte - minder doeltreffend verbind word deur gespalkbinding. Om te ondersoek of die lengte van die gedegenereerde volgorde oorhang van die splinter-oligonukleotied bydra tot afbindingsvooroordeel, het ons addisionele biblioteke van een van die ou DNA-ekstrakte voorberei deur splinters met sewe en agt gedegenereerde basisse te gebruik. Terwyl die algehele opbrengs van biblioteekmolekules soortgelyk is aan die drie splinters (Aanvullende Figuur S8a), vind ons dat langer splinters beide die timieninhoud (Aanvullende Figuur S7) sowel as die frekwensie van C tot T substitusie aan die 3΄ einde van volgordes (Aanvullende Figuur S8b), wat daarop dui dat langer splinters ligasie-vooroordele wat met gespalkte DNA-ligasie geassosieer word, verminder.


Tipes ensieme betrokke by DNA-sintese en kloning: 7 tipes

Die sewe tipes ensieme is: (1) Alkaliese fosfatase (2) Terminale oordragase (3) Termo-stabiele DNA Polimerases (4) Bakteriofaag RNA Polimerases (5) Nukleases: DNase en RNase (6) Polinukleotied Kinase en (7) DNA Ligase .

Tipe # A. Alkaliese fosfatase:

Alkaliese fosfatase verwyder 5′ fosfaatgroepe van DNA en RNA (Fig. 13.4). Dit sal ook fosfate uit nukleotiede en proteïene verwyder. Hierdie ensieme is die aktiefste by alkaliese pH, daarom staan ​​bekend as alkaliese fosfatase.

Daar is verskeie bronne van alkaliese fosfatase wat verskil in hoe maklik hulle kan inaktiveer:

1. Bakteriële alkaliese fosfatase (BAP) is die mees aktiewe van die ensieme, maar ook die moeilikste om te vernietig aan die einde van die defosforileringsreaksie.

2. Kalfderm alkaliese fosfatase (CIP) word uit beesderm gesuiwer. Dit is fosfatase wat die meeste in molekulêre biologie laboratoriums gebruik word, want, hoewel minder aktief as BAP, kan dit effektief vernietig word deur proteasevertering of hitte (75 °C vir 10 minute in die teenwoordigheid van 5 mM EDTA).

3. Garnale alkaliese fosfatase is afkomstig van 'n kouewatergarnale en word bevorder om maklik deur hitte vernietig te word (65°C vir 15 minute).

Daar is twee primêre gebruike vir alkaliese fosfatase in DNA-manipulasies:

1. Verwydering van 5′ fosfate van plasmied- en bakteriofaag-vektore wat met 'n beperkingsensiem gesny is. In daaropvolgende ligasiereaksies voorkom hierdie behandeling selfligering van die vektor en fasiliteer daardeur ligasie van ander DNS-fragmente in die vektor grootliks (bv. subkloning).

2. Verwydering van 5′ fosfate uit fragmente van DNA voor etikettering met radioaktiewe fosfaat. Polinukleotiedkinase is baie meer effektief in die fosforilering van DNA as die 5′ fosfaat voorheen verwyder is.

Dit word gewoonlik aanbeveel dat defosforilering van DNS'e met stomp of 5′-ingeboude ente uitgevoer word deur gebruik te maak van 'n hoër konsentrasie alkaliese fosfatase of by hoër temperature as vir DNS'e met 5′ oorhange.

Tik # B. Terminale oordrag:

Terminale transferase kataliseer die toevoeging van nukleotiede tot die 3′ terminus van DNA. Interessant genoeg werk dit op enkelstring-DNS, insluitend 3′ oorhange van dubbelstring-DNS, en is dus 'n voorbeeld van 'n DNA-polimerase wat nie 'n onderlaag benodig nie. Dit kan ook homo-polimere van ribo-nukleotiede by die 3′ einde van DNA voeg. Die substraat wat baie verkies word vir hierdie ensiem is 3′-punte wat uitsteek, maar dit sal ook, minder doeltreffend, nukleotiede by stompe en 3′-ingeboude punte van DNS-fragmente voeg. Kobalt is 'n noodsaaklike kofaktor vir aktiwiteit van hierdie ensiem.

1. Benoem die 3′-punte van DNA:

Mees algemeen is die substraat vir hierdie reaksie 'n fragment van DNA wat gegenereer word deur vertering met 'n beperkingsensiem wat 'n 3′ oorhang laat, maar oligodeoksinukleotiede kan ook gebruik word. Wanneer sulke DNA geïnkubeer word met gemerkte nukleotiede en terminale oordragase, sal 'n string van die gemerkte nukleotiede by die 3′ oorhang of aan die 3′ einde van die oligonukleotied gevoeg word (Fig. 13.5).

2. Voeg komplementêre homopolimeriese sterte by DNA:

Hierdie slim prosedure is algemeen in die verlede gebruik om cDNA's in plasmiedvektore te kloneer, maar is grootliks deur ander, baie doeltreffender tegnieke vervang. Die beginsels van hierdie tegniek word in die Figuur 13.6 uitgebeeld. Basies word terminale transferase gebruik om 'n gelineariseerde plasmiedvektor met G’s en die cDNA met C’s. Wanneer saam geïnkubeer, die komplementêre G’s en C’s uitgloei om “insert” die cDNA in die vektor, wat dan omskep word in E. coli.

Terminale transferase is 'n soogdierensiem wat in limfosiete uitgedruk word. Die ensiem wat kommersieel aangekoop word, word gewoonlik geproduseer deur uitdrukking van die beesgeen in E. coli.

Tik # C. Termo-stabiele DNA Polimerases (TAQ Polimerase):

Dit is interessant hoe sommige onbelangrike ontdekkings na 'n tyd iets van groot praktiese belang word. Dit is die geskiedenis van Taq DNA-polimerase. Die oorspronklike verslag van hierdie ensiem, gesuiwer van die warmwaterbronbakterie Thermus aquaticus, is in 1976 gepubliseer (Fig. 13.7). Sowat 10 jaar later is die polimerase-kettingreaksie ontwikkel en kort daarna het “Taq” 'n huishoudelike woord in molekulêre biologie-kringe geword. Tans is die wêreldmark vir Taq-polimerase in die honderde miljoene dollars elke jaar.

Die termofiele DNA-polimerases, soos ander DNA-polimerases, kataliseer templaat-gerigte sintese van DNA vanaf nukleotiedtrifosfate. 'n Onderlaag met 'n vrye 3′ hidroksiel is nodig om sintese te inisieer en magnesiumioon is nodig.

Oor die algemeen het hulle maksimum katalitiese aktiwiteit by 75° tot 80°C, en aansienlik verminderde aktiveer by laer temperature. By 37°C het Taq-polimerase slegs sowat 10% van sy maksimum aktiwiteit. Benewens Taq DNA-polimerase, is verskeie ander termostabiele DNA-polimerases geïsoleer en uitgedruk uit gekloonde gene. Drie van die mees gebruikte polimerases word in Tabel 13.2 beskryf.

Tik # D. Bakteriofaag RNA Polimerases:

Faag-gekodeerde DNA-afhanklike RNA-polimerases word gebruik vir in vitro transkripsie om gedefinieerde RNA's te genereer. Mees algemeen gebruik die reaksie ribo-nukleotiede wat met radio-nukliede of 'n ander merker gemerk is, en die resulterende gemerkte RNA word as 'n sonde vir hibridisasie gebruik. Ander toepassings van in vitro transkripsie insluitend die maak van RNA's vir in vitro translasie of om RNA-struksie en -funksie te bestudeer. Verskeie bakteriofaag-RNA-polimerases is kommersieel beskikbaar. Hulle is vernoem na die fage wat vir hulle kodeer, en óf gesuiwer van faag-geïnfekteerde bakterieë óf geproduseer as rekombinante proteïene.

Baie van die plasmiede wat gebruik word om gekloonde DNA te dra, inkorporeer promotors vir bakteriofaag-RNA-polimerases langs die kloningsplek. Dit stel 'n mens in staat om óf mRNA sintuig óf antisense transkripsies van die ingevoegde DNA maklik te verkry. Die proses word dikwels aflooptranskripsie genoem, omdat die plasmied met 'n beperkingsensiem stroomaf van die ingevoegde DNA gesny word, wat veroorsaak dat die polimerase van die sjabloon afval wanneer dit daardie plek bereik.

As ons aanvaar dat die RNA wat getranskribeer is (Fig. 13.8) die polariteit van 'n mRNA het (bv. sin), is dit maklik om die konstruk te verander om 'n antisense RNA uit te druk – keer eenvoudig die oriëntasie van die getranskribeerde streek om. Inderdaad, die meeste plasmiede wat vir in vitro transkripsie gebruik word, het twee verskillende faagpolimerase-promotors wat die invoegplek flankeer, wat transkripsie van sin-RNA met een polimerase en antisense met die ander moontlik maak.

Tik # E. Nukleases: DNase en RNase:

Die meeste van die tyd is nukleases die vyand van die molekulêre bioloog wat probeer om die integriteit van RNA- of DNA-monsters te bewaar. Deoksiribonukleases (DNases) en ribonukleases (RNases) het egter sekere onontbeerlike rolle in molekulêre biologie laboratoriums.

Talle tipes DNase en RNase is geïsoleer en gekarakteriseer. Hulle verskil onder andere in substraatspesifisiteit, kofaktorvereistes, en of hulle nukleïensure intern klief (endonukleases), inkou van die ente (eksonukleases) of in beide hierdie modusse aanval.

In baie gevalle hang die substraatspesifisiteit van 'n nuklease af van die konsentrasie ensiem wat in die reaksie gebruik word, met hoë konsentrasies wat minder spesifieke splitsings bevorder. Die nukleases wat die meeste gebruik word, is DNase I en RNase A, wat albei van beespankreas gesuiwer word: Deoksiribonuklease I klief dubbel- of enkelstring-DNS. Splyting vind by voorkeur plaas langs pirimidien (C of T) residue, en die ensiem is dus 'n endonuklease. Belangrikste produkte is 5′-gefosforileerde di-, tri- en tetra-nukleotiede.

In die teenwoordigheid van magnesiumione hidroliseer DNase I elke string van dupleks DNA onafhanklik, wat ewekansige splitsings genereer. In die teenwoordigheid van mangaanione, klief die ensiem beide DNA-stringe op ongeveer dieselfde plek, wat stomp punte of fragmente met 1-2 basis oorhange produseer. DNase I klief nie RNA nie, maar ru-preparate van die ensiem is besmet met RNase A RNase-vrye DNase I is geredelik beskikbaar.

Aansoeke:

1. Eliminering van DNA (bv. plasmied) uit preparate van RNA.

2. Ontleed DNA-proteïen-interaksies via DNase-voetafdruk.

3. Knip DNA voor radio-etikettering deur nick translasie.

Ribonuklease A is 'n endoribonuklease wat enkelstring-RNA aan die 3′-punt van pirimidienresidu's klief. Dit degradeer die RNA in 3′-gefosforileerde mononukleotiede en oligonukleotiede. Die hoofgebruik van RNase A is om RNA-kontaminasie uit te skakel of te verminder in voorbereidings van plasmied DNA.

Kartering van mutasies in DNA of RNA deur wanpassplyting:

RNase sal die RNA in RNA-DNA basters by plekke van enkelbasis-wanpassings klief, en die splitsingsprodukte kan ontleed word. 'n Aantal ander nukleases wat gebruik word om DNA en RNA te manipuleer, word in Tabel 13.3 beskryf.

a. Eksonukleases is ensieme (gevind as individuele ensieme, of as dele van groter ensiemkomplekse) wat nukleotiede een op 'n slag van 'n punt van 'n polinukleotiedketting afsplit. Hierdie ensieme hidroliseer fosfodiesterbindings vanaf óf die 3′ of 5′ terminus van 'n polinukleotiedmolekule (Fig. 13.9).

b. Endonukleases is ensieme wat die fosfodiësterbinding binne 'n polinukleotiedketting splits, in teenstelling met eksonukleases, wat fosfodiesterbindings aan die einde van 'n polinukleotiedketting klief. Beperkingsendonukleases (Restriction Enzymes) klief DNA op spesifieke plekke, en word verdeel in drie kategorieë, Tipe I, Tipe II en Tipe III, volgens hul meganisme van werking. Hierdie ensieme word dikwels in genetiese ingenieurswese gebruik om rekombinante DNA te maak vir inbring in bakteriese, plant- of dierselle (Fig. 13.10).

Tik # F. Polinukleotiedkinase:

Polinukleotiedkinase (PNK) is 'n ensiem wat die oordrag van 'n fosfaat vanaf ATP na die 5′ einde van óf DNA óf RNA kataliseer. Dit is 'n produk van die T4-bakteriofaag, en kommersiële preparate is gewoonlik produkte van die gekloonde faaggeen wat in E. coli uitgedruk word.

Die ensiematiese aktiwiteit van PNK word in twee tipes reaksies gebruik:

1, In die “voorwaartse reaksie”, dra PNK die gamma-fosfaat van ATP oor na die 5′ einde van 'n polinukleotied (DNA of RNA). Die teikennukleotied ontbreek 'n 5′ fosfaat óf omdat dit gedefosforileer is óf chemies gesintetiseer is.

2. In die “uitruilreaksie”, teiken DNA of RNA wat 'n 5′ fosfaat het, word geïnkubeer met 'n oormaat ADP, PNK sal eers die fosfaat van die nukleïensuur na 'n ADP oordra, wat ATP vorm en 'n gedefosforileerde teiken. PNK sal dan 'n voorwaartse reaksie uitvoer en 'n fosfaat vanaf ATP na die teikennukleïensuur oordra (Fig. 13.11).

Soos u kan verwag, is die doeltreffendheid van fosforilering via die uitruilreaksie aansienlik minder as vir die voorwaartse reaksie. In addition to its phosphorylating activity, PNK also has 3′ phosphatase activity, although this has little significance to molecular technologists.

There are two major indications for phosphorylating nucleic acids and hence uses of PNK are:

1. Phosphorylating linkers and adaptors (fragments of DNA ready for ligation) which require a 5′ phosphate. This includes products of polymerase chain reaction, which are typically generated using non-phosphorylated primers.

2. Radiolabelling oligonucleotides, usually with 32P, for use as hybridization probes. PNK is inhibited by small amounts of ammonium ions, so ammonium acetate should not be used to precipitate nucleic acids prior to phosphorylation. Low concentrations of phosphate ions, or NaCl concentrations greater than about 50 mM, also inhibit this enzyme.

Type # G. DNA Ligase:

The term recombinant DNA includes the concept of recombining fragments of DNA from different sources into a new and useful DNA molecule. Joining linear DNA fragments together with covalent bonds is called ligation. More specifically, DNA ligation involves creating a phosphodiester bond between the 3′ hydroxyl of one nucleotide and the 5′ phosphate of another.

The enzyme used to ligate DNA fragments is T4 DNA ligase, which originates from the T4 bacteriophage. This enzyme will ligate DNA fragments having overhanging, cohesive ends that are annealed together, as in the EcoRI (Fig. 13.12). This is equivalent to repairing “nicks” in duplex DNA. T4 DNA ligase will also ligate fragments with blunt ends, although higher concentrations of the enzyme are usually recommended for this purpose.


General PCR application information

What factors are critical for multiplex PCR?

All primer pairs used in multiplex PCR should have similar priming efficiencies for their target DNA. This can be achieved by using primers with nearly identical optimum annealing temperatures.

When designing primers, pay special attention the following parameters:

  • Homology with the target nucleic acid sequence
  • Lengte
  • GC content
  • Concentration
  • Primer homology (primers should not have homology either internally or with one another, especially at the 3' ends)

What is nested PCR?

Nested PCR is a method that involves re-amplification to improve PCR results. Nested PCR involves designing a new forward-nested (FN) or reverse-nested (RN) primer that is internal to the original primer and can pair with the original partner primer. A very small amount of the primary PCR product is used as a template for PCR with nested primers.

Nested PCR frequently leads to improved yield of the desired PCR product by:

  • Eliminating extra bands that may have been present in the initial PCR
  • Producing a robust band that may have been weak or invisible in the initial PCR

It is important to note that only a very small amount of the primary product should be used in nested PCR because this template has very low sequence complexity. To start, the primary PCR product can be diluted 1:100, and 1 µl can be used as the template for nested PCR. Also, you may need to reduce the number of cycles to 25&ndash30. The optimal conditions for nested PCR should be determined empirically.

What is touchdown PCR (TD-PCR) and when would I need to use it?

During the PCR denaturation step, all DNA molecules will become single stranded. When the temperature decreases for annealing, three types of duplexes can be formed:

  • Homoduplexes&mdashannealing of complementary strands
  • Heteroduplexes&mdashcross-hybridization of homologous sequences that may have partial homology
  • Duplexes between primers and template

To achieve higher specificity, heteroduplex formation should be minimized by increasing stringency (i.e., increasing the temperature) during the initial PCR cycles. Touchdown PCR increases specificity by using reaction conditions that gradually reduce the annealing temperature. The initial annealing temperature is set to several degrees above the estimated Tm of the primers. In subsequent cycles, the annealing temperature is slowly decreased until it reaches the calculated annealing temperature of the primers (Don 1991). By using a higher annealing temperature in the initial PCR cycles, touchdown PCR favors accumulation of amplicons for sequences with the highest primer-template complementarity, thereby enriching for the most specific amplicons. Transitioning to a lower temperature during subsequent cycles reduces stringency, improving priming conditions with the already enriched, desired template. We recommend performing an initial 5&ndash10 cycles with the higher annealing temperature, and then gradually decreasing the temperature until the optimal annealing temperature, or "touchdown temperature," is reached. For example, if the Tm of your primers is 68°C, the recommended TD-PCR conditions for the annealing temperature are:

Verwysings

Don, R. H., et al. 'Touchdown' PCR to circumvent spurious priming during gene amplification. Nucl Acids Res. 19(14):4008 (1991).

How can I clone a blunt-end PCR product into a TA-cloning vector?

If a PCR product is amplified with a high-fidelity polymerase that generates blunt ends, you can perform A-tailing using Taq polymerase. A brief protocol for adding 3' A-overhangs to PCR products is provided below.

  1. Purify the PCR product. Before adding overhangs, it is very important to remove all of the polymerase in the reaction by purifying the PCR product using a PCR purification kit or by phenol extraction and DNA precipitation. This step is critical, since the proofreading activity of any residual DNA polymerase would degrade the A overhangs, thus recreating blunt ends.
  2. Prepare the Taq DNA polymerase reaction mix:

*The A-addition reaction works best when a specific amount of the PCR product is used. The recommended amount is 10&ndash100 ng per 100 bp of the PCR product. This corresponds to 0.15&ndash1.5 pmol of PCR product (see table below).

PCR product size Amount of PCR product to use
100 bp 10&ndash100 ng
250 bp 25&ndash250 ng
1,000 bp 100&ndash1,000 ng

3. Incubate for 20 min at 72°C.

Proceed to TA cloning. For optimal ligation efficiency, it is best to use fresh PCR products, since 3' A-overhangs will gradually be lost during storage.

Which polymerases generate blunt ends versus A-overhangs?

  • Enzymes in the PrimeSTAR series
    These enzymes exhibit substantial 3'&rarr5' exonuclease activity and primarily generate amplification products with blunt ends. Therefore, we recommend using the Mighty Cloning Reagent Set (Blunt End) for blunt-end cloning.
  • Taq and Terra enzymes
    Takara Taq, Takara Bv Taq, Takara LA Taq, SpeedSTAR HS, EmeraldAmp, SapphireAmp Fast, and Terra PCR DNA polymerases primarily yield amplification products containing 3'-dA overhangs that can be directly used for TA-cloning. Blunt-end cloning is also possible using the Mighty Cloning Reagent Set (Blunt End).
  • All Takara Bio DNA polymerases
    The fragment terminal structure after amplification with a particular polymerase is indicated in the table below. Some polymerases generate a mixture of blunt-end and A-overhang products other polymerases generate only blunt-end or A-overhang products.

Polymerase A-overhang Stomp einde
Takara Taq DNA polymerases
Takara Bv Taq DNA polymerases
Takara LA Taq DNA polymerases
Titanium Taq DNA Polymerase
Advantage 2 Polymerase Mix
Advantage GC 2 Polymerase Mix
Advantage HF 2 Polymerase Mix
EmeraldAmp GT PCR Master Mix
EmeraldAmp MAX HS PCR Master Mix
SapphireAmp Fast PCR Master Mix
High Yield PCR EcoDry Premix
High Fidelity PCR EcoDry Premix
Terra PCR Direct Polymerase Mix
SpeedSTAR HS DNA Polymerase
PrimeSTAR HS DNA Polymerase
PrimeSTAR GXL DNA Polymerase
PrimeSTAR Max DNA Polymerase
CloneAmp HiFi PCR Premix
SeqAmp DNA Polymerase
TaKaRa Z-Taq DNA Polymerase
e2TAK DNA Polymerase
PerfectShot Bv Taq DNA Polymerase

What is meant by polymerase fidelity? What applications require a high-fidelity polymerase?

The fidelity of a DNA polymerase refers to its ability to accurately replicate a template, or to add the correct nucleotides starting at the 3' end of the primer. The rate of base misincorporation is known as the error rate. PCR polymerases with proofreading activity possess 3'&rarr5' exonuclease activity that can excise incorrectly incorporated nucleotides and replace them with the correct nucleotides.

High-fidelity polymerases are recommended for gene cloning, protein expression, structure-function studies of proteins, cDNA library construction, and next-generation sequencing. To select a high-fidelity polymerase, see our PCR selection guide.

How can I compare error rates of different high-fidelity polymerases?

Error rates reported by vendors for polymerases cannot always be directly compared, as different methods are used to measure fidelity. These methods include:

  1. Blue-white screening
    This approach is based on phenotypic changes and is widely used since it is fast, relatively simple, and cost effective. The original method for blue-white screening, known as the Kunkel method (Kunkel and Tindall 1987), is based on &alpha-complementation of the lacZ&alpha gene that restores &beta-galactosidase enzyme activity and allows production of a blue color. With this method, colonies derived from lacZ&alpha PCR products containing single-nucleotide errors or frameshift mutations typically have a white color, while clones derived from error-free amplicons generate blue colonies.
  2. Sequencing approach
    This approach utilizes Sanger sequencing of individual colonies after PCR. The blue-white screening approach can quickly measure polymerase fidelity, however it is not as accurate as the sequencing approach. The blue-white method will not detect silent mutations, single-nucleotide substitutions that do not affect translation. The sequencing method can detect all mutations, and thus is more accurate.

Verwysings

Kunkel, T. A. and Tindall, K. R., Fidelity of DNA synthesis by the Thermus aquaticus DNA polymerase. Biochemie 27, 6008&ndash6013 (1987).

PrimeSTAR Max and PrimeSTAR GXL DNA polymerases have very high fidelity how was fidelity measured for these enzymes?

The fidelities of the PrimeSTAR polymerases were measured by Sanger sequencing of individual colonies after PCR, as described below:

  • Ten arbitrarily selected GC-rich regions of Thermus thermophilus HB8 genomic DNA were amplified.
  • PCR products were cloned into a plasmid vector.
  • Multiple clones were selected for each respective amplification product, and the PCR insert was sequenced.

PrimeSTAR Max DNA Polymerase has a fidelity 29X that of Taq polymerase, whereas PrimeSTAR GXL DNA Polymerase has a fidelity 6.5X that of Taq polymerase.

What precautions should be taken when using inosine-containing primers?

Inosine-containing primers should not be used with PCR enzymes that have 3'&rarr5' exonuclease activity (e.g., PrimeSTAR HS DNA Polymerase, PrimeSTAR Max DNA Polymerase, PrimeSTAR GXL DNA Polymerase, TaKaRa Ex Taq DNA Polymerase, or Takara LA Taq DNA polymerases), nor with Terra PCR Direct polymerase. When using one of the compatible Takara TaqPCR enzymes for degenerate PCR, we recommend using a mixture of degenerate primers with A, T, G, or C at the desired position(s) rather than inosine-containing primers.


LIC cloning

L igation I ndependent C loning (LIC) uses the 3′ exonuclease activity of T4 DNA Polymerase to chew back constructs to a particular base, and then uses the resulting sticky ends to paste a gene into the correct place in a vector. This is followed with transformation to bacteria to repair the nicked strands and make more DNA.

T4 DNA polymerase has 3′ exonuclease activity: in the absence of NTPs, it will chew back the 3′ end of double stranded DNA. This reaction competes with the addition of bases in the 5′-3′ direction on the same strand. If we add a large number of dNTPs, the polymerase activity will overwhelm the exonuclease activity and the 3′ end will extend. Things get interesting if we add only a single dNTP. Let’s say we add dGTP. The polymerase will chew back until it reaches a “C” on the opposite strand. It will then incorporate the dGTP. There is then a competition between the exonuclease — going backwards — and adding the G — going forwards. As long as there is dGTP around, the polymerase will sit stalled at that position. By carefully designing a DNA construct, one can use this stalling behavior to create long sticky ends to paste DNA together.

Our vector (derived from pET28/30) has an SspI site that cuts in the following location. The soon-to-be sticky ends are blue and green the “G” at which the polymerase stalls is shown in bold red.

To create an insert for LIC cloning, we amplify our gene of interest using primers that have special LIC ends (bold) that will be complementary to the vector LIC ends. The other end of each primer is complementary to our gene of interest.

Do T4 DNA polymerase reaction with only dCTP, which will chew back the 3′ ends until the reaction hits the first C (bold red):

Note the long length of the vector and insert that are complementary (blue and green). The last step is to anneal the vector and the insert and then transform into bacteria to repair breaks.

VECTOR INFORMATION:

Sequencing primers:
MalE (forward): GGTCGTCAGACTGTCGATGAAGCC
T7Term (reverse): GCTAGTTATTGCTCAGCGG

I. Vector Prep:

    Cut vector (5 ug) with SspI in 150 uL volume for

In thermocycler, incubate at 22 °C for 30 minutes, 75°C for 20 minutes and 4°C for 5 minutes

II. Insert Prep:

1. PCR amplify insert using special LIC cloning primers.
2. Digest PCR product with 1 uL DpnI for 1-2 hours @ 37°C to remove template vector (if it contains Amp-resistance gene).
3. Clean up DpnI-digested PCR product with Qiagen PCR Kit – 30 uL
4. Phosphorylate PCR product

30 uL (500 ng) PCR product
4 uL 10X T4 ligase buffer
1 uL T4 PNK
5 uL H2O
40 uL total

In thermocycler, incubate at 37°C for 1.5 hr, 65°C for 20 minutes and 4°C for 5 minutes

5. Perform dCTP PCR product overhang reaction

40 uL phosphorylated PCR product above
0.5 uL 1 M DTT
1.25 uL 100 mM dCTP
0.5 uL T4 DNA polymerase-LIC Novagen
2.7 uL NEB2
5 uL H2O
50 uL total

In thermocycler, incubate at 22 °C for 30 minutes, 75°C for 20 minutes and 4°C for 5 minutes


Ligation Independent Cloning

Ligation Independent Cloning (LIC) relies on the 3'-5' exonuclease activity of T4 DNA polymerase. An exonuclease is an enzyme which removes nucleotides from the end of a DNA strand. In LIC, the T4 DNA polymerase’s exonuclease activity creates “chewed-back” overhangs of 10-12 base pairs on the 5' end of both the vector and insert. These overhangs can easily anneal creating a circular product with four nicks that are repaired by the bacteria after transformation. LIC does not require site-specific recombination or a ligation step, making it an easy, cheap and rapid cloning method.

So how does this work exactly? LIC depends on the addition of only one free dNTP to the reaction. In the presence of a single free dNTP, T4 polymerase will continue to function as an exonuclease until a base is exposed on the single strand overhang which is complementary to the free nucleotide. Given this opportunity, T4 will resume its polymerase activity, add back the free base, and become stuck at this point (with no other free bases to add). Complementary overhangs are built into the PCR primers for the insert, based on the destination vector sequence and choice of restriction site. Because of the relatively long stretches of base pairing in the annealed product, ligation is rendered unnecessary. The product may be transformed directly into E coli, where the nicks will be repaired by the normal replication process. It is important to note that LIC has difficulty assembling DNA fragments with repetitive sequences and DNA that ends in sequences that form complex secondary structues. You can view an example of a LIC protocol on our website.

Ligation Independent Cloning (Figure adapted from LIC protocol)


Can Pfx polymerase add only one 3' A overhang? - Biologie

Molecular Biology Laboratory Topics

Molecular Biology Review

Replication is the process by which DNA is synthetized in vivo, and requires a pre-existing DNA molecule as template, a primer, a replication origin, DNA polymerase, deoxynucleotides (dNTPs), and ligase. It starts with the unwinding of a DNA template and separation of the strands forming a structure known as a replication fork. Each strand can then serve as a template. A shot RNA sequence serves as a primer by annealing to the replication origin, for example, to ori C in the E coli circular chromosome. Eukaryotes have many replication origins because they have more than one chromosome. DNA polymerase recognizes and binds to the replication origin, the starts catalyzing the addition of nucleotides to the primer.

DNA replication always moves from the 5' end to the 3' end of the newly synthezized molecule. Because one of the template strands is not completely unwond, replication of that strand occurs in pieces, adding new primers as the template unwinds. The DNA fragments produced are known as Okazaki fragments and are eventually joined by ligase. The new DNA strand synthetized in fragments is known as the lagging strand, while the strand synthetized continuously is known as the leading strand.

Usually, a molecule of DNA polymerase does not compleately replicates a strand, but "jumps around" from template to template. This phenomenom is known as distrivuive synthesis. Some isozymes stay on one tamplate longer than others, thus are more efficient or have better processivity.

Example Procedure: Bacterial DNA Isolation

Use lysosime to digest cell wall (contained in Solution I). There is EDTA in most of the reagents to chelate Mg2+ to inhibit DNase. Cell membrane is disolved using 0.5% SDS (contained in Solution II) to release DNA, RNA, proteins, carbohydrates and lipids. DNA is not soluble in phenol, but lipid, proteins and some carbohydrates are, thus the mixture is extracted with phenol several times. Chloroform is the used to remove more lipids, as well as some proteins and carbos. The clean DNA is precipitated by adding ethanol, and charges are neutralized with NaOAC (sodium acetate).

Example Procedure: DNA Resin Extraction

Example Procedure: DNA Electroelution

Nucleases cut at either side of the phosphodiester bond of polynucleotides:

Some nucleases cut both DNA and RNA, while others cut only DNA (DNases) or only RNA (RNases). Nucleases that cut only at or near the end of a polynucleotide are known as exonucleases, while endonucleases only cut at interior base pairs. Some commonly used nucleases are Bal31, ExoIII, S1, mung bean nuclease, DNase 1, RNase A and RNase H.

Bal31 is obtained from Alteromones espejiana and cuts polynucleotides. It acts as a single strand endonuclease and a double strand exonuclease in the prescence of Ca2+. Bal31 is commonly used to make division, for example to isolate the sequence of interest and make blunt ends by removing unwanted base pairs.

ExoIII recognizes double stranded polynucleotides but cut only one strand. It is a 3'-to-5' exonuclease that leaves a 5' overhang, but cannot cut if there is a 3' overhang. ExoIII is used as Bal31, then another enzyme is used to remove the 5' overhang.

S1 nuclease from Aspergillus oryzae cuts polynucleotides as either an endonuclease or an exonuclease in the prescence of Zn2+. It is single strand specific, but will cut a double strand that is already nicked. Mung bean nuclease is identical to S1 except it will not cut nicked double stranded DNA.

DNase 1 is a DNA endonuclease. If Mg2+ is present, DNase 1 will recognize double stranded DNA but cut only one strand. If Mn2+ is present, it will cut both strands.

RNase H cuts only the RNA in RNA/DNA hybrid helices. RNase A is specific to single stranded RNA (cannot cut at hairpins), cutting in front of C or U.

Restriction Endonucleases

Restriction endunucleases originate from one of two enzymatic systems in bacteria: hsd (host specificity for DNA) or MDRS (methylation-dependent restriction system).

The hsd genes confere protection to bacteria against bacteriophages (viruses that infect bacteria). Different strains of bacteria have different hsd genes that produce restriction endonucleases and methylases. The methylases modify bacterial DNA by methylating at either adenine or cytocine. The restriction endonucleases degrade DNA if not methylated, protecting the bacteria from non-methylated foreign DNA.

But some bacteriophages may also methylate their DNA, thus using hsd bacteria may be able to protect themselves only against bacteriophages with methylation patterns different to their own. For example, if the bacteriophage lambda kappa infects E coli kappa, the bacteria will not be able to fight the infection because both organisms have the same methylation pattern. On the other hand, restriction endonucleases from E coli beta should be able to degrade lambda kappa.

The MDRS enzymes cut methylated DNA only, thus E. coli does not methylate its own genomic DNA at the MDRS recognition sites, thus the MDRS system does not produce methylases as hsd do. MDRS genes may be of two types: modified cytosine restriction (MCR) or methyladenine recognition restriction (MAR).

Restriction endonucleases degrade bacteriophage DNA by cutting at specific double-stranded DNA sequences (they do not cut single stranded DNA), for example:

5' ----- GAATTC ----- 3'
3' ----- CTTAAG ----- 5'
EkoRI
5' ----- G AATTC ----- 3'
3' ----- CTTAA G ----- 5'

An enzyme like EkoRI (from E coli) leaves "sticky ends" with a 5' overhang. Other enzymes may leave either a 3' ovehang or blunt ends:

Pstek

Aluek

5' ----- CTGCA G ----- 3'
3' ----- G CTGCA ----- 5'

There are three types of restriction endonucleases. The most commonly used Type II restriction endonucleases are simple proteins that require only Mg2+ and generally cut at a palindromic host specific recognition site. Other types of restriction endonuclease require Mg2+, AdoMet and/or ATP and may cut many base pairs away from the recognition site, sometimes at random.

Isoschizomers are restriction endonucleases that recognize the same sequence and may cut at the same or different bases. If they cut at different bases, they are called neoschizomers. Isoschizomers may be affected differently by methylation. Byvoorbeeld: MboI, Sau3A and DpnI are isochizomers (DpnI is a neoschizomer) that recognize 5'--GATC--3'. MboI will cut only the unmethylated sequence, Sau3A will cut either the one-strand methylated or unmethylated sequence, and DpnI will cut only if the sequence is metylated in both strands.

Synthesis and Modification Enzymes

Synthetic enzymes include DNA polymerases and RNA polymerases. There are many isozymes of DNA polymerase, some commonly use in biolotechnology are E coli, T7, T4, Taq and reverse transcriptase.

E. coli DNA polymerase has two subunits: a 76 kD 5' to 3' polymerase and a 35 kD 3' to 5' exonuclease. The exonuclease only cut one strand of the double stranded DNA, and in the bacteria is used to proofread a newly sinthezized DNA strand. The polymerase does not recognize individual nucleotides, it just ads any nucleoride, and it is up to the exonuclease to identify the incorrect pairings and remove the wrong nucleotide just added. The 3'-to-5' exonuclease identidies the wrong bases by reconizing that the H bonds are not forming. Such proofreading will continue until the correct base is in place.

T7 DNA polymerase, also known as sequenace (?), is made of two subunits: 5' to 3' polymerase and 3' to 5' exonuclease. Although similar to E coli, T7 has better processivity, therefore it is often used for manual DNA sequencing.

T4 DNA polymerase also has the 5' to 3' polymerase and 3' to 5' exonuclease activities, but its exonuclease is single-strand specific. It is mostly used to remove 3' overhangs.

Taq DNA polymerase comes from Thermus aquaticus, a bacteria that lives in hot springs. It is used for reactions that need to occur at very high temperatures, like the polymerase chain reaction (PCR).

There are also many RNA polymerase isozymes. Prokaryotic isozymes like E coli RNA polymerase make mRNA, tRNA and rRNA. Other commonly used RNA polymerases includ Sp6 (from Salmonella), T7 and T3. Eukaryotic have different RNA polymerases that make the divers kinds of RNA:

  • RNA Polymerase I: 18s, 28s and 5.8 s rRNA
  • RNA Polymerase II: mRNA and snRNA
  • RNA Polymerase III: tRNA and 5s rRNA

Modification enzymes include methylases, lagases, alkaline phosphatases and kinases. As already discussed, methylases add a methyl group at either adenine or cytocine:

Ligases join two pieces of DNA together by forming phosphodiester bonds:

Phosphatases remove the 5' phosphate of polynucleotides, while kinase adds a phosphate to an already dephosphorilated DNA 5' end.


Erkennings

We thank V. Kalinin, V. Krutyakov, G. Villani, C. Bieri and U. Sheveleva for their critical reading of the manuscript Ursi Hübscher, R. Hobi, P. Schrafll and N. Pirogova for their assistance with graphics T. Steitz for permission to reproduce Figure 1 and K. Ramadan for his assistance on the manuscript. The work carried out in the authors' laboratories was supported by the Swiss National Science Foundation, the European Union TMR grant, the Kanton of Zürich and the Russian Foundation for Basic Research. We apologize to those researchers whose work could not be cited directly because of the strict limit on the number of references.


Kyk die video: Polymerase Chain Reaction PCR (Oktober 2022).