Inligting

Rekombinasiefraksie (frekwensie) in homosigote

Rekombinasiefraksie (frekwensie) in homosigote


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ek het 'n vraag oor die herkombinasiefrekwensie, ek hoop jy het tyd om te beantwoord.

Agtergrond: As ons kyk na homosigotiese individu A/A B/B wat uit die gamete AB en AB gevorm is, sal hierdie individu op sy beurt die gamete AB, AB, AB, AB hê. Dit is dieselfde as die gamete wat gebruik is om die individu te vorm.

My vraag: Is die rekombinasiefrekwensie 0? Of moet ons die A's en B's as verskillend beskou, dit wil sê soos A$_1$, A$_2$, B$_1$, B$_2$. Dan kry ons die moontlike gamete A$_1$B$_1$ (ouer), A$_1$B$_2$ ​​(rekombinant),A$_2$B$_2$ ​​(par), A$_2$B$_1$ (herkom). Ons kry dan dat die herkombinasiefrekwensie 50 persent is (wat dit moet wees volgens die bron wat onderaan gegee word). Watter interpretasie is korrek?

Definisies gebruik in my vraag:

"Meiotiese rekombinasie is enige meiotiese proses wat 'n haploïede produk genereer met nuwe kombinasies van die allele wat deur die haploïede genotipes gedra word wat verenig het om die meiosiet te vorm." (Griffiths et. al., Inleiding tot Genetiese Analise, tiende uitgawe, Internasionale Uitgawe, bl. 95)

Rekombinante: "Rekombinante is meiotiese uitset anders as meiotiese insette." (dieselfde boek).

Rekombinasie breuk: "Rekombinasiefraksie (ook genoem rekombinasiefrekwensie) tussen twee lokusse word gedefinieer as die verhouding van die aantal herkombineerde gamete tot die totale aantal gamete wat geproduseer word." (Shizhong Xu, Beginsels van Statistiese Genomika, Springer, Hoofstuk 2, bladsy 11, 2013).

Verder: "Wanneer gene ontkoppel is, het hulle 'n rekombinasiefrekwensie van 0,5, wat beteken 50 persent van die nageslag is rekombinante en die ander 50 persent is ouertipes." (Bron: Boundless. "Genetic Linkage and Distances." Boundless Biology. Boundless, 21 Jul. 2015. Onttrek 11 Sep. 2015 van https://www.boundless.com/biology/textbooks/boundless-biology-textbook/modern- verstaan-van-oorerwing-13/chromosomale-teorie-en-genetiese-skakeling-97/genetiese-skakeling-en-afstande-427-11654/)


Welkom by Biology.SE

Jou vraag spruit uit die verwarring tussen die meting van 'n rekombinasietempo en die werklike rekombinasietempo.

In die A/A, B/B individue wat jy beskryf, kom rekombinasies steeds voor. Daardie rekombinasie beïnvloed net nie koppelingsonewewig tussen dieAaen dieBblokusse aangesien daar geen afwyking by daardie lokusse is in die individue wat u oorweeg het nie. Daar is dus geen manier om te sê of 'n rekombinasiegebeurtenis in 'n spesifieke geval plaasgevind het nie. Jy benodig genetiese variansie by beide lokusse om 'n koppelingsonewewig te hê wat deur rekombinasie beïnvloed kan word. Maar dit is nie omdat jy nie die rekombinasietempo kan meet dat rekombinasies nie plaasvind nie.


Daar is toenemende bewyse dat ekologiese veranderlikes wat stres behels belangrik is in die bepaling van evolusionêre tempo's. Hierdie vraestel inkorporeer herkombinasie in hierdie scenario.

In Drosophila melanogaster, neem rekombinasie toe by ontwikkelingstemperature bo en onder normale kultuurtemperature, wat 'n U-vormige kromme gee wat die meeste uitgespreek is in sentromeriese streke, maar by naby dodelike temperatuuruiterstes is daar bewyse vir 'n afname in rekombinasie. Meer beperkte data van ander organismes is oor die algemeen in ooreenstemming met hierdie gevolgtrekking. Voedingstres in die vorm van hongersnood verhoog rekombinasie in D. melanogaster, en gedragstres is gevind om rekombinasie in manlike muise te verhoog.

In natuurlike populasies is rekombinasie onder komplekse genetiese beheer analoog aan ander kwantitatiewe eienskappe. In D. melanogaster in 'n nuwe omgewing is daar bewyse dat additiewe genetiese variasie vir rekombinasie hoër is as in 'n standaard laboratorium omgewing. Tydens seleksie in populasies wat aan uiterste stres blootgestel is, kan verhoogde rekombinasie plaasvind, dit impliseer dat in marginale (stresvolle) habitatte, variasie wat deur rekombinasie gegenereer word, kan toeneem.

In D. melanogaster, strukturele heterosigositeit as gevolg van inversies in een deel van die genoom is geneig om rekombinasie in die res van die genoom te verhoog op 'n kwalitatief soortgelyke wyse aan, en kumulatief met, direkte omgewingseffekte veral temperatuur. Aansienlike rekombinasie behoort geïnduseerbaar te wees onder kombinasies van kariotipes en omgewings wat afwyk van bestaande omstandighede, veral as die voorstel dat effekte dikwels sinergisties is as gevolg van 'n afhanklikheid van beskikbare energievlakke, bevestig kan word.


7.5: Afleiding van rekombinasie uit genetiese data

  • Bygedra deur Todd Nickle en Isabelle Barrette-Ng
  • Professore (Biologie) by Mount Royal Universiteit en Universiteit van Calgary

In die voorafgaande voorbeelde het ons die voordeel gehad om die benaderde chromosomale posisies van elke betrokke alleel te ken, voordat ons die rekombinasiefrekwensies bereken het. Om hierdie inligting vooraf te ken, het dit relatief maklik gemaak om die ouer- en rekombinante genotipes te definieer, en om rekombinasiefrekwensies te bereken. In die meeste eksperimente kan ons egter nie die chromosome, of selfs die gamete, direk ondersoek nie ons moet die rangskikking van allele uit die fenotipes aflei oor twee of meer generasies. Dit is belangrik dat dit oor die algemeen nie voldoende is om die genotipe van individue in net een generasie te ken nie, byvoorbeeld gegewe 'n individu met die genotipe AaBb, ons weet nie uit die genotipe alleen of die lokusse op dieselfde chromosoom geleë is nie, en indien wel, of die rangskikking van allele op elke chromosoom is AB en ab of Ab en aB (Figuur (PageIndex<6>)). Die boonste sel het die twee dominante allele saam en die twee resessiewe allele saam en word gesê dat dit die gene in die koppeling (of cis) konfigurasie. Die alternatief wat in die sel hieronder getoon word, is dat die gene in die afstoot (of trans) konfigurasie.

Figuur (PageIndex<6>): Allele in koppelingskonfigurasie (bo) of afstotingskonfigurasie (onder). (Oorspronklik-Deyholos-CC:AN)

Gelukkig vir genetici kan die rangskikking van allele soms afgelei word as die genotipes van 'n vorige generasie bekend is. Byvoorbeeld, as die ouers van AaBb genotipes gehad AABB en aabb onderskeidelik, dan die ouerlike gamete wat saamgesmelt het om te produseer AaBb genotipe sou gewees het AB en genotipe ab. Daarom, voor meiose in die dihibried, sou die rangskikking van allele ook so wees AB en ab (Figuur (PageIndex<7>)). Omgekeerd, as die ouers van AaBb genotipes gehad aaBB en AAbb, dan sou die rangskikking van allele op die chromosome van die dihibried wees aB en Ab. Die genotipe van die vorige generasie kan dus bepaal watter van 'n individu&rsquos gamete as rekombinant beskou word, en watter as ouer beskou word.

Figuur (PageIndex<7>): Die genotipe van gamete kan ondubbelsinnig afgelei word as die gamete deur homosigote geproduseer word. Rekombinasiefrekwensies kan egter slegs gemeet word onder die nageslag van heterosigote (d.w.s. dihibriede). Let daarop dat die dihibried aan die linkerkant 'n ander konfigurasie van allele bevat as die dihibried aan die regterkant as gevolg van verskille in die genotipes van hul onderskeie ouers. Daarom word verskillende gamete gedefinieer as rekombinant en ouer onder die nageslag van die twee dihibriede. In die kruisie aan die linkerkant sal die rekombinante gamete genotipe AB en ab wees, en in die kruisie aan die regterkant sal die rekombinante gamete Ab en aB wees. (Oorspronklik-Deyholos-CC:AN)

Kom ons kyk nou na 'n volledige eksperiment waarin ons doel is om rekombinasiefrekwensie te meet (Figuur (PageIndex<8>)). Ons benodig ten minste twee allele vir elk van twee gene, en ons moet weet watter kombinasies van allele in die ouerlike gamete teenwoordig was. Die eenvoudigste manier om dit te doen is om te begin met suiwer teellyne wat kontrasterende allele by twee lokusse het. Ons kan byvoorbeeld kortstertmuise, bruinmuise (aaBB) met langstert, wit muise (AAbb). Gebaseer op die genotipes van die ouers, weet ons dat die ouerlike gamete sal wees aB of Ab (maar nie ab of AB), en al die nageslag sal dihibriede wees, AaBb. Ons weet nie op hierdie stadium of die twee lokusse op verskillende pare homoloë chromosome is nie, en of hulle op dieselfde chromosoom is nie, en indien wel, hoe naby hulle aan mekaar is.

Figuur (PageIndex<8>): 'n Eksperiment om rekombinasiefrekwensie tussen twee lokusse te meet. Die lokusse beïnvloed haarkleur (B/b) en stertlengte (A/a). (Wikipedia-gewysigde Deyholos-CC:AN)


3. Praktiese oorwegings van balanseerdergebruik

3.1. Eienskappe van goeie balanseerders

Balanseerders word gebruik vir 'n verskeidenheid take, insluitend balansering van bestaande mutasies, fasilitering van stamkonstruksie en sifting vir nuwe mutasies. 'n Balanseerder moet ten minste die eienskappe hê wat reeds beskryf is: heterosigote moet 'n fenotipe hê wat onderskei kan word van dié van elke homosigote rekombinasie moet feitlik uitgeskakel word. ongebalanseerd raak). Dit is ook nuttig as die balanseerder maklik in genetiese kruisings gemanipuleer kan word, veral as dit deur manlike sperm geslaag kan word, en as morfologies gemerkte of dodelike variante bestaan.

Balansering van bestaande mutasies is waarskynlik die minste veeleisend van hierdie take, wat slegs vereis dat 'n geskikte balanseerder bestaan ​​en dat die mutasie/balanseerder heterosigoot lewensvatbaar is. 'n Geringe mate van onstabiliteit in die heterosigote is aanvaarbaar, solank die ondersoeker die stam gereeld nagaan. Vervormingskonstruksie kan aangehelp word deur bepaalde eienskappe van 'n paar balanseerders, en vereis dikwels balanseerders wat met spesifieke mutasies gemerk is (sien Afdeling 3.3).

Verreweg die strengste toets van 'n balanseerder is om dit te gebruik om te kyk vir dodelike mutasies. Die belangrikste bykomende vereiste wat aan die balanseerder gestel word, is dat die skynbare spontane mutasiefrekwensie laag moet wees (nie hoër as in die verwysingswildtipe-stam, N2). Studies wat twee verskillende wederkerige translokasies gebruik ( eT1 en szT1 ) illustreer hierdie punt.

1. eT1(IIIV) Hierdie translokasie is 'n uiters stabiele balanseerder wat wyd gebruik is vir dodelike skerms. Die grootte van die gebalanseerde streek is ongeveer 40 kaarteenhede (mu). Rosenbluth, R.E., Cuddeford, C., en Baillie, D.L. (1983) het 'n dosis-reaksie-studie vir gebalanseerde dodelike mutasies met etielmetaansulfonaat (EMS) en gammabestraling uitgevoer, en die spontane mutasiefrekwensie vir dodelike mutasies bepaal. 'n Genotipe-stam dpy-18/eT1 III unc-46/eT1 V is gebruik om te kyk vir nuwe dodelike mutasies wat aan een van beide gekoppel is dpy-18 of unc-46 . Dodelike mense is teen redelike frekwensie met beide mutagene herwin (6.6% by 12 mM EBW, en 4.5% by 1500 R gamma). Die frekwensie van ophoping van spontane mutasies was baie laag. Twee kontrole-eksperimente, wat 3198 F1-heterosigotiese nageslag van twee P0-diere behels het, het gelei tot 'n totaal van twee gebalanseerde dodelike mutasies vir 'n frekwensie van 0,06%. Daarbenewens, eT1 blyk heeltemal stabiel te wees. Dit is gebruik om baie duisende gemutageniseerde chromosome te skerm, word tans gebruik om honderde dodelike mutasies te balanseer, en daar is nog nooit waargeneem dat dit afbreek nie.

2. szT1(IX) Hierdie translokasie is baie stabiel, en dit was nuttig in stamkonstruksies en vir die balansering van bestaande mutasies. Dit is in 'n beperkte mate gebruik om nuwe dodelike mutasies te herstel. Eksperimente om die spontane dodelike mutasie frekwensie te bepaal in die streek gebalanseer deur szT1 resultate gegee anders as dié wat verkry is met eT1 . McKim, K.S., Howell, A.M. en Rose, A.M. (1988) het ongewone segregante onder die nageslag van 'n genotipestam opgespoor dpy-5 unc-13/szT1[lon-2] I unc-3/szT1 X . Hierdie stam het 'n wild-tipe fenotipe en skei normaalweg wilde tipes, Dpy-5 Unc-13 Unc-3 homosigote, 'n paar Lon-2 mannetjies (as gevolg van meiotiese nie-disjunksie van die X-chromosoom), en aneuploïede wat as embrio's arresteer of jong larwes. Uit die nageslag van 1104 ongemutageniseerde wilde-tipe heterosigote is 34 diere herwin wat nie Dpy Unc-13 Unc-3 nageslag gegee het nie en dus blykbaar 'n nuwe dodelike in een van die gebalanseerde streke dra. Hierdie diere het egter nie nageslag gegee wat geskik is vir 'n szT1 heterosigote en, by verdere ontleding, blyk dit 'n saamgestelde chromosoom te dra wat bestaan ​​uit szT1 (X) saamgesmelt aan die normale X wat die dra unc-3 mutasie. Hierdie tipe spontane herrangskikkings verminder die nut van szT1 as 'n balanseerder vir dodelike skerms, alhoewel dit suksesvol gebruik is na mutagenese om dodelike stowwe te herstel wat verband hou met dpy-5 (McKim, K.S., Howell, A.M. en Rose, A.M., 1988).

3.2. Geneties gemerkte balanseerders

In behoorlik ontwerpte stamme besit diere wat heterosigoties is vir 'n balanseerder en 'n gebalanseerde mutasie (en merkermutasies), of homosigoties vir die mutasies en wat 'n balanserende duplisering dra, 'n unieke fenotipe. Hierdie stamme kan in stand gehou word deur diere met hierdie fenotipe te selekteer en hul nageslag te kontroleer om seker te maak dat toepaslike fenotipiese klasse geskei is. Die genetiese besonderhede verskil tussen individuele balanseerders, en 'n goeie begrip van hierdie besonderhede is nodig om 'n gegewe stam te handhaaf. Spesifieke inligting oor normale nageslag genotipes en fenotipes vir elke klas van balanseerder kan gevind word Afdeling 2 (Tipes balanseerders), en inligting oor homosigotiese balanseerder fenotipes en standaard merker mutasies vir spesifieke balanseerders kan gevind word Afdeling 5 ('n Veldgids tot balanseerders).

Die oorspronklike isolate van sommige balanseerders dra mutasies wat in die genetiese agtergrond was van die stamme waaruit die balanseerders gegenereer is (bv. dpy-10 en unc-52 in die geval van mnC1 ) of dra mutasies in gene wat deur herrangskikkingsbreekpunte onderbreek word (bv. unc-36 in eT1 ). Daarbenewens is bestaande balanseerders spesiaal gemerk met dodelike of morfologiese mutasies vir spesifieke take. Hierdie variante kan nuttig wees vir stamkonstruksie (Rosenbluth, RE en Baillie, DL, 1981), instandhouding van gebalanseerde mutasies (Johnsen en Baillie, ongepubliseerde resultate) en ontleding van mutasies en balanseerderstruktuur (Rosenbluth, RE en Baillie, DL). , 1981). Hulle kan op verskillende maniere gegenereer word, insluitend spontane mutasie (Rogalski, TM, Bullerjahn, AME en Riddle, DL, 1988), mutagenese of rekombinasie (Rosenbluth, RE en Baillie, DL, 1981) en DNA-fusie (Hunter, CP en Wood, WB, 1990). Die nuwe mutasies wat hulle dra, kan resessief of dominant wees en kan voorwaardelik of nie-voorwaardelik wees.

Dodelike variante van homosigotiese lewensvatbare balanseerders kan gebruik word wanneer dit wenslik is om balanseerder homosigote uit 'n populasie te verwyder, wat heterosigote as die enigste lewensvatbare klas nageslag laat. Byvoorbeeld, Johnsen en Baillie (ongepubliseerde resultate) het 'n dodelike afgeleide van eT1 om dodelike mutasies te handhaaf in stamme waarin balanseerder homosigote die kragtigste nageslagklas was. Dodelike variante is nuttig om te verhoed dat balanserende homosigote 'n bevolking oorgroei onder enige toestande waarin heterosigote nie gereeld geselekteer kan word nie, soos grootskaalse voorbereidings vir biochemiese analise of DNS-ekstraksie.

Morfologies gemerkte balanseerdervariante word gebruik wanneer 'n homosigotiese lewensvatbare balanseerder nie reeds 'n unieke fenotipe het nie, wanneer sy fenotipe soortgelyk is aan dié van een van die nageslagklasse, of wanneer 'n tweede bepuntbare fenotipe nodig is bykomend tot die balanseerder se inheemse homosigotiese fenotipe. Byvoorbeeld, Rosenbluth, R.E., en Baillie, D.L. (1981) het nuwe mutasies op eT1 om die segregasiepatrone van die halftranslokasies te bepaal. Zetka, M.C., en Rose, A.M. (1992) het 'n nuwe geïnduseer unc-54 mutasie op die inversie hIn1 , wat oorspronklik 'n wilde-tipe homosigotiese fenotipe gehad het, om homosigote van heterosigote te onderskei.

Die meeste van die dodelike of morfologiese balanseerder variante in algemene gebruik is gegenereer deur mutagenese met EMS en is dus nie baie waarskynlik struktureel verander nie. Dit wil sê, daar kan oor die algemeen van hulle verwag word om dieselfde streke as hul ouerbalanseerders te balanseer. Aan die ander kant kan daar verwag word dat balanseerders wat aan mutagenese onderworpe is met ioniserende straling nuwe herrangskikkings sal dra (Rosenbluth, RE, Cuddeford, C., en Baillie, DL, 1985 McKim, KS, en Rose, AM, 1990 McKim, KS, Peters. , K. en Rose, AM, 1993). Dit kan dus nodig wees om die omvang van balansering vir spesifieke variante te toets.

3.3. Kruisingskemas

Kruisings om mutasies in of uit verskillende genetiese agtergronde te beweeg, is basies tot genetiese analise. Byvoorbeeld, kruisings is nodig om mutasies geneties te karteer om hulle teen tekortkominge, dupliserings of ander mutasies aan te vul om die uitwerking van verskillende mutasies op mekaar te bestudeer en om ongewenste skadelike mutasies na mutagenese te verwyder. As 'n mens 'n gebalanseerde mutasie na 'n ander genetiese agtergrond wil oorsteek, kan mannetjies nodig wees wat die mutasie dra en in staat is om te paar. Drie metodes kan gebruik word om dit te bereik. Eerstens kan 'n gemengde populasie van heterosigotiese mannetjies, waarvan die helfte die balanseerder dra en die helfte die gebalanseerde mutasie dra, gemaak word deur heterosigotiese hermafrodiete met wilde-tipe mannetjies te kruis. Tweedens kan mans in gebalanseerde stamme ontstaan ​​deur spontane X-chromosoom nie-disjunksie, waarvan die frekwensie verhoog kan word met 'n hom mutasie in die genetiese agtergrond (Hodgkin, JA, Horvitz, HR en Brenner, S., 1979) of deur hittevoorraad (Sulston, J. en Hodgkin, J., 1988), en hierdie mannetjies kan gebruik word om gebalanseerd voort te plant manlike aandele. Derde, en mees wenslike, gebalanseerde fenotipies unieke mannetjies kan gemaak word van elke gebalanseerde stam op aanvraag deur oor te steek na 'n standaard manlike balanseerder stam.

Die eerste metode bemoeilik analise deur F2-nageslagtoetsing te vereis om te verseker dat die korrekte merker oorgedra is. Die tweede metode burgemeester mag dalk nie nageslagtoetsing vereis nie, afhangende van of die verlangde F2-kruisnageslag 'n unieke fenotipe het, maar dit vereis dat 'n manlike voorraad in stand gehou word vir elke gebalanseerde mutasie.Stamkonstruksie en komplementasietoetse word baie eenvoudiger gemaak as die genotipes en ooreenstemmende fenotipes wat voortspruit uit kruisings uniek is, en as die vereiste mannetjies gegenereer kan word soos nodig.

Die volgende bespreking bied 'n paar voorbeelde van nuttige kruisingsprotokolle van laasgenoemde klas vir spesifieke balanseerders. Die oorspronklike gepubliseerde werke, of die ondersoekers self, is steeds die beste bron vir spesifieke detail en advies.

1. hIn1 (I) Ho en Rose (ongepubliseerde resultate) het 'n eenvoudige skema bedink om die komplementtoetsing van 'n stel dodelike mutasies wat deur die inversie geïnduseer word, te fasiliteer hIn1 as 'n balanseerder. 'n Enkele kruising vir elke gebalanseerde dodelike gegenereerde wilde-tipe mannetjie van 'n enkele genotipe wat gebruik kan word in komplementeringstoetse teen tekorte en ander dodelike mutasies. Byvoorbeeld, mannetjies van 'n standaard balanseerder-stam, van genotipe hIn1[unc-54]/unc-75 unc-101 , is oorgesteek na hIn1[unc-54 unc-75]/unc-101 lev-11 laat-x hermafrodiete (Figuur 5). Die enigste fenotipies wilde-tipe manlike nageslag, van genotipe hIn1[unc-54]/unc-101 lev-11 laat-x , is toe oorgesteek na ander identies gebalanseerde dodelike middels in komplementeringstoetse (bv. hIn1[unc-54]/unc-101 lev-11 laat-y ). In hierdie geval, aanvulling van laat-x deur laat-y is aangedui deur die teenwoordigheid van lewensvatbare, vrugbare Unc-101 Lev-11 nageslag ( unc-101 lev-11 laat-x/unc-101 lev-11 laat-y ). Versuim om te komplementeer is aangedui deur die afwesigheid van hierdie nageslagklas. Dieselfde skema is gebruik om die dodelikes te karteer teen tekortkominge wat albei uitgevee het lev-11 en unc-54 (soos eDf3 ). In hierdie gevalle is aanvulling of die mislukking daarvan aangedui deur die teenwoordigheid of afwesigheid van Lev-11 nageslag, aangesien geen van die tekorte uitgevee is nie unc-101 .

Figuur 5. Voorbeeld van 'n kruisingskema wat gebruik maak van hIn1 om genotipies en fenotipies unieke gebalanseerde mannetjies te genereer wat 'n verlangde dodelike mutasie dra. Die standaard manlike balanseerderstam en 'n monster gebalanseerde dodelike stam word deur genotipes in die blokkies aan die linkerkant voorgestel. Die genotipes en fenotipes van die vier klasse van kruisnageslag wat gevolg word, word aan die regterkant getoon. Beide manlike en hermafrodiete kruis nageslag sal teenwoordig wees. Hierdie voorbeeld illustreer 'n basiese beginsel van merker manipulasie, wat aangepas kan word vir ander balanseerders en merkers.

2. szT1(IX) N voordeel van szT1 in kruisingsprotokolle is die spontane segregasie van vrugbare mannetjies wat 'n duidelike Lon-2-fenotipe het en hemisigoties is vir die translokasie. Hierdie mannetjies is doeltreffend gebruik vir stamkonstruksie- en komplementasietoetse (McKim, K.S., en Rose, A.M., 1990) en toeligting van die struktuur van die translokasie (McKim, K.S., Howell, A.M., en Rose, A.M., 1988). Die translokasie is geïnduseer in 'n stam wat dra lon-2(e678) , en hierdie mutasie is dus teenwoordig op een halwe translokasie (Fodor, A., en Deak, P., 1985). Mannetjies uit szT1 stamme dra lon-2 moet 'n Lon-2-fenotipe hê, aangesien hulle hemisigoties is vir die X-chromosoom. Hierdie mannetjies dra beide halftranslokasies en een kopie van 'n normale LG I. Soos mannetjies spontaan ontstaan ​​in szT1 stamme teen 'n frekwensie van ongeveer 10% (Fodor, A., en Deak, P., 1985 McKim, KS, en Rose, AM, 1990), is dit nie nodig om mannetjies te maak wat óf die half-translokasies óf die gebalanseerde dra. LG I-merkers deur gebalanseerde hermafrodiete met wilde-tipe mannetjies te kruis.

Die drie basiese gebruike van die Lon-mannetjies hang af van hul eksklusiewe oordrag van die normale LG I na alle lewensvatbare manlike nageslag en van die translokasie-chromosome na alle lewensvatbare hermafrodiet-nageslag (Figuur 6). Eerstens kan die mannetjies gebruik word om bestaande mutasies te balanseer. Byvoorbeeld, dpy-5 gebalanseer kon word met szT1 bloot deur Lon-2 mannetjies oor te steek na a dpy-5 homosigoot. Aangesien alle wilde-tipe hermafrodiet nageslag wat uit die kruising voortspruit, vir beide heterosigoties moet wees szT1 en dpy-5 , word die mutasie in 'n enkele stap gebalanseer. Tweedens kan die mannetjies gebruik word om wilde-tipe mannetjies te genereer wat heterosigoties is szT1 -gebalanseerde dodelike mutasies vir gebruik in komplementeringstoetse teenoor ander szT1 -gebalanseerde letals, met die veronderstelling dat die letals 'n morfologiese merker in gemeen het en die aanname dat versuim om te komplementeer betroubaar in manlike nageslag beoordeel kan word. Derdens kan hulle gebruik word vir doeleindes wat vereis dat F3-hermafrodiet-nageslag twee kopieë van die normale LG I dra. Byvoorbeeld, McKim, K.S., en Rose, A.M. (1990) gebruik unc-11 dpy-14/szT1 (I) szT1 (X)/O mannetjies om wilde-tipe mannetjies van genotipe te genereer unc-11 dpy-14/dpy-5 laat-x unc-13 . Hierdie is dan gekruis na ander stamme om te toets vir komplementering van laat-x deur 'n stel dupliserings. Teenwoordigheid van die unc-11 dpy-14 chromosoom het hulle toegelaat om nageslag van die verlangde genotipe te selekteer sonder nageslagtoetsing.

3. mnDp1 (XV) Hierdie duplisering van 'n deel van die regterkant van LG X word getranslokeer na LG V. Dit is steriel as 'n homosigoot, maar heterosigotiese mannetjies is vrugbaar (Herman, R.K., Albertson, D.G., en Brenner, S., 1976). Normaalweg is analise van X-gekoppelde mutasies ingewikkeld omdat mans hemisigoties is vir die X-chromosoom en dus die mutante fenotipe uitdruk. Byvoorbeeld, mannetjies wat voortspruit uit die kruising van wilde-tipe mannetjies na 'n homosigotiese mutant unc-3 (LG X) hermafrodiet sou die genotipe hê unc-3/0 (X) . Hierdie sou 'n Unc-3 fenotipe hê en nie in staat wees om te paar of swak te paar nie. Die gebruik van mnDp1 (en soortgelyke dupliserings vir ander dele van die X-chromosoom) los hierdie probleem op. 'n Hermafrodiet-stam wat twee mutante kopieë van unc-3 en een kopie van mnDp1 het 'n wild-tipe fenotipe, aangesien die duplisering 'n wild-tipe kopie van die unc-3 geen. Mannetjies wat voortspruit uit die kruising van wilde-tipe mannetjies met hierdie stam het een van twee genotipes en ooreenstemmende unieke fenotipes. Die helfte sal die genotipe hê +/+ V unc-3/O en wees Unc-3, en die helfte sal die genotipe hê mnDp1/+ V unc-3/0 en 'n wildtipe fenotipe. Laasgenoemde is in staat om beide die duplisering en die te paar en oor te dra unc-3 mutasie in kruisings. Meneely en Herman (1979) het hierdie eienskappe van gebruik mnDp1 om resessiewe dodelike mutasies gebalanseer deur te analiseer mnDp1 wat óf gekoppel is aan óf uitgevee is unc-3 . Wild-tipe mannetjies van genotipe mnDp1/+ V unc-3 laat-x/O is gebruik om die twee X-mutasies na verskillende genetiese agtergronde oor te dra vir twee- en driefaktorkartering en vir komplementeringstoetse met ander gebalanseerde letales.

Figuur 6. Voorbeeld van 'n kruisingskema wat spontane Lon-2 mannetjies van 'n szT1 spanning om te balanseer a dpy-5 mutasie. Die manlike en hermafrodiete ouers word deur genotipes in die blokkies aan die linkerkant voorgestel. Die genotipes en fenotipes van die twee klasse lewensvatbare kruisnageslag word aan die regterkant getoon. Manlike ouers is hemisigoot vir LG X en, as gevolg van die lon-2 mutasie voortgesit szT1 , moet 'n Lon-fenotipe hê. Alle wilde-tipe manlike nageslag sal heterosigoties wees vir dpy-5 en sal nie die translokasie dra nie. Alle wilde-tipe hermafrodiet nageslag sal heterosigoties wees vir beide dpy-5 en die translokasie. Alle ander kruis-nageslag is aneuploïed, en word gestop tydens ontwikkeling.

3.4. Ophoping van spontane mutasies

Rosenbluth, R.E., Cuddeford, C., en Baillie, D.L. (1983) het die spontane dodelike mutasiefrekwensie in die 40-mu-streek gemeet, gebalanseer deur eT1 en gevind dat dit 0,06% is. Geekstrapoleer na die hele genoom, kan verwag word dat ongeveer 1 uit elke 119 self-hermafrodiete heterosigoties is vir 'n nuwe dodelike mutasie. Hierdie mutasies sou vinnig deur segregasie verlore gaan as hulle in stamme voorkom wat geen balanseermiddel dra nie en in kultuur gehandhaaf word. As die mutasies egter in 'n gebalanseerde streek voorkom, sal segregasie- en rekombinasionale verlies uitgeskakel word. Inderdaad, spontane mutasies van alle soorte (nie net dodelik nie) is geneig om in balanseerderstamme op te bou. Groot sorg moet dus deur die ondersoeker geneem word om te bevestig dat 'n gegewe gebalanseerde stam geen addisionele mutasies na die oorspronklike mutagenese opgedoen het nie. Dit is verkieslik om stamme gevries te hou as hulle nie werklik in eksperimente gebruik word nie, en stamme wat deurgegaan is, moet noukeurig nagegaan word. Die gevolge van 'n bykomende dodelike mutasie in 'n stam wat reeds 'n dodelike dra, kan veral subtiel wees. Byvoorbeeld, as die oorspronklike mutasie arrestasie in 'n middel-larvale ontwikkelingstadium tot gevolg het, kan 'n bykomende mutasie wat veroorsaak dat die dier effens vroeër arresteer, nie opgemerk word nie. Nuwe mutasies wat latere ontwikkelingsarrete veroorsaak, is fenotipies onopspoorbaar in 'n dodelike wat as 'n embrio arresteer. Hierdie onherkende sekondêre mutasies kan ontledings verwar.

3.5. Uitsonderlike segregante en balanseerder afbreek

Die waarde van 'n balanseerder word verminder indien gebalanseerde mutasies spontaan ongebalanseerd raak, of as balanseerderstamme blykbaar nuwe mutasies teen hoë frekwensie verkry. Die punt waarop 'n balanseerder nie meer as 'n balanseerder beskou word nie, is wanneer dit nie suksesvol vir sy beoogde doel gebruik kan word nie. Dit is die besluit van die betrokke ondersoeker. Alhoewel dit moontlik is vir enige balanseerder om rekombinasie te ondergaan wat lei tot verlies van gebalanseerde mutasies, is dit belangrik om te onderskei tussen uitsonderlike nageslag wat voortspruit uit rekombinasie en dié wat kan voortspruit uit chromosoom nie-disjunksie, soos hieronder beskryf. Die bepaling van die aard van 'n vermoedelike afbreekgebeurtenis moet altyd gedokumenteer word deur herstel en ontleding van diagnostiese nageslag.

Uitsonderlike segregante kan die ondersoeker laat glo dat rekombinasie in 'n balanseerderstam plaasgevind het. Byvoorbeeld, die normale nageslag van 'n stam wat dra dpy-5 ek en unc-3 X mutasies gebalanseer deur szT1 ( dpy-5/szT1[lon-2] I unc-3/szT1 X ) is wild-tipe heterosigote, Dpy-5 Unc-3 homosigote, Lon-2 mannetjies, dodelik szT1 homosigote, en dodelike aneuploïede nageslag. Dpy nie-Unc en Unc nie-Dpy nageslag word gewoonlik nie geproduseer nie omdat die merkers pseudo-gekoppel is. Skaars Unc-3-nageslag kom wel voor (McKim, K.S. en Rose, A.M., 1990), wat met die eerste oogopslag die produk kan wees van 'n rekombinasiegebeurtenis tussen die normale LG I en szT1(X) wat gelei het tot verlies van dpy-5 van die normale LG I. Noukeurige ontleding van een so 'n gebeurtenis het egter aan die lig gebring dat geen rekombinasie plaasgevind het nie. In plaas daarvan, een van die half-translokasies, szT1(X) , wat 'n gedeelte van LG I dra, was teenwoordig as 'n duplisering bykomend tot twee normale kopieë van LG I (gemerk met dpy-5 ) en twee normale kopieë van LG X (gemerk met unc-3 ). Soos hierdie duplisering, genoem szdp1 , gedra 'n wild-tipe kopie van dpy-5 maar nie van nie unc-3 , die stam het 'n Unc-3 fenotipe gehad. Analoog uitsonderlike segregante is van 'n aantal translokasiestamme herwin, bv. mnDp11 van mnT2 (Herman, R.K., Kari, C.K., en Hartman, P.S., 1982), hDp133 van hT1 , hDp134 van hT2 , en hDp135 van hT3 (McKim, K.S., Peters, K., en Rose, A.M., 1993). Die ondersoeker moet dus bewus wees van die moontlikheid dat 'n translokasie-heterosigoot aanleiding sal gee tot oënskynlike rekombinante nageslag en moet die uitsonderlike nageslag ontleed voordat daar tot die gevolgtrekking gekom word dat 'n oorkruising plaasgevind het. Fisiese ineenstorting van 'n paar balanseerders is gedokumenteer. Daar is byvoorbeeld waargeneem dat sommige dupliserings van LG I spontaan verkort, wat lei tot blootstelling van voorheen gebalanseerde mutasies (McKim, K.S. en Rose, A.M., 1990). Ook Zetka, M.C., en Rose, A.M. (1992) het twee seldsame rekombinasiegebeure in hIn1 heterosigote wat tekorte tot gevolg gehad het. In al hierdie gevalle is die feit dat fisiese herrangskikking plaasgevind het deur die herstel en ontleding van uitsonderlike nageslag gedokumenteer.

3.6. Gebruik van balanseerders in mutante skerms

Balanseerders is meestal in mutantskerms gebruik vir die herstel van dodelike mutasies, maar hulle kan ook gebruik word om nie-dodelike mutasies te herstel. Hulle kan byvoorbeeld gebruik word in nie-komplementasie-skerms vir nuwe allele van bestaande morfologiese mutasies. Die werk wat hieronder opgesom word, is hoofsaaklik gemoeid met dodelike mutasies, maar dit verskaf praktiese inligting vir enigiemand wat 'n mutantskerm oorweeg. Die volgende inligting sal nie 'n grondige kennis van balanseerdergenetika en die gepubliseerde werke vervang nie, maar die punte is goeie riglyne om onnodige werk en verwarring te vermy.

3.6.1. Mutageniserende balanseerderstamme

Ideaal gesproke word niebalanseerderstamme gemutageniseer en die nuwe mutasies word in kruisings na balanseerders vasgevang, om te verhoed dat mutasies op die balanseerder self veroorsaak word. Sulke kruisings vervang ook ongeveer die helfte van die gemutageniseerde genoom met ongemutageniseerde chromosome, wat help om ongewenste tweedeplekmutasies te verwyder. Vir groot skerms is roetine-terugkruising egter nie prakties nie, en dit is baie meer doeltreffend om balanseerderstamme direk te mutageniseer. Genetiese kartering en inter se aanvulling van die nuwe mutasies kan vinnig bewerkstellig word met stamme wat reeds gebalanseerd en toepaslik gemerk is, maar wat nie teruggekruis is nie, soos voorheen bespreek. Die probleem van tweedeplek mutasies kan tot die minimum beperk word deur die gebruik van lae mutageen dosisse (sien hieronder). Voordat meer uitgebreide karakterisering vir spesifieke mutasies onderneem word, kan terugkruising gedoen word deur gebruik te maak van skemas soortgelyk aan dié wat in Afdeling 3 (Praktiese oorwegings van balanseerdergebruik) aangebied word.

3.6.2. Mutagene dosis

Skerms moet teen lae mutagene dosisse vir alle mutagene gedoen word om die voorkoms van veelvuldige mutasiegebeure te verminder. Studies onderneem deur Rosenbluth, R.E., Cuddeford, C., en Baillie, D.L. (1983 1985) het die nut van lae dosisse EBW en gammabestraling gedemonstreer, en 'n aantal herrangskikkings wat in hierdie eksperimente gegenereer is, gekenmerk. Op grond van hierdie studies beveel ons dosisse in die reeks 1500 tot 3000 R aan vir gammabestraling en 6 tot 18 mM vir EBW. Dit is aanloklik om hoër dosisse te gebruik om die doeltreffendheid van herstel te verhoog, maar die voordele word meer as oortref deur die verhoogde komplikasie van analise. Die gebruik van laer dosisse kan ten minste help om die hoeveelheid werk te verminder deur die behoefte aan uitgebreide terugkruising voor ontleding te verminder. Skaars veelvuldige gebeurtenisse word gewoonlik in die proses van kartering opgemerk, hoewel dit nie altyd die geval is nie (Anderson, P., 1995).

3.6.3. Mutasie tipes

Mutagenese van balanseerderstamme het puntmutasies, tekortkominge, dupliserings en translokasies opgelewer. Sommige hiervan kan baie ingewikkeld wees om te ontleed. Die ondersoeker moet vertroud wees met al die gepubliseerde werk wat 'n voornemende balanseerder behels voordat dit gebruik word om dodelikes te herstel, en moet ook vertroud wees met die gedetailleerde studie deur Rosenbluth, R.E., Cuddeford, C., en Baillie, D.L. (1985) van die tipes en frekwensie van mutasies wat in skerms met eT1 .

3.6.4. Chromosomale ligging van gebalanseerde letals

Skerms wat wederkerige translokasies gebruik, sal dodelike dele in die twee genomiese streke herstel wat deur die twee halftranslokasies gebalanseer word. Om uit te vind op watter chromosoom hulle woon, vereis koppelingstoetse of kartering (bv. met tekorte). Koppelingskartering is redelik triviaal as die oorspronklike gebalanseerde stam morfologiese merkers op beide gebalanseerde chromosome dra. Verwys byvoorbeeld na Figuur 2. Kartering na chromosoom kan gedoen word deur uitkruising om die translokasie te verwyder en segregerende nageslag te ondersoek vir verminderde getalle van óf Dpy-18 (wat 'n dodelike op LG III aandui) of Unc-46 (wat 'n dodelike op LG aandui V). Daaropvolgende hoër-resolusie-posisionering kan bewerkstellig word deur gebruik te maak van rekombinasiekartering en aanvullingstoetse met tekortkominge of duplisering.

3.6.5. Mutasies buite die gebalanseerde streek

Translokasie- en inversieskerms kan dodelike mutasies oplewer wat gebalanseerd is omdat hulle naby die herrangskikkingsbreekpunte is, maar hulle lê buite die herrangskikking en kan verlore gaan deur herkombinasie. Duplikasies het 'n presiese herstelgrens, aangesien hulle balanseer deur die aanvulling van die dodelike (teenwoordigheid van 'n wilde-tipe alleel). 'n Dupliseringsskerm sal slegs dodelike stowwe oplewer wat binne die genetiese omvang van die duplisering lê. Tekortkominge wat oor die dupliseringseindpunt strek, sal nie herstel word as hulle enige noodsaaklike gene binne die eindpunt uitvee nie.

3.6.6. Gekoppelde merkers

Die teenwoordigheid van morfologiese mutasies wat aan dodelikes in balanseerderstamme gekoppel is, hou verskeie voordele in. Eerste hiervan is die gemak van herstel van die dodelikes. Dit is baie makliker om te sif vir die afwesigheid van 'n spesifieke morfologiese mutantklas as wat dit is om te sif vir vasgekeerde embrio's of larwes. Die tweede groot voordeel is dat die teenwoordigheid van die merkers genetiese kartering, komplementeringsanalise en arrestasiestadiumbepaling van die dodelikes vergemaklik. 'n Nadeel is dat die ondersoeker merker-effekte kan teëkom. Die teenwoordigheid van spesifieke merkers kan lei tot 'n dodelike arrestasie op 'n ander ontwikkelingstadium as wat dit sonder die merkers sou wees, of 'n gegewe mutasie kan dodelik wees in die teenwoordigheid van 'n merker, maar heeltemal lewensvatbaar in die afwesigheid daarvan. Byvoorbeeld, dpy-14 vertoon 'n sintetiese dodelike fenotipe in dubbelmutante konstrukte wat 'n aantal spiermutante behels, soos bv. unc-15 en unc-54 (Rose, A.M. en Baillie, D.L., 1980). Dit is die beste om die merkers te verwyder voor fenotipiese ontleding.

3.6.7. Seleksie van dodelike homosigote

Sorg moet gedra word wanneer homosigotiese nageslag gekies word vir verdere ontwikkelings- of molekulêre karakterisering om die ooreenstemming van fenope en genotipes wat van 'n gebalanseerde dodelike heterosigoot geskei is, te verstaan. Translokasiestamme skei byvoorbeeld 'n groot deel van aneuploïede nageslag af (Figuur 2) wat as embrio's of vroeë larwes arresteer, maar dit is nie die dodelike homosigote van belang nie. Om seker te wees dat die gearresteerde embrio's of diere van die korrekte genotipe is, moet die dodelike draende chromosoom na 'n nie-gebalanseerde genetiese agtergrond gekruis word en as 'n homosigoot hersegregeer word (Johnsen, R.C., en Baillie, D.L., 1991).

3.7. Skerms vir transposon-geïnduseerde mutasies

Die voordele van balanseerders vir dodelike mutante skerms lyk ideaal vir uitbreiding na skerms wat uitgevoer word in mutator genetiese agtergronde wat 'n hoë frekwensie van Tc1 transposisie vertoon (Moerman, D.G., en Waterston, R.H., 1989 Anderson, P., 1995). Die gemak van onderhoud en kruising is veral aantreklik gegewe die noodsaaklikheid om die mutator van die agtergrond te verwyder sodra 'n mutasie geïnduseer is.Alhoewel hierdie skerms gewenste mutasies kan produseer, is hulle dalk nie so algemeen bruikbaar soos skerms wat ander mutagene gebruik nie. Met behulp van mut-4(st7000)I , Clark, D.V., Johnsen, R.C., McKim, K.S., en Baillie, D.L. (1990) het 28 spontane dodelike mutasies (waarskynlik Tc1-geïnduseerde) in die 49 mu-streek ontleed, gebalanseer deur nT1 . Die verspreiding van hierdie mutasies was skeef: 86% van hulle is gekarteer na LG V, in vergelyking met 43% van EMS-geïnduseerde dodelike mutasies wat oor herstel is nT1 . Verder was die tipes mutasies wat verkry is verskillend van dié wat verkry is deur gebruik te maak van EMS, formaldehied of gamma bestraling. Twee was nuwe mutasies in voorheen ongeïdentifiseerde gene, ses was mutasies in lin-40 , en sewe was tekortkominge. Al laasgenoemde het die linkerkant van die chromosoom geskrap, en vyf van hulle het regter eindpunte in of naby lin-40 .

Die verspreiding van transposon-geïnduseerde mutasies is besig om te verander met identifikasiemetodes wat nie vereis dat 'n invoeging 'n bepuntbare fenotipe tot gevolg het nie (Plasterk, R.H.A., 1995). Ontleding van sekondêre delesie-mutante afkomstig van stamme wat transposon-insersies dra, lei ook tot inligting oor die nul-fenotipes van hierdie gene. Balanseerders kan nuttig wees in sulke skemas vir die handhawing van heterosigositeit van geïnduseerde mutasies en die identifisering van diere wat homosigoties is vir die invoegings of hul spontane afgeleides.


Neurospora: Rekombinasie, geenkartering en genotipiese beheer | Genetika

In hierdie artikel sal ons bespreek oor:- 1. Rekombinasie in Neurospora 2. Geenkartering in Neurospora 3. Genotipiese beheer.

Rekombinasie in Neurospora:

Die swam Neurospora crassa het 'n paar voordele vir studie van oorkruising. In die vegetatiewe fase van sy lewensiklus is daar groei van filamentagtige, koenositiese hifes om die haploïede miselium te vorm. Seksuele voortplanting word bewerkstellig deur twee hifes van behoorlike paringstipe en hul kerne saam te smelt om 'n diploïede sigoot te vorm (Fig. 8.11).

Die sigoot begin vergroot tot 'n langwerpige struktuur wat ascus genoem word en die sigootkern begin meioties verdeel. Die vier produkte van meiose is in 'n enkele lineêre ry binne die askus gerangskik. Elkeen hiervan ondergaan 'n mitotiese verdeling sodat 8 kerne gevorm word wat 'n muur ontwikkel en askospore word.

Wat Neurospora vir 'n genetikus interessant maak, is die feit dat die askospore lineêr georden is in dieselfde volgorde as wat die chromatiede op die meiotiese metafaseplaat was. Dit is dus moontlik om al die vier produkte van 'n enkele meiose te herwin en hulle te ontleed, soos ook elke chromatied van 'n tetrad. Dit word tetrad-analise genoem.

Neurospora bied dus 'n direkte manier om rekombinasie te demonstreer wat in hoër organismes op 'n statistiese basis uit nageslagtellings afgelei kan word. Nog 'n verdere voordeel is die gebruik van sentromeer as 'n merker vir die bepaling van kaartafstande.

Wanneer die segregasie van 'n enkele paar allele ontleed word, toon die askus van Neurospora twee rangskikkings van die agt askospore: 4: 4 verhouding as gevolg van eerste divisie segregasie en 2: 2: 2: 2 verhouding as gevolg van tweede divisie segregasie (Fig. 8.12).

Eerste Afdeling Segregasie:

Die resultate van 'n kruising tussen 'n normale (al + ) en 'n albino (al) stam van Neurospora word in Fig. 8.12 getoon. As die 8 askospore uit die askus verwyder word en elkeen afsonderlik gekweek word, word gevind dat 4 askospore mycelium van normale tipe en 4 van albino tipe produseer.

Dit is as gevolg van eerste deling segregasie wat soos volg verduidelik word: tydens anafase I van meiose in die sigoot, skei een homoloog wat al + al + dra van die tweede homoloog wat die ander alleel alal het en albei beweeg na teenoorgestelde pole.

Hul produkte word in 'n 4:4-verhouding na meiose II (en na mitose) herwin omdat geen oorkruising tussen die geen en die sentromeer plaasgevind het nie. Hierdie situasie ontstaan ​​wanneer die geen naby die sentromeer geleë is. As daar dus gevind word dat 'n groot aantal asci 'n 4:4-verhouding toon, dui dit daarop dat die betrokke geenlokus naby die sentromeer is.

Tweede Afdeling Segregasie:

Soos getoon in Fig. 8.12 as oorkruising plaasvind tussen die genoemde geen en die sentromeer, dan sal een chromatied van elke homoloog al + dra en die ander al. Daarom sal al + en al nie in staat wees om van mekaar te skei by anafase van eerste meiose wanneer die twee homoloë na die twee pole skei nie.

Dit is slegs by anafase van tweede meiose wanneer sentromere verdeel en chromatiede van mekaar skei na die twee pole dat al + en al van mekaar sal skei. Dit word tweede deling segregasie genoem en produseer 'n verhouding van 2al + : 2al: 2al + : 2al, wat ook aandui dat oorkruising tussen die geenlokus en sentromeer plaasgevind het.

Genekartering in Neurospora:

In Neurospora is die sentromeer 'n merker vir die bepaling van kaartafstande. Vir die opsporing van koppeling en kaartafstande, word die frekwensie van kruising bepaal uit die aantal asci wat tweede-afdeling segregasie toon. As daar een oorkruising is, toon die gevolglike askus 50% van askospore met ouerkombinasies en 50% met herkombinasies.

Gestel in 'n kruising waarby 'n paar allele betrokke is, toon 30% van asci tweede-afdeling segregasie. Dit wys dat 30% van sigote oorgesteek het tydens meiose en 70% nie. Aangesien daar vier chromatiede in elke tetrad is, het die 50% asci ontstaan ​​uit 30 x 4 = 120 oorspronklike chromatiede in meiose. Wanneer daar oorkruising plaasvind, is slegs twee van die vier chromatiede by 'n uitruil betrokke.

Daarom is slegs die helfte van die 120 chromatiede d.w.s. 60 oorkruisingschromatiede, die oorblywende 60 chromatiede is nie-oorkruisingschromatiede. Dit is ook hierbo genoem dat 70% van sigote nie oorkruising gehad het nie, wat beteken dat 70 x 4 = 280 nie-oorkruisingchromatiede is. Die werklike aantal nie-oorkruischromatiede is groter omdat die 30% asci wat tweede-afdeling segregasie toon, ook 60 nie-oorkruischromatiede het.

Die presiese getal is dus 280 + 60 = 340. Daarom is van die oorspronklike 100 tetrads of asci 340 nie-oorkruis-chromatiede en 60 is oorkruis-chromatiede. Aangesien 100 tetrads of asci ook 400 chromatiede beteken, is die persentasie oorkruisingschromatiede (60/400) x 100 = 15%.

Hieruit kan ons aflei dat daar 15% oorkruising tussen die geen en die sentromeer was. Ons kan ook sê dat die betrokke geen 15 kaarteenhede afgesien van die sentromeer is. Omdat die sentromeer self as 'n merker dien, is dit in Neurospora moontlik om 'n enkele geenpaar te karteer. Dit word ook 'n tweepuntkruis genoem.

Dit volg dat die metode om geenkoppeling in swamme op te spoor basies soortgelyk is aan dié vir diploïede. Die hoofkenmerk in alle gevalle bestaan ​​daarin om die frekwensie van ouertipes met rekombinante tipes te vergelyk. As daar 'n beduidende vermindering in die frekwensie van rekombinante tipes is vanaf die frekwensies wat verwag word op grond van onafhanklike assortiment, kan ons koppeling oorweeg.

Terwyl die meiotiese produkte in Neurospora in 'n askus in 'n lineêre volgorde (geordende tetrads) voorkom, is dit nie waar vir ander swamme in Ascomycetes wat ongeordende tetrads het nie. Kom ons ondersoek 'n kruising wat twee gekoppelde gene + +/ab behels in 'n swam met ongeordende tetrads.

Die sigoot (++/ab) ondergaan meiose, en afhangende van die voorkoms van oorkruising, is die tetrads van die volgende drie tipes:

(a) Ouerditipe (PD) (Fig. 8.13a):

As 'n oorkruising nie tussen hierdie twee lokusse plaasvind nie, of as 'n tweestrengdubbelkruising tussen hulle plaasvind, sal die resulterende meiotiese produkte van twee soorte wees, wat albei lyk soos ouerkombinasies, en in gelyke frekwensie verskyn (1 + + 1 ab). So 'n tetrad word ouerditipe (PD) genoem.

(b) Nie-ouerlike ditipe (NPD) (Fig. 8.13 b):

As 'n vierstring dubbele oorkruising tussen die twee gene plaasvind, word twee soorte produkte gevorm, wat albei herkombinasies is. So 'n tetrad word 'n nie-ouerlike ditipe (NPD) genoem.

(c) Tetra-tipe (TT) (Fig. 8.13 c):

Dit word geproduseer óf deur 'n enkelkruising óf 'n driestrengige dubbelkruising (van twee tipes) tussen die twee gene.

Wanneer die aantal ouer-di-tipes en nie-ouer-di-tipes aansienlik ongelyk is, moet koppeling tussen die twee gene oorweeg word.

Om die hoeveelheid rekombinasie tussen die twee gene te bepaal, word die volgende formule gebruik:

Rekombinasiefrekwensie = NPD + 1/2 TT / Totale aantal tetrads

Genotipiese Beheer van Neurospora:

In sommige gevalle is ten minste rekombinasie self onder beheer van gene. In Neurospora crassa beheer verskeie rekombinasiegene die frekwensie van rekombinasie hetsy tussen gene of binne gene. Dus, 'n resessiewe geen rec-1 beheer frekwensie van rekombinasie by die his-1 lokus. Beide rec-1 en his-1 is op dieselfde chromosoom.

By mielies kan chiasma-vorming geheel en al onderdruk word deur 'n resessiewe geen soos teenwoordig op chromosoom 1. Daar is 'n hele paar voorbeelde bekend van enkele gene sowel as poligene wat variasie in frekwensie en verspreiding van chiasma in een of meer chromosome kan veroorsaak.


Materiale en Metodes

Kultuurvoorwaardes.

H. vulkanii selle is gereeld in ryk (YPC) medium of in CAS medium gekweek (sien ref. 21). Nukleïensure en aminosure is bygevoeg tot 'n finale konsentrasie van 50 µg/mL (Sigma).

Kompetisietoetse.

H26 en H12 (Tabel 1) kulture is oornag gekweek, en toe hulle 'n OD600 𢏁 bereik, is die selle verdun tot OD600 𢏀.2 en laat groei tot OD600 𢏀.4, waar hulle almal verdun is tot OD600 𢏀.1 en gemeng 1:1. Die selle is uitgeplaat om 'n meting van verhoudings op tyd 0 te verkry. Die kulture is 1:50 elke 24 uur vir 6 d verdun. Die eksperiment is uitgevoer met vier biologiese herhalings, en elke herhaling is in duplikate gedoen. Om te onderskei tussen inteïen-bevattende selle en inteïen-geskrap selle, het ons PCR-analise uitgevoer met behulp van primers AP409 en AP410, wat die polB streek rondom die inteïn, en dit het die beoordeling van die aantal kolonies op elke plaat moontlik gemaak wat van inteïn-positiewe of inteïn-negatiewe selle ontstaan ​​het. Vanaf die 0- en 3d-tydpunte is ongeveer 95 kolonies vir elke eksperiment gekeur, en vir die 6d-tydpunt is 48 kolonies gekeur. Ons het fiksheidskoste van genotipe gedefinieer x vs genotipe y as die relatiewe verandering in gemiddelde groeikoers bereken soos in ref. 23 gebruik die selnommers op dae 0, 3 en 6 met die toepaslike verdunningsfaktore (sien sigblad in Datastel S1).

Paring Protokol.

Elke kultuur is gegroei tot 'n OD600nm van 1.1𠄱.3, en 2-ml monsters is van beide stamme geneem en toegepas op 'n 0.2-μm filter gekoppel aan 'n vakuum om oortollige medium uit te skakel. Die filter is dan op 'n Petri-bak geplaas wat 'n ryk medium (YPC-medium + timidien, sien hieronder) vir 48 uur by 42 ଌ bevat. Die selle is gewas en dan hersuspendeer in casamino (CA) sous, nog twee keer in dieselfde medium gewas en op selektiewe media uitgeplaat.

Ondersoek van inteïnverspreiding.

Om die doeltreffendheid waarmee hierdie inteïn/HEN versprei te skat, het ons stamme H729 en HAN17 (Tabel 1 en Fig. S1) gepaar. Na paring is die selle uitgeplaat deur gebruik te maak van seleksie vir timidien en urasiel (met CAS-medium aangevul met triptofaan), en dus kon slegs gepaarde selle kolonies vorm. Uit hierdie kolonies, wat beide seleksiemerkers moet bevat, is agt enkelkolonies per paringseksperiment gepluk (vier onafhanklike paringseksperimente is uitgevoer) en is in die afwesigheid van seleksie vir vier tot ses generasies in vloeibare medium gekweek, wat alle seltipes toegelaat het om te groei en heterodiploïede selle om te segregeer. Vervolgens is kulture oorgeplaas, en uit elk van hierdie 32 gepaarde kulture is 11� enkelkolonies ontleed om hul genotipe en inteïnstatus vas te stel. Om vas te stel of elke kolonie afkomstig is van die Δinteïn (HAN17) stam of van die wildtipe polB stam (H729 Tabel 1), het ons die trpA merker, wat 62 kb van is polB en daarom oor die algemeen ontkoppel daaraan. Elke kolonie is gestreep op media met en sonder triptofaan, en die polB alleel is getoets deur gebruik te maak van PCR (primers AP409 en AP410), dus is trpA+-selle dié wat van H729 (met inteïen) ontstaan ​​het, en trpA−-selle kom van HAN17 af.

Bepaling van rekombinasiefrekwensies.

Om rekombinasiefrekwensies te skat, het ons drie paringseksperimente uitgevoer, almal onder dieselfde toestande, wat drie tot vyf keer herhaal is. Die selle na paring is uitgeplaat deur gebruik te maak van seleksie vir timidien en urasiel, en die medium wat gebruik is, het triptofaan bevat. Die gekoppelde selle is ontleed soos voorheen beskryf (19), deur die toets van die trpA merker deur PCR (met primers AP214 en AP215), waar kolonies wat twee kopieë van die geen bevat, beide trpA + en trpA −, is heterodiploïede kolonies, en dié wat een van die twee bevat trpA + of trpA − is rekombinante. Ons het voorheen gewys dat selle wat óf is trpA + of trpA − toon 'n enkele tipe chromosoom op ander plekke langs die chromosome en is ware rekombinante (19).

Paringseksperimente om die koppeling tussen die ingewande te toets/polB en trpA Loki.

Om die sukses van inteïnindringing verder te kwantifiseer deur gebruik te maak van seleksie vir groei op 'n selektiewe medium wat nie triptofaan het nie, is stam HAN17 (Tabel 1) getransformeer met 'n selfmoordplasmied wat 500 bp elk van die stroomop en stroomaf flankerende volgordes van die geen Hvo0894 gekloneer in pTA131 bevat ( 45), dus genereer stam UG417 dit wil sê pyrE2 + (Fig. S3). Stam UG417 is toe met stam H729 (trpA + int + Tabel 1 en Fig. S3), en gekoppelde selle is geselekteer op CAS-medium wat timidien, uracil en triptofaan ontbreek. Hierdie medium laat slegs groei toe van heterosigotiese/heterodipoloïede wat beide die ouerlike genotipes of rekombinante selle het wat gew. pyrE2, hdrB, en trpA. Omdat ons vir drie genomiese merkers geselekteer het, waarvan twee op die UG417-genoom is, het ons verwag dat alle rekombinante selle UG417 sou wees wat hulle vervang het. trpA lokus met die trpA + vanaf H729 via homoloë rekombinasie. Ses-en-negentig kolonies van drie biologiese herhalings is gekeur met hdrB primers AP121 (5′ CCCGCCTCGCCGACGTGCAGT 3′) en AP122 (5′ GGAGTTGGTCTGCGAGTGTCG 3′) en is almal homosigoties en dus rekombinant gevind. Die kolonies is verder gekeur met inteïn-inleiders AP409 en Ap410.

Om intein inval tempo te ondersoek onafhanklik van die trpA lokus, is stam H729 getransformeer met pWL102 (46), 'n pendelvektor wat 'n mevinolienweerstandmerker bevat. H729–pWL102 is toe met stam UG417 gepaar. Gepaarde selle is geselekteer op CAS-medium aangevul met triptofaan en mevinolien wat timidien en urasiel ontbreek, en daarom is geselekteer vir hdrB en pyrE2, twee genomiese merkers op UG417 (Fig. S3). Deur hierdie seleksie te gebruik, kon slegs heterosigotiese/heterodipoloïede of selle met die UG417 wat pWL102 tydens paring verkry het, groei. Hierdie paringstoets is drie keer herhaal, en uit elke biologiese herhaling is 96 kolonies geselekteer en gestreep op CAS-medium sonder triptofaan sowel as CAS-medium aangevul met triptofaan om rekombinasie by die trpA lokus. Alle kolonies is ook aan PCR-analise onderwerp deur inteïen-inleiders AP409 en Ap410 te gebruik om inteïen-indringing te bepaal.

Monsterversameling en 16S rRNA en polB Geen volgordebepaling.

Stagnante seewater- of droë soutmonsters is versamel uit 14 gety-/spuitpoele vanaf drie rotsagtige oewers langs Israel se Mediterreense kuslyn. Vyf milliliter seewater uit elke poel is op 'n YPC-plaat wat ampicillien bevat het, versprei. Droë soutmonsters is in steriele seewater opgelos voordat dit op plate versprei is. Kolonies met tipiese Haloferax kleur en vorm is verder ondersoek deur 16S rRNA geen PCR met behulp van Halobacteriales-spesifieke 16S rRNA geen primers 287F en 958R (47). Die �-bp amplikon is deur ABI 3730XL-volgorders by MCLAB DNA Sequencing Services (San Francisco) gevolgorde. Kolonies wat blyk te behoort aan die Haloferax genus (100% identiteit tot a Haloferax sp. in NCBI nukleotied BLASTN) is aan PCR-analise en volgordebepaling van die polB geen. Die polB geen is geamplifiseer deur gebruik te maak van primers AP8 en AP11. Intein teenwoordigheid of afwesigheid is bepaal volgens die lengte van die versterkte polB produk. Die polB volgorde van die isolate is bepaal deur gebruik te maak van primers AP8, AP11, AP439, AP409 en AP410. Vir volgordeverifikasie is elke isolaat twee keer georden deur al vyf primers te gebruik, en slegs areas wat deur ten minste twee oorvleuelende rye gedek is, is as foutvry beskou en vir genotipebepaling gebruik. Afsonderlike polB genotipes het volgordeverskil van ten minste twee nukleotiede in ten minste twee liggings getoon (naamlik twee aangrensende nukleotiede het nie as twee verskillende nukleotiede getel nie, maar slegs as een).

Filogenetiese Rekonstruksie en Volgorde Logos.

polB rye is in lyn gebring in SPIER (48) met behulp van die verstek parameters soos geïmplementeer in Seaview4.3 (49) (Dataset S3). Die filogenie van ekstein-reekse is met Phyml (50) in Seaview4.3 (49) onder die GTR + Gamma + I-model bereken. Getalle gee ondersteuning waardes bereken met behulp van die benaderde waarskynlikheid verhouding toets soos geïmplementeer in Phyml 3.0 (51). Reeks rondom die invoegplek c is onttrek, en weblogo's (52) is bereken uit die belynde extein-volgorde.

Simulasies om die effekte van ploïdie te verken.

Inteïnindringing tydens paring en koloniegroei is gesimuleer om die effekte van ploïdie, homing endonuklease doeltreffendheid en fiksheidskoste van die inteïn op die tempo van inteïnindringing te bepaal. Ons weet nie hoe die chromosome na samesmelting segregeer nie, daarom het ons die gebeure na selfusie op twee verskillende maniere gemodelleer. In die eerste vorm twee selle, een inteïn-positiewe en een inteïn-negatiewe sel, 'n saamgesmelte enkelsel, en elke chromosoom segregeer onafhanklik in die dogterselle. In die tweede simulasie word chromosome van elke ouertipe ewekansig in dogterselle gesorteer, en een van die dogterselle word ewekansig gekies en vir 'n gegewe aantal generasies gevolg. Vir beide simulasies tydens elke generasie word die waarskynlikheid dat 'n inteïn-negatiewe chromosoom binnegedring word soos volg bereken: Elke ongeïnvalde chromosoom kan met waarskynlikheid gesny word

waar E is die doeltreffendheid van die homing endonuklease, Xn is die aantal homing endonukleases in die ndie generasie, en N is die totale aantal chromosome in die saamgesmelte sel. Dit normaliseer die totale aktiwiteit sodat die HEN-aktiwiteit in die ten volle binnegedringde sel dieselfde is vir verskillende ploïdievlakke (m.a.w. die hoeveelheid sitoplasma per chromosoom is konstant).

As 'n snit op 'n gegewe chromosoom voorkom, is die herstel van die snit met 'n binnegeval volgorde afhanklik van die aantal indringer rye in die sel. Die herstel van die gesnyde plek met 'n binnegeval volgorde vind met waarskynlikheid plaas

Die minus 1 in die noemer sluit die gesnyde chromosoom uit van die berekening (dit wil sê, dit kan nie as sjabloon vir sy eie herstel optree nie).

Selle met 'n nuut binnegedringde chromosoom verdeel met waarskynlikheid 1 − f, waar f is die fiksheidskoste per intein.

Parameter skatting.

Die geskatte aantal generasies van groei na paring is 34. Dit is gebaseer op 𢏂 × 10 8 selle per kolonie, of � generasies van groei. Die selle is vir nog 6 generasies gegroei nadat die kolonies gepluk is, wat 'n totaal van 34 generasies gee.

Die fiksheidskoste (f) is die afname in organisme fiksheid per inteïn verkry. Gebaseer op die medekultuurkompetisie-eksperimente (Fig. 2), het 'n heeltemal binnegedringde 20-ploïede sel 'n fiksheidsafname van 7,2% in vergelyking met 'n identiese oninvade sel. Ons gebruik 'n fiksheidskoste van 0,075% per sel wat die inteïne in die bevolking dra.

Die doeltreffendheid van die homing endonuklease (E) is bereken met behulp van deterministiese simulasies in Excel. Die aantal binnegedringde chromosome in 'n gegewe generasie is volgens die formule bereken

waar N is die aantal chromosome per sel, Xn is die aantal chromosome met inteïen vir hierdie paringsimulasies, n is die generasienommer, NXn is die aantal allele wat binnegeval kan word, en E is die doeltreffendheid van die homing endonuklease. Die faktor Xn/N weerspieël die hoeveelheid HE per genoom. Die faktor Xn/(N − 1) gee die fraksie van sjablone wat die inteïn bevat en sal lei tot die invoeging van die inteïn as die sjabloon gebruik word om die dubbelstringsny te herstel. f is die fiksheidskoste per intein. Let daarop dat hierdie formule gelykstaande is aan Xn + (NXn)PiPCfXn.

In hierdie deterministiese berekeninge, 'n homing endonuklease doeltreffendheid (E) van 0,06 lei tot inval van 81% in die geval van 'n 20-ploïede sel (sigblad in Datastel S4). Dit stem ooreen met die resultate dat 68.5% van die selle wat nie binnegedring is nie binnegeval word en 92.5% van die binnegevalle selle binnegeval bly na paring, vir 'n totaal van 80.5% van selle wat na paring binnegeval word.

Simuleer inteïnval in 'n bevolking met 'n beperkte dravermoë.

Ons het inteïnival gesimuleer in populasies wat 'n spesifieke dravermoë gehad het deur 'n gewysigde diskrete logistieke vergelyking te gebruik. Ons gebruik die volgende formules:

waar bl dui die proporsie van die bevolking aan wat die inteïn en bevat q is die proporsie van die bevolking wat nie die ingewande bevat nie, hm verteenwoordig die saamgestelde waarskynlikheid dat 'n inteïn-positiewe en inteïn-negatiewe sel DNA uitruil en die doeltreffendheid van die HEN-domein wat 'n dubbelstring breek en die inteïn inval, f verteenwoordig die fiksheidskoste vir individuele selle vir die dra van die ingewande, r is die tempo van bevolkingsgroei, en k is die drakrag (ons stel k = 1 om populasies uit te druk as breuke van die drakrag). Die groeitempo van die inteïnvrye en inteïnbevattende selle is r en (1 − f)r, onderskeidelik. Na aanleiding van die logistieke vergelyking word die groeikoers vermenigvuldig met k minus die huidige bevolkingsgrootte. Vir die simulasies wat in Fig. 4 uitgebeeld word, het ons die bydrae van inteïnbevattende en inteïnvrye selle tot die drakrag as gelyk beskou. Om 'n effek van die inteïn op beide die groeitempo en die drakrag in te sluit, het ons die vergelyking gewysig om die bydraes van bl en q tot die drakrag (Fig. S2):


Modelle en resultate

Ons ondersoek die evolusie van 'n chromosoomsamesmelting wanneer dit rekombinasie tussen twee lokusse onder opponerende selektiewe druk in twee verskillende habitatte verminder. Voor die oorsprong van die samesmelting, twee afsonderlike chromosome (ongesmelte vorm U) dra die twee polimorfiese lokusse A en B, met allele A, a en B, b onderskeidelik. Hierdie polimorfismes word gehandhaaf in 'n migrasie-seleksie-balans, wat vir eenvoud ons aanvaar in die haploïede fase gebeur. Fiksheidseffekte (s) is gelyk by die lokusse en toevoeging oor lokusse, en die samesmelting self het geen effek op lewensvatbaarheid nie.

Die voorkoms van die samesmelting (chromosoomvorm F) veroorsaak A en B gekoppel te word en teen 'n tempo te herkombineer rf in saamgesmelte homosigote (Fig. 1). In heterosigote vir die samesmelting (dra U en F chromosome), beskou ons die rekombinasieafstand tussen elke lokus en die samesmeltingspunt. Hierdie punt van samesmelting kan saamval met die sentromeer, soos die geval is in Rb translokasies. Dit is egter die posisie van die samesmeltingspunt en nie van die sentromeer self wat relevant is vir ons model nie. (Om hierdie rede is ons modelle ook van toepassing op samesmeltings wat nie die sentromeer betrek nie.) Ons maak aanvanklik die vereenvoudigende aanname dat beide lokusse op gelyke rekombinasieafstand is (rh) vanaf die samesmeltingspunt (Fig. 1). Ons neem aan dat alle evolusionêre kragte klein is, en dat migrasie baie swakker is as seleksie en rekombinasie (spesifiek: s, rh, en rf is O(ε), terwyl m is O(ε 2 ), waar ε <<1).

Ons bestudeer beide 'n kontinent-eiland en 'n twee-deme model. Die eerste hiervan kan van toepassing wees wanneer migrasie eenrigting is, of wanneer bevolkings aansienlik in grootte verskil en ons migrasie van die kleiner bevolking na die groter kan verwaarloos. Die twee-deme model, aan die ander kant, verteenwoordig 'n situasie waarin migrasie simmetries tussen twee bevolkings is. Deur 'n reeks potensiële natuurlike scenario's in te sluit, poog hierdie twee modelle om ons intuïsie in te lig.

KONTINENT–EILAND MODEL

Ons ontleed eers 'n kontinent-eiland-model waarin ongefuseerde chromosome allele dra A en B is op die vasteland gevestig. Hierdie allele is nadelig op die eiland, waar die samesmelting blykbaar die voordelige allele vasvang (a en b). Relatiewe lewensvatbaarheid in die eiland word gedefinieer as 1 vir haplotipes met allele ab, vir Ab en aB, en vir AB. Migrasie is teen koers eenrigting m van die vasteland af. Op die eiland is daar agt haplotipes met frekwensies blijk, vir chromosome van vorm i ( = U, F), alleel j by lokus A, en alleel k by lokus B. Ons gebruik bl(l) om die som van alle haplotipes met vorm of alleel aan te dui l (bv. bl(F) = blFAB + blFAb + blFaB + blFab).

Voorwaardes vir inval

Ons lei die per-generasie verandering in haplotipe frekwensies af, wat ons in staat stel om die inval van die samesmelting op die eiland te ontleed. Ons stel belang in of die F haplotipes val in wanneer dit skaars is. Ons lineariseer dus die dinamiese sisteem in terme van die frekwensies van die vier saamgesmelte haplotipes. Ons verkry eenvoudige vergelykings vir die per-generasie verandering in frekwensie van gefuseerde haplotipes, , as die som van die veranderinge by elk van die stappe in die lewensiklus: migrasie vanaf die vasteland, gevolg deur seleksie en herkombinasie.

Frekwensieveranderinge as gevolg van migrasie- en seleksiestappe is eenvoudig. Alle migrante van die vasteland is in U kariotipes, dus na migrasie verander die frekwensie van elke saamgesmelte haplotipe met. Die verandering as gevolg van seleksie is , waar is die gemiddelde fiksheid van die bevolking en WFjk is die lewensvatbaarheid van die haplotipe. Die vergelykings vir rekombinasie is effens meer ingewikkeld. Op die eiland vorm agt haplotipes 64 moontlike diploïede genotipes en herkombineer teen drie verskillende tempo's. Die veranderinge in frekwensie van F haplotipes na rekombinasie word in die Bylaag getoon.

(1)

Hierdie uitdrukking toon dat die samesmelting bevoordeel word wanneer rh < s. Vergelyking 1 dui ook daarop dat die verspreiding van die samesmelting deur migrasie gedryf word. Die selektiewe voordeel is maksimum by wanneer die herrangskikking rekombinasie ten volle onderdruk (d.w.s. by rh = 0), wat ooreenstem met vorige resultate vir inversies (Kirkpatrick en Barton 2006). Rekombinasie in saamgesmelte homosigote, rf, speel geen rol in die bepaling van die verspreiding van die samesmelting nie. Dit is omdat, wanneer die samesmelting skaars is, feitlik alle saamgesmelte chromosome in heterosigote is.

Figuur 2 vergelyk ons ​​eenvoudige analitiese benadering vir λ (gestreepte lyne) en die presiese eiewaarde (soliede lyne) wat numeries vir twee gevalle verkry is. Ons benadering is beter wanneer evolusionêre kragte swak is, maar hou steeds wanneer die seleksiekoëffisiënt s is nie veel kleiner as 1 nie. Gegewe klein evolusionêre kragte en wanneer 'n kontinent-eiland model gepas is, sal chromosoom samesmeltings ontwikkel solank as wat rekombinasie in heterosigote kleiner is as die sterkte van seleksie by plaaslik aangepaste lokusse.

(2)

Hierdie resultaat impliseer dat die samesmelting kan versprei selfs al is een van die lokusse nie styf gekoppel aan die samesmeltingspunt nie. In 'n uiterste voorbeeld word 'n samesmelting altyd bevoordeel as dit een lokus het wat heeltemal aan die sentromeer gekoppel is (d.w.s. rh,A of rh,B = 0), ongeag die posisie van die ander lokus of die sterkte van seleksie. Op die eiland, saamgesmelte chromosome wat totaal aan lokus gekoppel is A (rh,A = 0) sal altyd die voordelige alleel dra a. Verder, omdat die samesmelting rekombinasie tussen lokusse verminder A en B, is meer geneig om saamgesmelte chromosome ook die voordelige alleel te dra b, wat die inval van die samesmelting dryf. Hierdie voordeel neem af as rekombinasie tussen die samesmelting en B toeneem, en verdwyn wanneer B word heeltemal ontkoppel (rh,B = 0.5).

Frekwensie van die samesmelting by ewewig

(3)

Weereens, die verhouding tussen rh en s word uitgelig. Die samesmelting benader fiksasie soos die verskil tussen die twee parameters toeneem, en gaan verlore wanneer rhs. Hierdie resultaat toon dat die rekombinasietempo in homosigote, rf, speel nie 'n belangrike rol in hierdie stelsel nie. Die herrangskikking is voordelig omdat dit introgressie van wanaangepaste allele wat deur migrante met die U haplotipe. Daar is geen voordeel om te verminder nie rf, egter, want daar is geen bron van saamgesmelte haplotipes met wanaangepaste allele nie.

TWEE-DEME MODEL

Vervolgens bestudeer ons die evolusie van 'n samesmelting wat plaaslik aangepaste allele vasvang in 'n stelsel van twee demes wat deur migrasie verbind word (wat teen 'n gelyke tempo plaasvind m in beide rigtings). Relatiewe lewensvatbaarheid in deme 1 word gedefinieer as 1 vir haplotipes met die plaaslik aangepaste allele ab, vir Ab en aB, en vir AB. Seleksie in deme 2 is teenoorgestelde in rigting en gelyke sterkte. Die samesmelting verskyn in deme 1, wat die voordelige allele vasvang (a en b). Weereens, ons neem aan dat evolusionêre kragte swak is (s, rh, en rf is O(ε), terwyl m is O(ε 2 ), waar ε <<1).

Ons is nie in staat om 'n geslote vorm uitdrukking vir die selektiewe voordeel λ van 'n nuwe samesmelting te vind nie. Numeriese verkenning van hierdie model toon dat λ altyd positief is, en daal na nul as rh verhoog (m.a.w. die samesmelting is neutraal wanneer dit nie rekombinasie verminder nie). Om die ewewigsfrekwensies te verken, voer ons numeriese iterasies van die stelsel uit teen parameterwaardes wat voldoen aan die invalstoestande vir die kontinent-eilandmodel, aangesien dit waarskynlik situasies sal verteenwoordig waarin die kragte wat die samesmelting dryf, sterk is.

Die samesmelting versprei naby aan fiksasie in deme 1 altyd, en dra die allele wat plaaslik aangepas is vir daardie habitat. In sommige gevalle bereik dit 'n polimorfiese ewewig, maar in ander versprei dit na fiksasie in beide dele. Hierdie tweede uitkoms vind plaas wanneer allele wat in deme 2 bevoordeel word, herkombineer op gesmelte chromosome (wat moontlik is indien rh > 0). Figuur 3 toon die parameterkombinasies wat tot hierdie twee uitkomste lei. Die potensiële voordeel van 'n chromosomale herrangskikking kom uit die vermindering van introgressie van wanaangepaste migrante.

In deme 2 word die samesmelting voordelig as homosigote vir die samesmelting minder as heterosigote herkombineer, wat dus introgressie van migrerende saamgesmelte haplotipes vanaf deme 1 verminder. Dit gebeur rofweg wanneer rf < 2rh vir klein rekombinasiekoerse. Om die faktor van twee in die ongelykheid te verstaan, onthou rh is die rekombinasietempo tussen elke lokus en die samesmeltingspunt, terwyl rf is die tempo tussen lokusse A en B (sien Fig. 1). Aan die ander kant, wanneer rekombinasie in heterosigote minder is as in gefuseerde homosigote, versprei die herrangskikking nie in deme 2 nie. Dan sal die samesmelting in sterk assosiasie met allele wees a en b, en kan gehandhaaf word as 'n byna vaste kariotipiese verskil tussen demes. Die uitkoms in hierdie geval is soortgelyk aan die een wat deur inversies geproduseer word, waarin slegs die rekombinasie in heterosigote sterk verminder word. Ons het verskeie kombinasies van seleksie- en migrasieparameters ondersoek (deur altyd waardes van s > m, en s << 1), en vind dat hierdie parameters nie die kwalitatiewe patrone wat in Figuur 3 getoon word, beïnvloed nie (resultate nie getoon nie).

Ons verslap nou die aannames om verskillende herkombinasietempo's tussen elke terrein en die samesmeltingspunt toe te laat. Van belang is die beperkende geval waarin lokus A is ten volle gekoppel aan die punt van samesmelting, terwyl lokus B herkombineer teen tariewe rh,B en rf,B onderskeidelik in heterosigote en saamgesmelte homosigote. In hierdie scenario bepaal die verhouding tussen rekombinasietempo's in homosigote en heterosigote nie die lot van die samesmelting nie. Dit word altyd gehandhaaf as 'n polimorfisme tussen demes 1 en 2 (resultate nie getoon nie). Hierdie resultaat stem ooreen met intuïsie: die samesmelting verskyn eers in deme 1 wat allele dra a en b, en daaropvolgende rekombinasie kan saamgesmelte chromosome produseer wat alleel dra B. As gevolg van die gebrek aan rekombinasie tussen lokus A en die punt van samesmelting, egter, saamgesmelte chromosome wat alleel dra A verskyn nooit nie. Gesmelte chromosome dra altyd alleel a, en is nadelig in deme 2 omdat alleel a is skadelik daar.

Alhoewel toestande vir 'n polimorfiese ewewig in die twee-deme model redelik beperkend is, vind ons dat verbygaande polimorfismes vir baie lang tye kan voortduur. Figuur 4 toon 'n numeriese voorbeeld. Die samesmelting binnedring deme 1 in ongeveer 10 4 generasies, maar bly by lae frekwensie in deme 2 vir meer as 10 6 generasies voordat dit daarheen versprei. Dit impliseer dat samesmeltings wat klinies of ander ruimtelike patrone toon in werklikheid nie in 'n stabiele ewewig kan wees nie. Die absolute tydskaal vir die evolusie van die samesmelting word grootliks deur migrasie bepaal (soos ons invalsanalise vir die kontinent-eilandmodel getoon het). Die vertraging tussen demes is egter langer wanneer beide rekombinasiekoerse klein is en rf is net effens laer as 2rh. Onder daardie omstandighede, die voordeel van haplotipe F oor U is verdwynend klein, so die koers van toename is stadig.

Tot op hierdie stadium gebruik ons ​​vooruit-tyd populasie genetiese modelle om die lot van 'n nuwe samesmelting wat plaaslik aangepaste allele dra en die toestande waaronder dit sal voortduur as 'n stabiele polimorfisme te ondersoek. In die volgende afdeling, wend ons ons na terug-tyd modelle om te bepaal hoe samesmeltings patrone van neutrale genetiese diversiteit beïnvloed.

KOALESCENT-PATROONNE RONDOM POLIMORFIESE FUSIES

Chromosoomsamesmeltings kan 'n duidelike handtekening in die neutrale genetiese volgorde laat. Om ons intuïsie in te lig, bestudeer ons die verwagte samesmeltingstye op 'n neutrale terrein i wat gekoppel is aan 'n polimorfiese samesmelting onder ons twee-deme model. Hierdie tye is eweredig aan die hoeveelheid genetiese diversiteit wat op die neutrale plek verwag word.

Die samesmeltingsmodel volg die voorgeslag van 'n paar gemonsterde chromosome in 'n stelsel met verskeie genetiese agtergronde. In ons geval is hierdie genetiese agtergronde die 16 haplotipes wat deur die kombinasie van U/F vorms, A/a allele, en B/b allele in dele 1 en 2. Ons neem aan die twee demes van gelyke bevolkingsgrootte N is al baie langer in genetiese en demografiese ewewig as N geslagte. Migrasie en seleksie tree op dieselfde manier op as beskryf in ons model hierbo, en ons verkry die haplotipe frekwensies numeries van ons vorentoe-tyd model. Ons monster twee chromosome en volg hul voorgeslag op die terrein i terug in tyd. Die voorouers beweeg tussen die 16 haplotipe agtergronde deur migrasie en rekombinasie. Wanneer die voorouers dieselfde agtergrond het, smelt hulle saam teen 'n tempo wat eweredig is aan die bevolkingsgrootte van hul huidige genetiese agtergrond. Herkombinasie gebeure vind plaas tussen vier terreine: A, die samesmeltingspunt, B, en webwerf i (wat dalk aan die linkerkant van A, tussen die geselekteerde lokusse, of regs van B). Rekombinasietempo's verskil in saamgesmelte, ongefuseerde en heterosigotiese genotipes. Vir gemak van aanbieding parametriseer ons rekombinasie in terme van die genetiese kaart in ongefuseerde homosigote gefuseerde homosigote en heterosigote herkombineer teen tempo cf en ch relatief tot ongefuseerde homosigote. (Byvoorbeeld, die rekombinasietempo tussen A en die samesmeltingspunt in saamgesmelte homosigote is 'n fraksie van die tempo in ongefuseerde homosigote, rf,A = cf ru,A).

Ons stel belang in die verwagte samesmeltingstyd (gemeet in 2N generasies) op die terrein i. Die volledige stelsel word beskryf deur 'n Markov-ketting met 136 state. Ons het 'n eerste-stap-analise (hersien in Wakeley 2008) gebruik om die verwagte samesmeltingstye uit die matriks van oorgangswaarskynlikhede te bereken, en daardie tye numeries geëvalueer in Mathematica (Wolfram Research 2012 Ondersteunende Inligting). Hier bied ons 'n numeriese voorbeeld aan om die kwalitatiewe patrone wat in data verwag word, te illustreer. Ons fokus op die geval waarin N = 25,000, s = 0.1, en m = 0.01. In ongefuseerde homosigote, A is 1 cm aan die linkerkant van die samesmeltingspunt terwyl B is 5 cm na regs (d.w.s. ru,A = 0,01 en ru,B = 0.05). Die uitwerking van gefuseerde homosigote en heterosigote op rekombinasie is cf = 0,5 en ch = 0.1, onderskeidelik. By ewewig is die frekwensie van die samesmelting ongeveer 95% in deme 1 en 5% in deme 2.

Figuur 5 toon die verwagte samesmeltingstyd vir 'n monster van een saamgesmelte en een ongefuseerde chromosoom. Daar is gemerkte pieke van divergensie (verhoogde samesmeltingstyd) by die twee lokusse onder seleksie wat voortspruit uit die ou gebalanseerde polimorfisme by elk van hierdie lokusse. Daar is ook groter divergensie in die streek tussen A en die punt van samesmelting, maar nie in die streek tussen die samesmelting en B. Die gesamentlike effek van seleksie en noue koppeling tussen A en die samesmelting produseer hierdie uitgebreide divergensie. Soos rekombinasie in daardie streke toeneem, val samesmeltingstye volgens die verwagting onder die standaard neutrale model (hersien in Wakeley 2008). Hierdie patrone van divergensie is kwalitatief soortgelyk aan dié wat gevind is deur Aeschbacher en Bürger (2014), wat 'n deeglike analise uitgevoer het vir neutrale terreine wat deur twee lokusse onder plaaslike aanpassing geflankeer word. In ons model verteenwoordig die samesmelting 'n derde plaaslik aangepaste lokus wat divergensie verder bevorder deur rekombinasie te verminder. Ons resultate impliseer dat alhoewel plaaslike aanpassing in sommige gevalle 'n sterk handtekening in die genoom kan laat, dit beslis nie altyd waar is nie. Verhoogde divergensie word dalk nie gevind in lokusse wat styf gekoppel is aan die punt van samesmelting nie (bv. B in Figuur 5, effektief by 0,5 cM in heterosigote).


Meganismes van DNA-rekombinasie en genoom-herrangskikkings: interseksie tussen homoloë rekombinasie, DNA-replikasie en DNA-herstel

Christopher P. Caridi,. Irene Chiolo, in Methods in Enzymology, 2018

Abstrak

Heterochromatien is meestal saamgestel uit lang stukke van herhaalde DNA-volgordes wat geneig is tot ektopiese rekombinasie tydens dubbelstrengbreuk (DSB) herstel. In Drosophila, "veilige" homoloë rekombinasie (HR) herstel van heterochromatiese DSB's maak staat op 'n treffende herlokalisering van herstelterreine na die kern periferie. Sentraal tot die begrip van heterochromatienherstel is die vermoë om die 4D-dinamika (beweging in ruimte en tyd) van herstelpersele te ondersoek. 'n Spesifieke uitdaging van hierdie studies is die voorkoming van fototoksisiteit en fotobleikingseffekte terwyl die monster oor lang tydperke afgebeeld word, en met voldoende tydpunte en Z-stapels om herstelfokuspunte oor tyd op te spoor. Hier beskryf ons 'n geoptimaliseerde benadering vir hoë-resolusie lewendige beelding van heterochromatiese DSB's in Drosophila selle, met 'n spesifieke klem op die fluoresserende merkers en beeldopstelling wat gebruik word om die beweging van herstelfoci oor lang tydperke vas te vang. Ons gee besonderhede oor benaderings wat fotobleiking en fototoksisiteit tot die minimum beperk met 'n DeltaVision-wyeveld-dekonvolusie-mikroskoop, en beeldverwerkingstegnieke vir seinherstel-postbeelding met behulp van SoftWorX- en Imaris-sagteware. Ons bied 'n metode aan om gemiddelde vierkante verplasingskrommes af te lei wat sommige van die biofisiese eienskappe van die beweging openbaar. Laastens beskryf ons 'n metode in R om stukke van gerigte bewegings (DM's) in gemengde trajekte te identifiseer. Hierdie benaderings maak 'n dieper begrip van die meganismes van heterochromatiendinamika en genoomstabiliteit in die driedimensionele konteks van die kern moontlik en het breë toepaslikheid in die veld van kerndinamika.


Bevolkingsgenetika

Die toepassing het talle kenmerke wat verband hou met die onderrig van bevolkingsgenetiese beginsels. Op die mees basiese vlak sal die probleemoplosser- en probleemgeneratorkenmerke werk met toetse vir passing van bevolkingsgenotipegetalle by verwagtinge onder Hardy-Weinberg-aannames. Dit bereken ook die intelingskoëffisiënt (F sien Wright 1922) wat verband hou met waargenome afwykings van Hardy-Weinberg.

Ons verwag egter dat studente groter gebruik sal maak van die toepassing se grafiese uitbeeldings van evolusionêre veranderinge in alleelfrekwensie. Binne 𠇊llele Freak” (naam is 'n woordspeling op 𠇊llele frequency”), kan studente fikshede spesifiseer wat met al drie genotipes geassosieer word by 'n biallele lokus. Hulle spesifiseer ook die aanvanklike frekwensie van een alleel, die bevolkingsgrootte (oneindigheid is die verstek, om suiwer deterministiese evolusie te demonstreer), en die intelingskoëffisiënt. Die toepassing sal dan evolusionêre verandering in alleelfrekwensie oor 400 of meer generasies simuleer. Ons vind hierdie kenmerk veral handig om die stogastiese effekte van genetiese drywing te demonstreer, insluitend byvoorbeeld dat swak nadelige allele soms steeds versprei na fiksasie (frekwensie 100%) binne 'n eindige populasie (sien voorbeeld in Figuur 2). Tabel 1 bied verskeie lesse/leeruitkomste aan wat deur hierdie simulator gefasiliteer kan word. Die koppelvlak beskik oor “knyp-om-te-zoem,” sodat studente spesifieke resultate kan sien. Die simulasie self werk deur verwagte proporsies van elke genotipe te bereken en dan die aantal nageslag aan genotipes toe te ken op grond van die verwagte proporsies. Hierdie simulasie genereer dus elke individu elke generasie, so die stel van dit vir baie groot (maar nie deterministiese/oneindige) bevolkings, of vir baie lang getalle generasies, sal die loopspoed van die toepassing vertraag.

Voorbeeld van die 𠇊llele Freak”-kenmerk wat alleelfrekwensieveranderinge uitbeeld (van𠇊”) oor 250 generasies in vier bevolkings van grootte 50, in almal waarvan die genotipe�” ʼn geringe fiksheidstekort het. Hierdie spesifieke voorbeeld demonstreer hoe sterk genetiese drywing soms swak natuurlike seleksie kan oorweldig: 'n algehele neiging is duidelik, maar daar is uitskieters.

Tabel 1

• Kontrasverspreiding van dominant vs. resessiewe voordelige mutasies (of verlies van dominante vs. resessiewe nadelige mutasies)
• Bereken of verifieer voorspelde ewewig alleel frekwensies onder heterosigote voordeel en heterosigote nadeel
• Kontras-effekte van genetiese drywing met wisselende bevolkingsgroottes
• Identifiseer waarskynlikheid van „ventuele” fiksasie van alleel via genetiese drywing en neem waar dat dit voorspel word deur alleelfrekwensie te begin
• Verken verspreiding/verlies van seldsame voordelige alleel in eindige populasie, wisselende dominansie
• Verken effek van inteling op spoed van verlies van nadelige resessiewe mutasie

Campbell Probleem 5

Molekulêre Genetika Probleem 5 5. In 'n ander kruising is 'n wilde-tipe vrugtevlieg (heterosigoties vir grys liggaamskleur en rooi oë) gepaar met 'n swart vrugtevlieg met pers oë. Die nageslag was soos volg: wildtipe, 721 swart-pers, 751 grys-pers, 49 swart-rooi, 45. (a) Wat is die rekombinasiefrekwensie tussen hierdie gene vir liggaamskleur en oogkleur? (b) Na aanleiding van hierdie probleem en probleem 4, watter vrugtevlieë (genotipes en fenotipes) sal jy paar om die volgorde van die liggaamskleur, vlerkvorm en oogkleurgene op die chromosome te bepaal?

Skryf die genotipes uit om die proses te help sien. Die gene kan soos volg gesimboliseer word:

b+ = grys liggaam b = swart liggaam pr+= rooi oë pr = pers oë

Genotipe van die heterosigotiese wilde tipe (grys lyf en rooi oë) met behulp van Morgan’ se metode:

Die genotipe van die homosigotiese resessiewe individu (gebruik in 'n toetskruising) sou wees:

Bepaal die rekombinasiefrekwensie:

721 wild-tipe (grys-rooi) 721/1566 = 46% verwag
751 swart-pers 751/1566 = 48% verwag
49 grys-pers 49/1566 = 3% rekombinante
45 swart-rooi 45/1566 = 3% rekombinante

(a) Die persentasie rekombinasie is dus 6%

(b) Voorbeeld: kruis 'n wilde tipe vlieg heterosigoties vir liggaamskleur en vlerkvorm met 'n vlieg homosigoties resessief vir dieselfde eienskappe (swart liggaam/krulvlerke)