Inligting

36: Bile Esculin - Biologie

36: Bile Esculin - Biologie


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Leerdoelwitte

  • Identifiseer die organisme se vermoë om in hoë galkonsentrasie te groei en om die suikereskuline te gebruik

BILE ESCULIN

Gal esculin agar kom in 'n skuins vorm. Dit is 2 toetse in een --- weerstand teen 40% gal EN die gebruik van die suiker eskuline. Gal is 'n baie inhiberende chemikalie, veral in daardie konsentrasie. AS die bakterie groei, is die volgende vraag of dit die eskuline gebruik.

As jou bakterie nie in die teenwoordigheid van gal kan groei nie, sal die esculin-reaksie op 'n ander manier verkry moet word, met 'n esculin-suikerskyf

MATERIALE BENODIG

  • 1 gal esculin skuins per onbekende

DIE PROSEDURE

  1. Gebruik jou onbekende, streep die inokulum op die skuins.
  2. Inkubeer die medium by 25ºC of 37ºC.

INTERPRETASIE

  1. Groei op die skuins = weerstand teen 40% gal
  2. Gebruik van esculin suiker = skuins verander swart koffie (meer as 1/2 van skuins of hele agar) kleur

VRAE

  1. Die teenwoordigheid van groei op gal esculin beteken __________.
  2. Wat is esculin?

25 Hydroxycholesterol

Henriikka Kentala,. Vesa M. Olkkonen, in International Review of Cell and Molecular Biology, 2016

1.3 Lipiedligande van ORP's

OSBP, die argetipe van soogdier-ORP's, bind 25-hydroxycholesterol (25OHC) binne sy ORD-lipiedbindende sak met 'n Kd van 10 nM, en ander oksisterolspesies met laer affiniteit (Taylor et al., 1984 Dawson et al., 1989 Wang et al., 2002). Belangrik is dat OSBP ook cholesterol bind met a Kd van 173 nM (Wang et al., 2005, 2008). Die noue homoloog van OSBP in ORP subfamilie I, ORP4L, is op soortgelyke wyse getoon om 25OHC te bind met 'n Kd van 10 nM (Wang et al., 2002), en eksperimente met die ORP4S-variant het voorgestel dat ORP4 ook cholesterol by 'n laer affiniteit bind (Wyles et al., 2007). In ORP subfamilie II bind ORP1L 25OHC (Kd 97 nM), 24(S)OHC, 22(R)OHC en 7-ketocholesterol (7KC) by relatief hoë affiniteit (Suchanek et al., 2007 Vihervaara et al., 2011), terwyl ORP2 'n hoë affiniteit toon (Kd 14 nM) vir 22(R)OHC (Hynynen et al., 2009), maar slegs lae affiniteit (Kd 3.9 μM) vir 25OHC (Suchanek et al., 2007), wat aantoon dat selfs nouverwante familielede duidelike verskille in ligand-spesifisiteit kan vertoon. Soortgelyk aan OSBP en ORP4L, word verskeie ander ORP's voorgestel om cholesterol te bind (Hynynen et al., 2009 Ngo en Ridgway, 2009 Vihervaara et al., 2011 Nissilä et al., 2012 Liu en Ridgway, 2014) Trouens, ORP9L het misluk. om oksisterole te bind, maar het wel cholesterol gebind in vitro (Ngo en Ridgway, 2009), en is in staat om cholestatrienol en PI4P uit liposome te onttrek (Liu en Ridgway, 2014). Net so kon ons nie oksisterolbinding opspoor nie in vitro deur ORP10 (Nissilä et al., 2012), wat later voorgestel is om fosfatidielserien (PS) te bind (Maeda et al., 2013). In 'n studie wat fotokruisbindbare radio-gemerkte cholesterol en 25OHC gebruik het, het ons 'n positiewe kruisbindingsein vir een of albei van hierdie sterole waargeneem vir 'n totaal van 10 menslike ORP's (Suchanek et al., 2007). Dit het egter ietwat onduidelik gebly of al die waargenome seine die invoeging van die gemerkte sterolderivate binne die ORD-ligandholte weerspieël. Sommige van hulle het moontlik ontstaan ​​deur kruisbinding aan die oppervlak van die membraan-geassosieerde proteïene.

Strukturele studies oor die gis Osh-proteïene het ons kennis van ORP-liganding deur lipiede merkbaar bevorder. Die verslag deur Im et al. (2005) het die hoë-resolusiestruktuur van die "kort" gis ORP Osh4p (ook bekend as Kes1p) met vyf verskillende sterole onthul: ergosterol, cholesterol en 7KC, 20- en 25OHC. Van belang, de Saint-Jean et al. (2011) het die struktuur van Osh4p bepaal met PI4P wat binne die ORD-ligandholte ingevoeg is, en getoon dat 'n gebonde sterol geredelik vir PI4P uitgeruil word.

Die struktuur van die Osh3p ORD met gebonde PI4P (Tong et al., 2013) het aan die lig gebring dat die ligandholte van hierdie proteïen te smal voorkom om die lywige sterolmolekules te akkommodeer, wat daarop dui dat nie alle ORP's die kapasiteit het om sterole te bind nie. Die skrywers het aangedui dat die aminosuurreste wat die inositol-4-fosfaatbindende spleet by die ingang van die ligandholte beklee, hoogs behoue ​​bly onder alle ORP's, insluitend residue van die "OSBP-vingerafdruk"-volgorde (Figuur 2 (B)). Saam met die soortgelyke bevindings deur de Saint-Jean et al. (2011), het hierdie waarneming die moontlikheid na vore gebring dat PI4P-binding 'n verenigende kenmerk van alle ORP's kan wees, en dat slegs 'n subset van die familielede addisioneel sterole kan bind. 'n Nuwe aspek in ORP-ligand-spesifisiteit is deur Maeda et al. (2013), wat gedemonstreer het dat gis Osh6p en Osh7p spesifiek PS bind. Die skrywers het ook Osh6p gekristalliseer en PS in die ORD-ligandholte gemodelleer. Die kopgroep en die onversadigdes sn-2 vetterige asielketting was georiënteer na die ingang van die holte, terwyl 'n versadigde sn-1 vetterige asielketting is na die onderkant van die sak ingevoeg. Osh6p het baie min indien enige ergosterol uit membrane onttrek, wat daarop dui dat dit, soortgelyk aan Osh3p, moontlik nie sterole kan bind nie, en dus vermoedelik aan 'n nuwe, "gliserofosfolipied-bindende subgroep" van ORP's behoort. Die ORD-ligande wat vir die gis- en soogdier-ORP's geïdentifiseer is, word in Tabel 1 opgesom.

Tabel 1 . Ligande geïdentifiseer vir die ORDs van menslike en S. cerevisiae ORP's deur strukturele ontledings of in vitro binding/vervoer toetse.

SoogdierLigandeVerwysings
OSBP25OHC en ander oksisterole, cholesterol, PI4P Taylor et al. (1984) Dawson et al. (1989) Ridgway et al. (1992) Wang et al. (2005) Wang et al. (2008) Mesmin et al. (2013)
ORP4/OSBP225OHC, 7KC 20OHC, 22(R)OHC, 22(S)OHC, 7OHC, cholesterol Wang et al. (2002) Wyles et al. (2007)
ORP124(S)OHC, 22(R)OHC, 25OHC, 7KC, cholesterol Suchanek et al. (2007) Yan et al. (2007) Vihervaara et al. (2011)
ORP222(R)OHC, 7KC, 25OHC, cholesterol Suchanek et al. (2007) Hynynen et al. (2009)
ORP3?
ORP6?
ORP7?
ORP5PS, dehidro-ergosterol, cholesterol? Maeda et al. (2013) Du et al. (2011)
ORP8Cholesterol, 25OHC? Zhou et al. (2011) Yan et al. (2008)
ORP9Cholesterol, PI4P Ngo en Ridgway (2009) Liu en Ridgway (2014)
ORP10PS, cholesterol? Maeda et al. (2013) Nissilä et al. (2012)
ORP11?
S. cerevisiae
Osj1pCholesterol? Schulz et al. (2009)
Osj2pCholesterol Schulz et al. (2009)
Oos3pPI4P, cholesterol? Tong et al. (2013)
Oos4pErgosterol, cholesterol, 7OHC, 20OHC, 25OHC, dehidro-ergosterol, PI4P, PI(4,5)P2?, PS? Ek et al. (2005) Raychaudhuri et al. (2006) de Saint-Jean et al. (2011)
Osj5pCholesterol Schulz et al. (2009)
Oos6pPS Maeda et al. (2013)
oj7pPS Maeda et al. (2013)

Ileale galsuur vervoerder inhibisie as 'n anticholestatiese terapeutiese teiken in galatresie en ander cholestatiese versteurings

Biliêre atresie is 'n seldsame cholestatiese lewersiekte wat by babas voorkom en vinnig tot die dood vorder in die afwesigheid van intervensie. As gevolg van verstopping of vernietiging van die galweë, versamel galsure en dryf inflammasie, fibrose en siektevordering aan. Die standaard van sorg, Kasai porto-enterostomie (KPE), word tipies uitgevoer kort na diagnose (tans by

2 maande oud) en het ten doel om galvloei te herstel en cholestase te verlig. Nietemin ervaar die meeste pasiënte steeds lewerbesering as gevolg van ophoping van galsure na KPE, aangesien daar geen bekende effektiewe terapeutika is wat oorlewing na KPE kan verbeter nie. Die verbetering van cholestase deur onderbreking van die enterohepatiese sirkulasie van galsure kan hepatiese galsuurretensie direk verswak en die risiko van vroeë orgaanversaking verminder. Die direkte aanspreek van intrahepatiese aanwas van galsure om inherente galsuurtoksisiteite te vermy, bied 'n aantreklike en geloofwaardige terapeutiese teiken vir galatresie. Hierdie oorsig ondersoek die nuwe terapeutiese konsep van die inhibering van die enigste ileale galsuurvervoerder (IBAT), ook bekend as ASBT (apikale natrium-galsuurvervoerder, gekodeer deur SLC10A2), as 'n manier om hepatiese galsuurkonsentrasie na KPE te verminder. Deur die terugkeer van galsure na die cholestatiese lewer te verminder, kan IBAT-inhibeerders moontlik lewerskade wat verband hou met die hepatotoksisiteit en cholangiopatie van galsuurophoping verminder of vertraag. Die kliniese programme van 2 IBAT-remmers in ontwikkeling vir die behandeling van pediatriese cholestatiese lewersiektes, maralixibat en odevixibat, word uitgelig.

Dit is 'n voorskou van intekeninginhoud, toegang via jou instelling.


Inleiding

Galsure is biologies belangrike cholesterolderivate wat in die lewer geproduseer word en in die gal afgeskei word as glisien- of taurien-gekonjugeerde primêre galsure (Chiang, 2009). Die belangrikste primêre galsure wat geproduseer word, is cholsuur (CA) en chenodeoksicholsuur (CDCA) in mense, en CA en muricholsuur (MCA) in muise (Hofmann, 1999 Russell, 2003). Die gekonjugeerde vorms van hierdie primêre galsure word deur die galbuis in die duodenum vrygestel, waar hulle as skoonmaakmiddels optree vir die emulgering en absorpsie van dieetlipiede (Hofmann, 2009). Buiten hul spysverteringstelsel, tree galsure ook op as hormoon-agtige reguleerders van gasheermetabolisme (Kuipers et al., 2014) sowel as antimikrobiese middels (Begley et al., 2005). Hul sterkte word beïnvloed deur verskeie mikrobiese transformasies tydens intestinale transito.

In die dunderm word primêre galsure gedekonjugeer deur galsuurhidrolases wat uitgedruk word deur 'n wye verskeidenheid intestinale bakteriese taksa insluitend spesies wat aan die Bakteroïede (Narushima et al., 2006), 'n dominante groep binne die dermmikrobiota. Ongeveer 95% van die primêre galsure word herabsorbeer in die dunderm en herwin via die enterohepatiese sirkulasie (Russell, 2003 Ridlon et al., 2005 Hofmann, 2009). Die oorblywende 5% wat die enterohepatiese sirkulasie ontsnap, ondergaan verdere mikrobiese transformasies in die dikderm (Ridlon et al., 2005, 2016). Een van die belangrikste galsuurtransformasies is 7α-dehidroksilering, wat sekondêre galsure genereer, insluitend deoksicholsuur (DCA) en litocholic suur (LCA). Hierdie multistap biochemiese pad, gekodeer in die bai (𠇋ile acid inducible”) geenoperon, is beperk tot 'n nou filogenetiese groep bakteriese spesies wat tot die Clostridium tros XIV en is die mees omvattende bestudeer in die spesie Clostridium scindens en Clostridium hylemonae (Ridlon et al., 2005, 2016).

Transformasie van gasheer-geproduseerde gekonjugeerde primêre galsure na DCA en LCA is 'n voorbeeld van mikrobiese inter-spesie ko-metabolisme. 7α-dehidroksileringsbakterieë is afhanklik van ander mikrobiese spesies vir dekonjugasie van die glisien- of taurien-gekonjugeerde galsure, aangesien hulle slegs ongekonjugeerde galsure kan metaboliseer. Om hierdie rede, galsuur 7α-dehidroksilasie deur menslike 7α-dehidroksylerende spesies C. scindens en C. hylemonae kan nie in mono-gekoloniseerde diere voorkom nie, in afwesigheid van galsuur dekonjugerende organismes (Narushima et al., 1999).

Sekondêre galsure speel 'n sleutelrol in weerstand teen derminfeksie (Begley et al., 2005). Die beste bestudeerde voorbeeld is Clostridium difficile infeksie (CDI), 'n nosokomiale, antibiotiese terapie-geassosieerde diarree-infeksie (Rupnik et al., 2009). Weerstand teen CDI wat deur 'n gesonde dermmikrobiota verleen word, word afgeskaf wanneer dit versteur word (disbiose) deur breëspektrum-antibiotiese behandeling (Britton en Young, 2012). Die antibiotika-geïnduseerde disbiose word geassosieer met die afskaffing van sekondêre galsuurbiosintese in die kolon (Antunes et al., 2011 Theriot et al., 2016, 2014).

Dit is goed gevestig dat galsure reguleer C. moeilikheid endospoor ontkieming en uitgroei sowel as vegetatiewe groei (Wilson et al., 1982 Wilson, 1983). Terwyl die ontkieming reseptore van C. moeilikheid slegs gedeeltelik geïdentifiseer word (Francis et al., 2013a Fimlaid et al., 2015), is die primêre galsure taurocholic suur (TCA) en choliensuur sowel as die sekondêre galsuur DCA bewese kieme van C. moeilikheid spore (Sorg en Sonenshein, 2008). Boonop is dit bekend dat chenodeoksicholsuur (CDCA) sowel as alfa- en beta-stereo-isomere van muricholsuur (MCA) inhibeer C. moeilikheid ontkieming (Sorg en Sonenshein, 2010 Francis et al., 2013b). Verder is DCA sowel as LCA, ursodeoksicholsuur (UDCA) en ω-muricholsuur (ω-MCA) sterk inhibeerders van spooruitgroei en vegetatiewe selgroei van C. moeilikheid (Francis et al., 2013b Weingorden et al., 2015). Daar is dus veronderstel dat galsuur dekonjugerende en 7α-dehidroksylerende mikrobiese spesies 'n kritieke rol speel in die toekenning van kolonisasie weerstand teen C. moeilikheid. Aanvanklike bewyse wat hierdie hipotese ondersteun is hoofsaaklik afgelei van in vitro eksperimente rig bewyse vir die belangrikheid van mikrobiese galsuurtransformasie in CDI in vivo is nog skaars. Eers onlangs kon Buffie en kollegas, deur gebruik te maak van metagenomiese ontledings en berekeningsmodellering van antibiotika-behandelde diere- en pasiëntmonsters, 'n sterk positiewe korrelasie tussen die teenwoordigheid van C. scindens-verwante taksa- en CDI-weerstand, en suksesvolle oorsaaklikheid getoets in vivo deur inenting van antibiotika-behandelde, CDI-gevoelige muise met die C. scindens tipe stam ATCC35704 (Buffie et al., 2014).

Die dermmikrobiologie van C. scindens en verwante spesies word nog onderbestudeer. 'n Beperking van vorige werk was dit C. scindens kolonisasie eksperimente in vivo vereis antibiotika-behandelde diere wat 'n disbiotiese mikrobiota bevat met onduidelike agtergrondvlakke van endogene galsuur 7-dehidroksylerende bakterieë. Alhoewel hierdie situasie die toestande in die CDI pasiënt naboots, kan dit 'n eksperimentele beperking wees vir die studie van C. scindens fisiologie in die gesonde ingewande.

Alhoewel dit standaard is om geneties gedefinieerde ingeteelde muisstamme vir die meeste eksperimentele dierestudies te gebruik, bevat konvensionele diermodelle steeds rudimentêr gedefinieerde en ongestandaardiseerde mikrobiese konsortia. Dit bestaan ​​uit honderde tot duisende verskillende operasionele taksonomiese eenhede en verskil aansienlik tussen individuele diere sowel as tussen navorsingsfasiliteite (Rogers et al., 2014 Ericsson et al., 2015 Hoy et al., 2015). Alhoewel moderne analitiese en berekeningsinstrumente die ontleding van komplekse gasheer–mikrobiota-interaksies vergemaklik, is dit 'n uitdaging om die onderliggende sein- en metaboliese netwerke te vestig sonder die vermoë om ook die mikrobiota-samestelling te standaardiseer. Eksperimentele diermodelle met 'n volledig gestandaardiseerde mikrobiota, sogenaamde gnotobiotiese dieremodelle, verskaf 'n gedefinieerde en verminderde kompleksiteit in vivo stelsel vir die in-diepte toeligting van gasheer–mikrobiota interaksies.

In die huidige studie het ons 'n onlangs-gedefinieerde muis-intestinale mikrobiese konsortium gebruik, waarna verwys word as “oligo-muis-mikrobiota” (Oligo-MM 12), rasioneel saamgestel uit 12 muis-intestinale bakteriese isolate verteenwoordigend van die belangrikste soogdier-intestinale bakterieë. phyla (Brugiroux et al., 2016) as 'n platform vir die in vivo studie van C. scindens. Die bakteriese stamme wat in die Oligo-MM 12-konsortium gekombineer is, is onlangs in detail beskryf en is openlik beskikbaar by die DSMZ-bewaarplek (Lagkouvardos et al., 2016). Gnotobiotiese Oligo-MM 12-geassosieerde muise (voortaan na verwys as “stable-defined matig diverse mikrobiota, murine 2,” kort sDMDMm2 muise) is oorspronklik gegenereer deur kolonisasie van kiemvrye muise met 'n cocktail van gekweekte bakterieë. Hulle is stabiel gehandhaaf deur vir meer as 25 generasies onder gnotobiotiese toestande te teel in drie onafhanklike fasiliteite sonder beduidende samestellingsafwykings, wat muise verskaf wat 'n fisiologies verworwe en ontwikkelde stabiele dermmikrobiota huisves.

Ons het die Oligo-MM 12 mikrobiota gewysig deur kolonisasie van gnotobiotiese sDMDMm2 muise met C. scindens ATCC35704 en het die resulterende galsuur 7α-dehidroksilasie-aktiwiteit en beskerming teen CDI getoets in vivo. Vir hierdie doel het ons eers die CDI-vatbaarheid van sDMDMm2 muise vergelyk met kiemvrye en antibiotika behandeling muismodelle van CDI en het 'n omvattende kwantitatiewe analise van die geassosieerde galsuurmetabolome uitgevoer. Ons het toe die uitwerking van die bekendstelling van C. scindens in die reeds bestaande stabiele sDMDMm2-konsortium. Ons wys dit C. scindens stam ATCC35704 kan funksioneel gewysig word na sDMDMm2 om CA en CDCA 7α-dehidroksilasie uit te voer. In verband met hierdie bevinding, C. scindens kolonisasie spesifiek vertraag intestinale oorgroei van C. moeilikheid en gepaardgaande dermpatologie. Slegs geringe direkte gevolge van C. scindens op die samestelling van die 12 spesies van die Oligo-MM 12 model konsortium was waarneembaar.


Die maak van Barrett se Metaplasia

Die meeste, indien nie almal nie, slokdarm adenokarsinome ontstaan ​​uit Barrett’ se slukderm, die toestand waarin die normale plaveiselagtige selle wat die distale slukderm beklee, vervang word deur derm-tipe kolomvormige selle 7 . Barrett se slukderm ontwikkel deur die proses van metaplasie, die vervanging van een volwasse seltipe deur 'n ander. Metaplasie word vermoedelik ontstaan ​​as 'n beskermende reaksie op chroniese weefselontsteking 8, wat in die slukderm vermoedelik as gevolg van GERD is. Barrett se metaplasie kan die gevolg wees van óf die verandering van volledig gedifferensieerde slokdarm-plaveisel selle direk in derm-tipe kolomvormige selle óf uit die verandering van die differensiasiepatroon van slokdarm stamselle 8 .


METABOLISME VAN LIPIDE - PowerPoint PPT-aanbieding

PowerShow.com is 'n toonaangewende webwerf om aanbiedings/skyfievertonings te deel. Of jou aansoek besigheid, hoe-om, onderwys, medisyne, skool, kerk, verkope, bemarking, aanlyn opleiding of net vir die pret is, PowerShow.com is 'n wonderlike hulpbron. En, die beste van alles, die meeste van sy cool kenmerke is gratis en maklik om te gebruik.

Jy kan PowerShow.com gebruik om voorbeeld aanlyn PowerPoint ppt-aanbiedings te vind en af ​​te laai oor omtrent enige onderwerp wat jy jou kan voorstel sodat jy kan leer hoe om jou eie skyfies en aanbiedings gratis te verbeter. Of gebruik dit om hoëgehalte-hoe-om PowerPoint-ppt-aanbiedings te vind en af ​​te laai met geïllustreerde of geanimeerde skyfies wat jou sal leer hoe om iets nuuts te doen, ook gratis. Of gebruik dit om jou eie PowerPoint-skyfies op te laai sodat jy dit met jou onderwysers, klas, studente, base, werknemers, kliënte, potensiële beleggers of die wêreld kan deel.Of gebruik dit om baie oulike foto-skyfievertonings te skep - met 2D- en 3D-oorgange, animasie en jou keuse van musiek - wat jy met jou Facebook-vriende of Google+-kringe kan deel. Dit is ook alles gratis!

Vir 'n klein fooi kan jy die bedryf se beste aanlyn privaatheid kry of jou aanbiedings en skyfievertonings in die openbaar bevorder met topranglys. Maar afgesien daarvan is dit gratis. Ons sal selfs jou aanbiedings en skyfievertonings omskep in die universele Flash-formaat met al hul oorspronklike multimedia-glorie, insluitend animasie, 2D- en 3D-oorgangseffekte, ingebedde musiek of ander oudio, of selfs video wat in skyfies ingebed is. Alles gratis. Die meeste van die aanbiedings en skyfievertonings op PowerShow.com is gratis om te sien, baie is selfs gratis om af te laai. (Jy kan kies of jy mense sal toelaat om jou oorspronklike PowerPoint-aanbiedings en foto-skyfievertonings af te laai teen 'n fooi of gratis of glad nie.) Kyk vandag na PowerShow.com - GRATIS. Daar is werklik iets vir almal!

aanbiedings gratis. Of gebruik dit om hoëgehalte-hoe-om PowerPoint-ppt-aanbiedings te vind en af ​​te laai met geïllustreerde of geanimeerde skyfies wat jou sal leer hoe om iets nuuts te doen, ook gratis. Of gebruik dit om jou eie PowerPoint-skyfies op te laai sodat jy dit met jou onderwysers, klas, studente, base, werknemers, kliënte, potensiële beleggers of die wêreld kan deel. Of gebruik dit om baie oulike foto-skyfievertonings te skep - met 2D- en 3D-oorgange, animasie en jou keuse van musiek - wat jy met jou Facebook-vriende of Google+-kringe kan deel. Dit is ook alles gratis!


Die sistematiese oorsig van proteïenevertering en nuwe strategieë vir die lewering van klein peptides

4 Fakulteit Vee- en Veeartsenykunde, Shabestar-tak, Islamitiese Azad Universiteit, Shabestar, Iran.

* Ooreenstemmende skrywer: Tohid Vahdatpour
Fakulteit Vee- en Veeartsenykunde
Shabestar-tak, Islamitiese Azad Universiteit
Shabestar, Iran.
Tel: +984114777882
E-pos: [e-pos beskerm]

Ontvangs datum: 16 Maart 2016 Aanvaarde datum: 16 Mei 2016 Gepubliseer datum: 23 Mei 2016

Aanhaling: Vahdatpour S, Mamaghani AP, Goloujeh MS, et al. Die sistematiese oorsig van proteïenevertering en nuwe strategieë vir die lewering van klein peptides. Elektroniese J Biol, 12:3

Abstrak

Die spysverteringstelsel is ryk aan verskillende proteolitiese ensieme, suur en ander afskeidings, ook gevoer met 'n laag slym, wat ekstrasellulêre en intrasellulêre hindernisse vir peptiedabsorpsie in alle epiteeloppervlaktes van lumen verskaf. Klein peptiede kan egter van hierdie hindernisse oorsteek en uit verskillende streke van die ingewande geabsorbeer word. Hierdie peptiede as klein, mini of klein peptiede genoem bioaktiewe peptiede. Bioaktiewe peptiede word gedefinieer as peptiede met kwasi-hormoon of geneesmiddelagtige aktiwiteit wat uiteindelik fisiologiese funksie moduleer deur bindingsinteraksies aan spesifieke reseptore op teikenselle. Bioaktiewe peptiede kan geklassifiseer word as antimikrobiese, anti-diabetiese, antitrombotiese, antihipertensiewe, opioïede, immuunmodulator, mineraalbindende en antioksidatiewe. Die meeste van die finale proteïenverteringsprodukte wat geabsorbeer word, is individuele aminosure, met laer waardes absorpsie van klein peptiede. Die peptiedtransporter 1 (PEPT1) is hoofsaaklik verantwoordelik vir die absorpsie van dieet-di- en tripeptiede uit die dunderm. Tans is daar 'n belangstelling in klein peptiede in farmaseutiese navorsing en ontwikkelings word in kliniese proewe geëvalueer. Die doel van hierdie oorsig is om die bestaande kennis op te som vir 'n beter begrip van die uitdagings oor proteïenvertering, klein peptied absorpsie en orale aflewering versterkers met die klem op klein peptiede.

Sleutelwoorde

Versperring Spysverteringspeptied PEPT1.

1. Inleiding

Byna alle proteïene en baie peptiede word in die spysverteringstelsel verteer. Daarom kan farmakologies aktiewe proteïene en peptiede soos hormone nie oraal toegedien word nie as gevolg van onvoldoende orale biobeskikbaarheid, en dit kan die bruikbaarheid van hierdie verbindings beperk. Laer gastro-intestinale biobeskikbaarheid kan veroorsaak word deur swak wateroplosbaarheid, degradasie binne die gastroïntestinale inhoud, lae membraanpermeabiliteit of pre-sistemiese metabolisme. Verbindings kan swak membraanpermeasie hê as gevolg van groot molekulêre gewig soos die geval is met proteïene en ander makromolekules, of onvoldoende lipofilisiteit om in biologiese membrane te verdeel, soos met baie hidrofiele lae molekulêre gewig verbindings. Daar is talle farmakologies effektiewe verbindings wat tans gebruik word wat moet inspuit weens onvoldoende biobeskikbaarheid deur nie-inspuitingsroetes. Absorpsieverbetering is die tegnologie wat gemik is op nie-inspuitbare lewering van swak membraandeurlaatbare verbindings. Verbruik van die peptiede en proteïene toon verskeie voordele in vergelyking met konvensionele middels. Dit sluit in hoë aktiwiteit, hoë spesifisiteit, lae toksisiteit en minimale nie-spesifieke en dwelm-geneesmiddel-interaksies [1]. Ontwikkelings van biotegnologie het gelei tot die produksie van peptiede. Orale toedieningsroete het voordele, insluitend: pasiënt-nakoming, gemak van toediening en redelik lae produksiekoste. Lae orale biobeskikbaarheid van makromolekulêre middels spruit hoofsaaklik uit pre-sistemiese ensiematiese degradasie en swak penetrasie oor die dermmembraan. Die huidige oorsig gee 'n opsomming van die fisiologiese hindernisse vir orale aflewering van peptiede en bied nuwe farmaseutiese benaderings om orale biobeskikbaarheid van bioaktiewe peptiede te verbeter.

2. Vertering van Proteïen

2.1 Vertering in die maag

Die Pepsien, 'n belangrike peptiese ensiem van die maag, is die aktiefste by 'n pH van 2,0 tot 3,0. Die maagkliere skei 'n groot hoeveelheid soutsuur af. Hierdie soutsuur word afgeskei deur die pariëtale (oksintiese) selle in die kliere en die pH is gemiddeld rondom 2,0 tot 3,0, 'n hoogs gunstige reeks suur vir pepsienaktiwiteit [2]. Pepsien verteer die proteïen kollageen. Kollageen is 'n hoofbestanddeel van die intersellulêre bindweefsel daarom, vir die verteringsensieme om vleis binne te dring en die ander vleisproteïene te verteer, is dit eers nodig dat die kollageenvesels verteer word. Pepsien begin slegs die proses van proteïenvertering, wat gewoonlik slegs 10 tot 20 persent van die totale proteïenvertering verskaf om die proteïen om te skakel na proteases, peptone en 'n paar polipeptiede. Hierdie splitsing van proteïene vind plaas as gevolg van hidrolise by die peptiedbindings tussen aminosure wat tot die finale stadium verteer word om enkele aminosure en klein klein peptiede te vorm. Meer as 95 persent van die finale proteïenverteringsprodukte wat geabsorbeer word, is individuele aminosure, met slegs 5 persent absorpsie van di- en tripeptiede en baie seldsame absorpsie van ander klein peptiedmolekules. Selfs hierdie baie min geabsorbeerde molekules van heel peptiede en/of proteïene kan soms ernstige allergiese of immunologiese versteurings veroorsaak [3].

2.2 Vertering in die ingewande

Die meeste proteïenvertering vind plaas in die begin van die dunderm, in die duodenum en jejunum, deur proteolitiese ensieme vanaf pankreasafskeiding. In die dunderm word die gedeeltelike afbreekprodukte van die proteïenvoedsel aangeval deur groot proteolitiese pankreasensieme: tripsien, chimotripsien, karboksipolipeptidase en proelastase. Die tripsien en chimotripsien verdeel proteïenmolekules in klein polipeptiede karboksiepolipeptase splits dan individuele aminosure van die karboksielpunte van die polipeptiede af. Proelastase word op sy beurt omgeskakel in elastase, wat dan elastienvesels verteer wat vleis gedeeltelik bymekaar hou. Die klein persentasies van die proteïene word tot by hul samestellende aminosure deur die pankreassappe verteer [4]. Daarom bly die meeste as dipeptiede en tripeptiede. Die laaste spysverteringstadium van die proteïene in die dermlumen word bereik deur die enterosiete wat die villi van die dunderm voer, hoofsaaklik in die duodenum en jejunum. Hierdie selle het 'n borselrand wat bestaan ​​uit honderde mikrovilli wat vanaf die oppervlak van elke sel uitsteek. Twee tipes peptidase-ensieme is belangrik, aminopolipeptidase en verskeie dipeptidases wat daarin slaag om die oorblywende groter polipeptiede in tripeptiede en dipeptiede en 'n paar in aminosure te verdeel. Die aminosure met die dipeptiede en tripeptiede word maklik deur die mikrovillus-membraan na die binnekant van die enterosiete vervoer [5].

3. Absorpsie van Peptiede

Daarom moet peptiede vir absorpsie eers oor die slymlaag diffundeer voordat absorpsie oor die epiteel moontlik is. Die waterige grens of ongeroerde waterlaag kan dien as 'n beperkende faktor vir hoogs lipofiele peptiede. Sodra 'n proteïen die monolaag van derm-epiteelselle oorsteek, kan dit óf die kapillêre van die portale veneuse stelsel óf die limfatiese lakteale binnedring [6]. Die lipofiele peptiede is meer geneig om deur die limfatiese stelsel geabsorbeer te word [7]. Die limfatiese sirkulasie omseil die lewer en dus die aantreklike benadering tot aflewering van peptiede en proteïene. Absorpsie in die limfatiese lakteale verskaf baie stadige sistemiese aflewering oor 'n paar uur, aangesien die limf teen 'n stadige tempo beweeg. Alhoewel, absorpsie in die portale veneuse stelsel lei tot vinnige aflewering binne minute na sistemiese sirkulasie na 'n aanvanklike hepatiese pas.

PEPT1-gemedieerde aktiewe absorpsie is verantwoordelik vir die hoë biobeskikbaarheid van oraal aktiewe peptiede sodat die protongekoppelde opname van die meer as 8000 verskillende di- en tripeptiede uitgevoer word deur die hoë-kapasiteit/lae-affiniteit peptied vervoerder isovorm PEPT1 (SLC15A1) [ 8]. Byvoorbeeld: betalaktam-antibiotika van die kefalosporien- en penisillienklasse, ACE-remmers, ester-voorgeneesmiddels van enalapril en fosinopril, bestatien, alafosfalien, aminosuurgekonjugeerde antivirale middels (valacyclovir), L-DOPA, sowel as kunsmatige di- en tripeptiede soos Glypeptiede - Sar [9]. PEPT1 verkies peptiede wat L-aminosure bevat bo D-enantiomere. Verskeie PEPT1-remmers soos sulfonielureum-antidiabetiese middels, nateglinied, glibenklamied, tolbutamied, chloorpropamied, sartans en ester-pro-middels van ACE-inhibeerders is geïdentifiseer. Di-peptiede soos Gly-Sar en Val-Ala het ook inhiberende potensiaal getoon, daarom kan di- en tri-peptiede wat deur vertering van melkproteïene geproduseer word, ook PEPT1-gemedieerde geneesmiddelabsorpsie inhibeer, wat verminderde blootstelling van die slagoffermedikasie veroorsaak (Figuur 1) .

4. Hindernisse vir Peptied Absorpsie

Hindernisse vir absorpsie van peptiede is ekstrasellulêre en intrasellulêre hindernisse. Kragtige hindernisse bestaan ​​vir die orale absorpsie van peptiede die ontwikkeling van orale vervangings vir inspuitbare peptiede is 'n hoë-prioriteit navorsing vir die verbruik van peptiede [10]. Die orale biobeskikbaarheid van die meeste peptiede is minder as een persent. Inhibisie van proteolitiese ensieme en die opening van stywe aansluitings verhoog para-sellulêre vervoer van peptiede vanaf die ingewande [11].

4.1 Ekstrasellulêre hindernisse

Peptied absorpsie van die spysverteringstelsel ondervind ensiematiese en penetrasie hindernisse. Hidrolise van peptiede en proteïene in die spysverteringstelsel kan voorkom in die lumen, in die kwasgrens, intrasellulêre vloeistof of in die sitosol van die enterosiete [12]. Soos die proteïen ingeneem word, bereik dit die maag, waar dit deur maagsap in 'n baie suur omgewing ingewerk word. Maagsap bevat 'n familie van asparaginale proteïnases wat pepsiene genoem word. Pepsiene verteer die proteïen in 'n mengsel van polipeptiede en beweeg af na die duodenum. Soos die proteïen die duodenum binnedring, styg die pH tot ongeveer 6,0 tot 8,0. Hierdie pH-verandering van ongeveer van 2.0 tot 8.0 kan ook presipitasie van die proteïen deur sy iso-elektriese punt veroorsaak en kan dan nie maklik weer oplos nie [4].

Figuur 1:Vertering van proteïene en peptiede vir absorpsie van aminosure en di-tri-peptiede na bloedstroom.

In die duodenum word die polipeptiede deur pankreasproteases ingewerk. Hierdie proteases word geklassifiseer na endopeptidases soos tripsien, chimotripsien en elastase of eksopeptidases soos karboksie peptidase A. Hierdie ensieme breek die polipptiede af in kleiner peptiede. Hierdie peptiede word dan verder afgebreek deur die proteases in die kwasgrens en die sitosol van die enterosiete. Vir peptiede met vier of meer residue is meer as 90 persent van die proteolitiese aktiwiteit in die borselgrensmembraan. Vir tripeptiede is die aktiwiteit 10 tot 60 persent vir dipeptiede, dit is slegs sowat 10 persent. Lysosome en ander selorganelle kan ook optree as potensiële plekke van peptied- en proteïenafbraak [13,14]. Die kwasgrens bevat eksopeptidases wat op die N-terminale einde van die proteïen (aminopeptidases) optree. Aminopeptidases in die ingewande sluit leucine amino peptidase en aminopeptidases N, A en B in. Die aminopeptidase-aktiwiteit in die Payer se kolle van die jejunum en ileum is slegs sowat 20 tot 30 persent van dié in die naburige pleistervrye gebiede [14 ]. Kennis van die verspreiding van borselgrensmembraanpeptidases langs die ingewande help om die voorkeuropname van peptiede en proteïene uit verskeie dermstreke te voorspel [13]. Omdat hierdie verspreiding vir verskillende ensieme kan verskil, kan plekspesifieke orale aflewering afhanklik wees van die aminosuurvolgorde van die peptied. Dit is as gevolg van die substraat spesifisiteit van die kwas grens membraan peptidases. Die aktiwiteite van borselgrensmembraanpeptidases kan ook beheer word deur die oppervlak pH van mukosale selle eerder as die luminale pH [15]. Daarom moet besef word dat verskeie ensieme wat op koolhidrate inwerk ook die geneesmiddel kan beïnvloed as dit 'n glikoproteïen is.

4.2 Intrasellulêre hindernisse

Peptiede kan deur twee roetes van epithelia beweeg. Die transsellulêre roete behels intrasellulêre oordrag van die apikale na die basolaterale oppervlak van 'n individuele epiteelsel. Hierdie vervoer kan óf deur spesifieke opnamemeganismes van die sel plaasvind óf deur opeenvolgende verdeling, gebeure vanaf 'n waterige omgewing na 'n hidrofobiese omgewing en dan terug na 'n waterige omgewing. Die transsellulêre roete is belangrik vir die opname van lipofiele peptiede deur opeenvolgende verdelingsgebeure. Die koolhidrate en aminosure word deur 'n draer-bemiddelde proses vervoer. Alhoewel L-aminosure deur 'n aktiewe vervoermeganisme geabsorbeer word, word D-aminosure deur passiewe diffusie geabsorbeer. Daar is vier afsonderlike vervoerstelsels vir aminosure, en 'n afsonderlike stelsel vervoer dipeptiede en tripeptiede na die mukosale selle.

Hierdie draerstelsels kan selfs aminosuur-tipe of peptied-tipe middels vervoer. Die aktiewe vervoermeganismes vir die transsellulêre roete sluit Na+-gekoppelde glukose-vervoer en H+-gekoppelde dipeptiede-vervoer in. Studies oor die kinetika van glisielprolienvervoer in dermborselgrensvesikels het getoon dat dipeptiedevervoer versadigbare proses is en volg Michaelis-Menten kinetika [16]. Deur gebruik te maak van borselgrensmembraanvesikels (BBMVs) wat van konynduodenum en jejunum en rot se boonste dunderm voorberei is, is geen bewyse gevind in die orale absorpsie van TRH deur 'n Na+ of H+ afhanklike draerstelsel in die borselgrensmembraan nie. Natuurlik blyk dit dat die TRH-absorpsie in vivo verantwoord kan word deur passiewe absorpsie van die peptied oor 'n parasellulêre roete en sy weerstand teen luminale hidrolise.

Die parasellulêre roete behels oordrag tussen aangrensende selle. Die villous selle het stywe intrasellulêre aansluitings, wat parasellulêre vervoer van opgeloste stowwe voorkom. Beweging vanaf hierdie roete word beperk deur die aansluitingskompleks tot molekules met 'n radius minder as ongeveer 8 Å [17]. As 'n peptied vanaf die parasellulêre roete kan beweeg, sal dit nie onderhewig wees aan vertering deur die intrasellulêre proteases nie. Alhoewel die parasellulêre roete om hierdie rede verkieslik kan wees, word strukturele kenmerke van peptiede wat hul parasellulêre vervoer kan aanmoedig nie goed verstaan ​​nie. Die verdelingskoëffisiënt tussen n-oktanol en water kan een voorspeller wees, en dwelms met 'n log P van minder as nul (d.w.s. hidrofiele molekules soos die meeste peptiede) is meer geneig om 'n parasellulêre pad te volg. Peptiede wat 'n parasellulêre pad volg, kan ook meer beïnvloed word deur penetrasieversterkers soos zonula occludens-toksien (ZOT), 'n proteïen van Vibrio-cholera wat hegte aansluitings tussen dermselle omkeerbaar kan oopmaak [18]. Parasellulêre vervoer word beperk deur die fisiese eienskappe van permeaat. Groter peptiede (meer as drie aminosure) word gewoonlik in klein hoeveelhede geabsorbeer deur passiewe diffusie via die parasellulêre roete. Alhoewel groter proteïene nie tipies in die spysverteringskanaal geabsorbeer word nie, kan proteïenantigene deur M-selle opgeneem word, wat gespesialiseerde derm-epiteelselle is wat oor aggregate van limfoïede weefsel (Payer se kolle) lê. Daar is gerapporteer dat die stywe aansluitings vir parasellulêre diffusie oor die algemeen ondeurdringbaar is vir molekules met radiusse van meer as 11 tot 15 Å, wat die limiet vir die hidrodinamiese radius vir orale aflewering van sferiese rigiede molekules kan verteenwoordig. Peptiede het egter 'n mate van bouvorm buigsaamheid, en selfs groter molekule-skanderings deurdring die stywe aansluitings [19].

5. Die webwerf van peptide aflewering

Die verskillende peptiede word op verskeie maniere uit verskillende streke van die ingewande geabsorbeer. Dit word vermoedelik veroorsaak deur verminderde proteolitiese aktiwiteit in die distale area. Die distale gebied het ook hoër parasellulêre deurlaatbaarheid ten spyte van 'n verminderde absorpsie-area [20]. Die protease-aktiwiteit in die sitoplasma toon nie streeksvariasie nie, maar dieselfde is nie waar vir die kwasgrens of vir die luminale vloeistof nie. Die maag, met sy lae pH en ensiematiese aktiwiteit, bied baie moeilike toestande vir 'n proteïenmiddel. 'n Tipiese benadering om oplossing van 'n doseervorm in die maag te voorkom, is om enteriese laag te gebruik.

Die dermsegmente het progressief minder en kleiner villi in die meer distale afdelings. Dit lei tot 'n progressief verminderde oppervlakte, met die kolon wat die laagste oppervlakte vir 'n bepaalde lengte het. Die dikderm het ook veranderlike pH en die teenwoordigheid van vaste fekale materiaal, wat kan inmeng met geneesmiddelabsorpsie. Die kolon het egter relatief lae ensiematiese aktiwiteit en is belowend in hierdie verband. Met behulp van geïsoleerde luminale ensieme en studies in ongeskonde mukosa, is gevind dat kalsitonien baie meer in die dunderm afbreek in vergelyking met die kolon [21]. Die dikderm het 'n hoë populasie van bakterieë, hoofsaaklik anaërobiese spesies. Hierdie feit is uitgebuit vir 'n vernuftige benadering om peptiede en proteïene na die kolon te teiken [22].In 'n studie is polipeptiede soos insulien of vasopressien bedek met polimere wat met asoaromatiese groepe gekruis is om oraal toegediende polipeptiede te beskerm teen vertering in die maag en dunderm van rotte. Sodra die polipeptied die dikderm bereik het, het die inheemse mikroflora die azo-bindings verminder en sodoende die kruisbindings verbreek en die polipeptied vir absorpsie vrygestel. Die boonste helfte van die dikderm word gedreineer deur hepatiese poortare, die onderste helfte word deur limfatiese gedreineer. As 'n polipeptied in die lewer vernietig word, kan dit moontlik wees om die dikte of samestelling van bedekking aan te pas sodat die middel in die onderste kolon vrygestel word, waar dit die lewerare sal omseil. Aflewering van insulien en 'n absorpsiebevorderaar aan die dikderm is ook gepoog deur 'n sagte gelatienkapsule bedek met 'n poli-akriel polimeer (Eudragit) met pH-afhanklike eienskappe [23]. Aflewering van insulien-agtige groeifaktor I (IGF-I) aan rot- en mini-vark kolon mukosa onder in vitro toestande is ondersoek. IGF-I is 'n 7649-Da proteïen van 70 aminosure wat sy biologiese aksies uitoefen deur spesifieke IGF-I reseptore. Dit is nuttig gevind om bloedglukosevlakke in insulienweerstandige diabetiese pasiënte in kliniese studies te verlaag. IGF-I is ongeskonde geabsorbeer oor die rotkolonslymvlies soos bepaal deur omgekeerde-fase hoëprestasie vloeistofchromatografie (RP-HPLC), natriumdodesielsulfaat en ndashpoly akrielamiedgelelektroforese (SDSPAGE), en Western blotting [24]. 'n Tydgebaseerde geneesmiddelvrystellingstelsel vir kolonspesifieke aflewering is ontwikkel. Hierdie stelsel ontgin die relatief konstante dunderm-transittyd van doseervorme [11]. Tydgebaseerde stelsels kan ontwerp word om hul geneesmiddel vry te stel na 'n voorafbepaalde vertragingstyd, met die vertragingstyd onafhanklik van normale fisiologiese toestande soos pH, spysverteringstoestand van die proefpersoon en anatomiese posisie ten tyde van vrystelling [19,25].

Die oënskynlike deurlaatbaarheid van insulien uit die ingewande van rotte toon 'n plekafhanklike variasie soos gemeet deur die afgekeerde rotdermsak-tegniek. Die deurlaatbaarheid was aansienlik groter in die jejunum en die ileum as in die duodenum. In hierdie in vitro eksperimente was insulien merkwaardig stabiel. Dit dui daarop dat insulienmetabolisme by die kwasgrens nie betekenisvol is nie. Insulien is egter byna volledig gemetaboliseer in intestinale homogenate. Dit blyk dus dat afbraak van insulien onder 'n in vivo situasie deur luminale en sitosol ensieme veroorsaak sal word [1]. In situ eksperimente het getoon dat die absolute biobeskikbaarheid van insulien hoër was wanneer dit toegedien word in die meer distale gebied van die rotderm as dié wat uit 'n meer proksimale gebied van die ingewande geabsorbeer is [26]. Insulienabsorpsie vanaf isobutielsianoakrilaat Nano-kapsules wat aan diabetiese rotte toegedien is, was afhanklik van die plek van absorpsie. Die hipoglisemiese effek na absorpsie vanaf verskeie plekke was soos volg: ileum, maag, duodenum en jejunum, en kolon.

6. Strategieë vir die lewering van peptide

Die vyf hoofmetodes is die belangrikste strategieë, insluitend: chemiese modifikasie, bioadhesive afleweringstelsels, penetrasieversterkers, protease-inhibeerders, draerstelsels. Die ander formulering en maniere verwys aan die einde van hierdie resensie wat in die nabye toekoms oorweeg sal word.

6.1 Chemiese modifikasie

Die draermolekules wat gebruik word om die inheemse peptiede omkeerbaar te destabiliseer. Hierdie geen kovalente interaksie tussen die draer en gedeeltelik ontvoude proteïenkonformasie verhoog oplosmiddelblootstelling van hidrofobiese sykettings, waardeur die lipiedoplosbaarheid en orale absorpsie van die proteïen deur 'n passiewe en transsellulêre roete verhoog word [27]. Die chemiese modifikasiebenadering is meer van toepassing op peptiede as op proteïene as gevolg van die strukturele kompleksiteit van proteïene. 'n Peptied kan chemies gemodifiseer word om sy ensiematiese stabiliteit of membraanpermeasie te verbeter. Byvoorbeeld, vervanging van D-aminosure vir L-aminosure in die primêre struktuur kan die ensiematiese stabiliteit van die peptied verbeter. 'n Voorbeeld van chemiese modifikasie van 'n peptied wat lei tot verhoogde ensiematiese stabiliteit sonder om membraanpermeabiliteit te beïnvloed, is die verskillende analoë van die natuurlik voorkomende penta-peptied metionien (Met)-enkefalien. Die metabolisme van hierdie analoë deur BBMV's toon groot verskille in degradasietempo's, maar hulle het almal soortgelyke effektiewe deurlaatbaarheid oor Caco-2-selle [28].

Nog 'n leidraad vir chemiese modifikasie kom van die feit dat 'n lipofiele peptied, siklosporien A, geredelik uit die spysverteringskanaal geabsorbeer word. Sodoende is pogings gerig om lipiedoplosbaarheid aan peptiede te verleen deur 'n asielgroep van 'n vetsuur aan 'n aminoterminus van die peptied te bind. Deur 'n reeks van tripeptiede tot proteïene te gebruik, is lipiedoplosbaarheid vir tirotropien-vrystellende hormoon, tetra-gastrien, insulien en lisosiem bereik. Hierdie nuwe afgeleides het hul biologiese aktiwiteit behou en het absorpsie vanaf die ingewande verhoog [29]. Nog 'n benadering om lipofilisiteit te verhoog kan siklisering wees, wat gelaaide N- en C-terminale groepe sal verwyder, wat die algehele oplosmiddel-toeganklike oppervlakte van die molekule verminder. Ook kan meer lipofiele sintetiese aminosure soos t-butielglisien, b-naftielalanien en p-fenielfenielalanien gebruik word om peptiedanaloë te sintetiseer mits biologiese aktiwiteit nie verlore gaan nie. Die gebruik van 'n gekonjugeerde sisteem, wat strukturele kenmerke van lipiede kombineer met dié van aminosure en peptiede, sal waarskynlik 'n hoë mate van membraanagtige karakter vir die konjugaat verskaf, wat sy deurgang oor membrane kan toelaat [30]. Chemiese modifikasie van salmkalsitonien is ook gedoen om die orale absorpsie daarvan haalbaar te maak. In 'n studie het salmkalsitonien gewysig deur 'n nuwe metode om vetsuur-polipeptied-konjugate voor te berei, kan dit in waterige oplossings uitgevoer word en kan die oorspronklike aktiewe polipeptied in weefsels of bloed regenereer. Deur hierdie omkeerbare waterige lipidiseringsbenadering te gebruik, was die area onder die kurwe (AUC) van gemodifiseerde kalsitonien wat oraal afgelewer is ongeveer 20 keer hoër as dié van ongemodifiseerde kalsitonien [19]. PEGyleerde proteïene kan ook 'n potensiaal vir orale aflewering hê. Daar is gerapporteer dat PEGilering van rekombinante menslike granulosiet kolonie-stimulerende faktor sy stabiliteit en in vivo bioaktiwiteit verhoog wanneer dit deur die intraduodenale roete toegedien word. Die biobeskikbaarheid daarvan deur die interne roete was 1,8 tot 3,5 persent, die ongemodifiseerde proteïen het geen kwantifiseerbare respons geproduseer nie [31].

Chemiese modifikasie lei nie altyd tot verbeterde orale absorpsie nie. Diacyl-derivate van insulien het hoër proteolise getoon as inheemse insulien in die dunderm van rotte onder in vitro toestande. Dit was omdat insulienassosiasie deur diasilering geïnhibeer is, wat meer monomere beskikbaar maak vir proteolise [32]. Die strukturele vereistes vir dermabsorpsie van peptiedmiddels is hersien [23]. Barlow en Satoh [9] het 'n reeks elementêre ontledings gedoen om die basiese ontwerpkenmerke vir 'n kragtige, spesifieke en absorbeerbare peptiedmiddel te definieer. Herkenning van die peptied deur sy teikenreseptor benodig blykbaar ongeveer 4 tot 6 aminosuurreste, en die res van die struktuur kan oorbodig wees vir bioaktiwiteit. Die gevolglike struktuur is steeds te groot vir vervoer deur parasellulêre vervoer. Dit is ook onwaarskynlik dat peptiedtransporters vir molekules groter as die drie residue sal bestaan, sodat aktiewe vervoer ook nie haalbaar is nie. Vir vervoer deur eenvoudige diffusie, moet die lipofilisiteit van die peptied verhoog word. Gebaseer op molekulêre modellering, is voorspel dat 'n aktiewe absorbeerbare peptied 'n totale oppervlakte van ongeveer 350 Å2 moet hê, waarvan die polêre oppervlakte 50 Å2 of minder moet wees. Dit kan gepoog word deur die peptied NH-groepe te metieleer, wat gelaaide termini of siklisering van die molekule uitskakel sodat peptied CO en NH groepe ontoeganklik gemaak word om op te los as gevolg van intramolekulêre waterstofbinding. Rekenaarsimulasies om peptiede te ontwerp of om hul orale absorpsie te voorspel, kan moontlik wees. 'n Teoretiese analise om die mate van peptiedabsorpsie te skat is ontwikkel op grond van 'n massabalansbenadering. Met behulp van hierdie analise het simulasies getoon dat die dermabsorpsie van insulien ongeveer 1 persent van die toegediende dosis is [33]. Omdat dit bekend is dat sommige peptiedtransporters in die dermslymvlies bestaan, sal kennis van die struktuur daarvan lei tot rasionele ontwerp van peptiedmimetika wat affiniteit vir hierdie reseptor het. Passiewe diffusie sal egter beperk word as gevolg van substraat spesifisiteit. Strukturele kenmerke van peptiede om geneesmiddellewering te bewerkstellig, is nie noodwendig dieselfde as dié wat benodig word vir bioaktiwiteit nie. Daarom word 'n samewerkende poging deur 'n multidissiplinêre span vereis vir rasionele ontwerp van peptiedmimetika met voldoende orale absorpsie [33].

Kortliks, onder algemene standaardmodifikasies van peptiede soos volg:

- Onnatuurlike aminosure (6-Aminokapronsuur, Amino bottersuur, Citrulline, Norleucine, ens.)

- Swaar aminosure (gemerk met 13C en/of 15N)

- Fosforilering of sulfurilering (by Ser, Tyr, Thr)

- Vervoeging aan draerproteïene (BSA, KLH, OVA)

- Vertakking van peptiede (MAP's &ndash veelvuldige antigeniese peptiede)

6.2 Bioadhesiewe afleweringstelsels

Bioadhesive afleweringstelsels is wyd ondersoek om orale peptiedverbruik voor te berei [34]. Dit verhoog die totale tyd vir peptiedabsorpsie aangesien die afleweringstelsel nie afhanklik sal wees van die gastroïntestinale deurgangstyd vir verwydering nie. Peptiede sal nie deur die luminale inhoud of die slymlaag hoef te diffundeer om die mukosale epiteel te bereik nie. As gevolg van intieme kontak met die slymvlies, word 'n hoë geneesmiddelkonsentrasie vir absorpsie aangebied. Ook, plek-spesifieke aflewering kan moontlik wees as bioadhesie kan plaasvind op 'n spesifieke plek in die spysverteringstelsel. Bioadhesiewe afleweringstelsels kan beïnvloed word deur die slymomsettyd in die spysverteringstelsel, wat wissel na gelang van die plek. In die spysverteringstelsel van rotte is gevind dat die kolon en blindedarm die beste plek is vir mukoadhesie van poli-karbofiele skywe. Mukoadhesiewe dermkolle is ook ondersoek vir orale aflewering van konvensionele geneesmiddelmolekules [5]. Bioadhesiewe polimere kan gebruik word om die orale absorpsie van peptiedmiddels te verbeter. Die Bioadhesive polimere, poli-karbofiel en chitosan-derivate is gebruik om die absorpsie van die peptiedmiddel 9-desglisinamied, 8-argininevasopressien (DGAVP) in die vertikaal-perfusie-dermlusmodel van die rot te verbeter [35]. Buccale gomstelsels bied ontelbare voordele in terme van toeganklikheid, administrasie en onttrekking, ontvanklikheid, lae ensiematiese aktiwiteit, ekonomie en hoë pasiënt-nakoming. Adhesies van hierdie geneesmiddelafleweringstoestelle aan mukosale membrane lei tot 'n verhoogde geneesmiddelkonsentrasiegradiënt by die absorpsieplek en verbeter dus die biobeskikbaarheid van sistemies afgelewerde geneesmiddels. Ondersoeke duur voort buite tradisionele polimeernetwerke om ander innoverende dwelmvervoerstelsels te vind. In die huidige globale scenario vind wetenskaplikes maniere om bukkale gomstelsels te ontwikkel deur middel van verskeie benaderings om die biobeskikbaarheid van geneesmiddels wat mondelings gebruik word te verbeter deur die formuleringstrategieë te manipuleer soos die insluiting van pH-modifiseerders, ensieminhibeerders, permeasieversterkers, ens. Die toekomstige rigting van bukkale kleefmiddel aflewering lê in entstofformulerings en aflewering van peptiede.

Nog 'n belangrike aspek het betrekking op die in vitro en ex vivo tegnieke wat aangewend word vir die evaluering van die werkverrigting van die materiale en doseervorme. Belangrike faktore wat mukoadhesie beïnvloed, insluitend:

o Konsentrasie van aktiewe polimeer

o Ketting buigsaamheid van polimeer

o Funksionele Groepbydrae

&bul Omgewings &ndash Verwante faktore: 21-25

o Seleksie van die model substraat oppervlak

6.3 Penetrasieversterkers

Onlangs word die peptiede beskou as penetrasieversterkers soos velpenetrerende peptiede (SPP's) en/of selpenetrerende peptiede (CPP's) het die afgelope paar jaar wye aandag getrek en na vore gekom as 'n eenvoudige en doeltreffende nie-indringende strategie vir makromolekule lewering in die vel of selle, onderskeidelik. Oor die algemeen kan penetrasieversterkers orale absorpsie verbeter deur hul werking op die transsellulêre of parasellulêre pad. Vir effekte op die transsellulêre pad, kan oppervlakaktiewe middels en vetsure die membraanlipiedorganisasie verander en kan dus orale vervoer verhoog. Oppervlakaktiewe middels kan in lipied-dubbellae geïnkorporeer word en sodoende die fisiese eienskappe van die selmembrane verander. Vir effekte op die parasellulêre pad, kan chelaatvormende middels die integriteit van afsluitende aansluitingskomplekse ontwrig deur kalsium of magnesium om stywe aansluitings te chelaat [36]. Galsoute soos natriumdeoksicholaat en natriumcholaat kan ook in die formulering gebruik word om die absorpsie van insulien uit die kolon gemengde micellêre sisteme te bevorder, is ook gebruik om die orale absorpsie van polipeptiede te verbeter [37]. Dit is ook bekend dat sulke stelsels natuurlik in die spysverteringstelsel gevorm word om die absorpsie van lipiede te help. Die dieetvette word eers geëmulgeer deur galsoute in die ingewande en dan opgewerk deur pankreaslipase om monogliseriede en vrye vetsure te produseer. Lipoïdale dispersies van insulien in vetsure met behulp van natriumglikolcholate as 'n emulgator en absorpsiebevorderaar is ondersoek. Daar is gevind dat die hipoglisemiese effekte na orale toediening aan konyne afhanklik is van die vetsuur wat gebruik word. Penetrasieversterkers kan die absorpsie van geneesmiddels by voorkeur in 'n spesifieke area van die spysverteringskanaal verbeter. Siklo-dekstriene is ook gebruik om die absorpsie van insulien uit die onderste jejunale/boonste ileale segmente van die rot te verbeter deur 'n in situ geslote-lus metode.

Wanneer penetrasieversterkers gebruik word om orale absorpsie te verbeter, kan daar besef word dat dit beperkings het wat hul algemene aanvaarding vir gebruik kan verhoed. Die potensiële gebrek aan spesifisiteit van penetrasieversterkers kan ook langtermyn toksisiteitsimplikasies hê wat slegs in chroniese studies geëvalueer kan word. Die potensiële litiese aard van oppervlakaktiewe middels wek veiligheidskwessies omdat die derm-epiteel 'n versperring bied vir die toegang van gifstowwe, bakterieë en virusse. Net so werk chelators wat Ca2+-uitputting veroorsaak nie spesifiek op stywe aansluitings nie, maar kan eerder globale veranderinge in selle veroorsaak, soos ontwrigting van aktienfilamente of adherente aansluitings. Dit sal dus moeilik wees om die opening van stywe aansluitings op 'n vinnige, omkeerbare en reproduceerbare wyse te veroorsaak [37].

6.4 Protease-inhibeerders

Protease-inhibeerders kan ook orale absorpsie van terapeutiese peptiede en proteïene bevorder deur hul proteolitiese afbreek in die spysverteringskanaal te verminder. Oor die algemeen kan inhiberende middels geklassifiseer word as (1) polipeptiedprotease-inhibeerders (bv. aprotinien) (2) peptiede en gemodifiseerde peptiede (bv. bacitracin, chymostatin en amastatien) (3) aminosure en gemodifiseerde aminosure (bv. a- aminoboorsuurderivate), en (4) ander (bv. p-aminobensamien en camostatmesilaat) [38]. Daar is berig dat 'n aminopeptidase-inhibeerder, amastatien, die hidrolise van die penta-peptied, leucine (Leu)-enkefalien (YGGFL) by 'n hoë pH verminder. By laer pH (onder 5.0) is gevind dat die endopeptidase-inhibeerders, tripeptiede YGG en GGF, effektief is. Coperfusie van YGGFL met 'n kombinasie van amino- en endopeptidase inhibeerders was die mees effektiewe om hidrolise in die rot jejunum te inhibeer. In die afwesigheid van hierdie inhibeerders is uitgebreide hidrolise van YGGFL in die rot jejunum waargeneem, hoofsaaklik deur borselgrensensieme en sekondêr deur luminale peptidases [39]. In 'n ander studie was 'n aminopeptidase-inhibeerder (puromisien) in staat om die absorpsie van metkefamied (MKA), 'n stabiele analoog van Met-enkefalien, oor die rotte derm te verhoog. In hierdie studie was 'n endo-peptidase-inhibeerder (tiorfan) egter ondoeltreffend. Dit is omdat die dominante ensiem wat deelneem aan MKA-metabolisme tydens absorpsie amino-peptidase [40] is.

Galsoute, benewens om as penetrasieversterkers op te tree, kan ook as protease-inhibeerders optree om orale absorpsie te verbeter. Daar is getoon dat galsoute borselgrensmembraan en sitosoliese proteolitiese hidrolise inhibeer en sal dus nuttig wees om dermafbraak van peptiedmiddels te verminder [10]. N bakteriese protease inhibeerder van Brucella abortus genoem U-Omp19 is gerapporteer as 'n ideale bestanddeel vir 'n orale entstofformulering teen aansteeklike siektes. Wanneer U-Omp19 saam oraal toegedien is met Toxoplasma gondii antigeen (Ag), U-Omp19: i) kon die harde omgewing van die spysverteringskanaal omseil deur maag- en dermproteases te inhibeer en gevolglik die halfleeftyd van die saam-toegediende Ag by immuun-induktiewe plekke verhoog. Laastens het hierdie bakteriële protease-inhibeerder in 'n orale entstofformulering mukosale beskerming en verminderde parasietladings verleen na orale uitdaging met virulente Toxoplasma gondii [41]. In 'n in situ studie met geslote klein- en dikderm-lusse by rotte, is geen merkbare hipoglisemiese reaksie waargeneem wanneer insulien alleen toegedien is nie. 'n Beduidende hipoglisemiese effek is egter verkry na dikderm toediening van insulien met 20 mM natriumglikokolaat, camostatmesilaat en bacitracin [42]. Daar is voorgestel dat as 'n protease-inhibeerder soos sojaboon-tripsien-inhibeerder gebruik word om die proteolise van insulien in die rotte derm te voorkom, die absorpsie daarvan bevorder word deur die endogene galsure wat in die ingewande teenwoordig is [43]. In 'n ander studie is 'n afname in insulienafbraak met die gelyktydige toediening van protease-inhibeerders om die orale biobeskikbaarheid van insulien te verbeter, gerapporteer. 'n Beduidende afname in bloedglukosevlakke in beide maer en diabetes-geïnduseerde vetsug rotmodelle sowel as 'n beduidende toename in plasma-insulienvlakke 20 min en 135 min na toediening van orale insulien met die peptidase-inhibeerder is in hierdie studie getoon [44] . Baie klein dosisse (ongeveer 1 mg) vasopressien in oplossing het antidiurese by rotte na orale toediening veroorsaak. Die biologiese reaksie is versterk vir AVP en LVP deur die gelyktydige toediening van 1000 eenhede aprotinien, 'n protease-inhibeerder. Die sintetiese analoog DDAVP was meer aktief as die natuurlike hormone, maar die effek van aprotinien met DDAVP was inkonsekwent.Die relatief groter orale aktiwiteit van DDAVP word veroorsaak deur die onnatuurlike D-arginien, wat dit bestand maak teen aanval deur tripsien. Stysel-poli (akrielsuur) kopolimere en stysel/poli (akriel suur) mengsels is gesintetiseer en kan potensiaal hê om orale peptied aflewering moontlik te maak as gevolg van hul proteolitiese ensiem inhibisie aktiwiteit en ioonbinding kapasiteit [20].

6.5 Draerstelsels

Draerstelsels soos nano-deeltjies, mikrosfere, liposome of eritrosiete kan ook gebruik word om die orale absorpsie van peptiede en proteïene te verbeter. Emisphere Technologies, Incorporated (Tarrytown, NY) het kliniese proewe vir orale toediening van insulien begin deur gebruik te maak van sy draer eligen®-tegnologie. Die maatskappy het ook orale aflewering van rekombinante menslike groeihormoon in samewerking met Novartis begin en is tans in fase II kliniese toetse vir orale aflewering van kalsitonien. Hierdie draermolekules, in hoë konsentrasies, veroorsaak dat die proteïen 'n konformasieverandering ondergaan na 'n gedeeltelik ontvoude of gesmelte globule toestand wat 'n hoër orale deurlaatbaarheid het. Die draermolekules is klein organiese molekules met 'n molekulêre gewig van ongeveer 200 tot 400 Da. Die proteïen word in sy oorspronklike toestand gebruik eerder as deur 'n chemiese modifikasiebenadering, en die interaksie tussen draer en proteïen is nie-kovalent. Deur selmono-lae te gebruik, is getoon dat die hegte aansluitings tussen selle nie ontwrig word nie. Die maatskappy het ook PYY 3-36 gebruik om bewys van konsep vir sy mondelinge afleweringstegnologie te demonstreer. PYY 3-36 is 'n 34-residu dermhormoon wat voedselinname fisiologies inhibeer en potensiaal het vir die behandeling van vetsug [12,45]. Die gebruik van verskillende draerstelsels om die absorpsie van insulien in verdoofde diabetiese rotte te verbeter na intraduodenale toediening te midde van lynsnyding is geëvalueer. Verskeie eritrosiet- en membraandraerstelsels is getoets. Dit sluit in eritrosiete spoke (EG's) wat voorberei is deur hemolise van menslike rooibloedselle, eritrosiet vesikel (EV's) wat voorberei is deur sonication van EG suspensie, en liposoom-inkorporerende spoke of vesikels (LEG's en LEV's, onderskeidelik). In vergelyking met 'n kontrolegroep, het hierdie draers orale absorpsie van insulien verbeter, met LEV die beste draer vir meer doeltreffende aflewering [45].

Opname van liposome deur Payer se kolle kan die opname van enige vasgevange middel verhoog. Daar is berig dat negatief gelaaide liposome met ten minste 25 mol fosfatidielserien geredelik deur die rot Payer se kolle opgeneem word na intra-luminale toediening. Proteïene soos albumien is ook gebruik om mikrodeeltjies voor te berei om die stabiliteit van geneesmiddels in die spysverteringskanaal te verbeter. Termies gekondenseerde aminosure (proteïenoïede) kan spontaan mikrosfere vorm wanneer dit aan 'n suur medium blootgestel word. Proteïenoïede mikrosfere is met positiewe resultate gebruik om ingekapselde kalsitonien aan rotte en ape te lewer. By rotte het die serumkalsiumvlakke met 23 mg/ml 1 uur afgeneem na die dosering van ingekapselde kalsitonien. In teenstelling hiermee het rotte wat kontrole-kalsitonien (geen mikrosfere) ontvang het, 'n afname van slegs 6,5 mg/ml gehad [1].

Die voordeel van die gebruik van nanopartikelformulerings bo ander metodes soos liposoomformulerings is die vermoë van beheerde vrystelling bykomend tot die vermoë om geneesmiddelstabiliteit, absorpsie en teiken [44] te verbeter. Die absorpsie en weefselverspreiding van 14C-gemerkte poli (D, L-laktide-ko-glikolied) nanopartikels na orale toediening aan die muise is bepaal in vergelyking met die binneaarse roete. Die gastro-intestinale transito van die nano-deeltjies was baie vinnig, met die meeste van die radioaktiwiteit wat vinnig in die kolon verskyn het 4 uur na toediening en in die ontlasting 24 uur na toediening. Van die hoeveelheid wat deur die dermversperring geabsorbeer is (ongeveer 2%), is die meeste in die karkas en lewer gevind [16]. Nanokapsules kan verkieslik aanvanklik deur die Betaler se kolle geabsorbeer word en kan sigbaar wees in M-selle en intersellulêre ruimtes rondom limfselle. Dit blyk dat hierdie opname deur Payer se kolle veral belangrik is in die ileum. Absorpsie van nano-kapsules in die jejunum kan deur 'n parasellulêre pad plaasvind, moontlik deur die intersellulêre spasies wat gevorm word deur die afskilfering van goed gedifferensieerde absorberende selle aan die punt van die villi [16]. 'n Palmitiese ester voorgeneesmiddel van die model dwelm leucine-5-enkefalien was ingekapsuleer in chitosan amfifiliese nanopartikels. Palmitiensuur is gebruik vir die verhoging van die lipofilisiteit van Leucine-5-enkefalien wat ook die peptied in die plasma stabiliseer en chitosan amfifiliese nanopartikels is gebruik om gastroïntestinale opname te verbeter. Via die orale roete het die nano-deeltjie pro-geneesmiddel formulering die brein dwelm vlakke met 67% verhoog en leucine5-enkefalien se anti-nosiseptiewe aktiwiteit aansienlik verhoog. Die nano-deeltjies het orale absorpsie vergemaklik en die pro-geneesmiddel het plasma-afbraak verhoed wat breinaflewering moontlik gemaak het [46]. Vrye insulien het nie glukemie beïnvloed wanneer dit oraal onder dieselfde eksperimentele toestande toegedien word nie. Die dermabsorpsie van insulien en kalsitonien wat in poli-isobutielsiano-akrilaat nano-deeltjies ingekapsuleer is, is in rotte ondersoek, en die gevolglike farmakokinetiese profiele was kenmerkend van volgehoue ​​aflewering. 'n Relatief hoër plasmakonsentrasie is op die latere tydpunte gesien, maar is gebalanseer deur laer aanvanklike konsentrasies, dus was daar geen beduidende netto verbetering van absorpsie nie. Dit dui daarop dat die nano-kapsules die peptied stadig in die dermlumen vrygestel het, met klein hoeveelhede geabsorbeer [47]. Hidrogel nano-sfere wat saamgestel is uit polimeta-krilisuur-geënte poli (etileenglikol) is ook ondersoek vir orale proteïenaflewering en is gerapporteer dat dit in staat is om die hegte aansluitings tussen epiteelselle in Caco-2 sel monolae te open [48] . Dus bied ons huidige kennis 'n paar belowende benaderings oor hoe om peptiede-gebaseerde middels nie net na die plek van siekte te lewer nie, maar ook binne die teikensel vir verbeterde terapie. Tradisionele metodes van intrasellulêre aflewering, soos elektro-porsie of mikro-inspuiting is indringend en toepaslik vir in vitro eksperimente, maar nie vir kliniese toestande nie. Die gebruik van verskeie farmaseutiese nano-draers, soos liposome, wat pH-sensitiwiteit besit en in staat is om uit die endosome te ontsnap met die endositiese opname, of die modifikasie van peptied- en proteïenmedisyne met selpenetrerende peptiede, kan doeltreffende en nie-indringende intrasellulêre aflewering moontlik maak. . Alhoewel die meerderheid eksperimente met pH-sensitiewe farmaseutiese nano-draers en selpenetrerende peptied-gemodifiseerde middels en dwelmdraers nog in die pre-kliniese stadium is, kan ons die verskyning van nuwe middels en behandelingsprotokolle wat op hierdie metodes gebaseer is, verwag in die baie nabye toekoms (Figuur 2).

6.6 Ander formulering

Figuur 2:(A) Vervoermeganisme van biogeneesmiddel deur die derm-epiteelmembraan, (B) Waarskynlike meganisme van penetrasieversterker, en (C) ensieminhibeerders, (D) Verteenwoordigende meganisme van progeneesmiddelabsorpsie en die aktivering daarvan.

Verskeie formulerings is aangemeld vir die gastroïntestinale absorpsie van peptiede. Die oliefase bevat 'n lipiedsamestelling soortgelyk aan dié van chylomikrone. 'n Protinien, 'n protease-inhibeerder, sal peptiedafbraak voorkom, chilomikrone sal absorpsie in die enterosiet verbeter. Die emulsie word op draerpoeiers bedek, wat dan in harde gelatienkapsules gevul word. Die kapsules word dan enteries bedek om oplossing in die maag te voorkom. 'n Ander benadering behels nie-kovalente koppeling van die peptied aan fosfolipiede sodat die kompleks deur endositose in die enterosiete geabsorbeer kan word. Hierdie benaderings word gebruik om orale formulerings vir insulien, kalsitonien, varksomatotropien, eritropoïetien en 'n interferon te ontwikkel [48]. Orale toediening van insulien in vaste vorm aan nie-diabetiese en diabetiese honde is gepoog deur insulien met cholate en sojaboon-tripsien-inhibeerder te meng en dit oraal as enterocoated mikrotablette toe te dien. Na toediening van die geneesmiddel het plasma-insulienvlakke toegeneem en plasmaglukosevlakke het na 'n gaping van ongeveer 60 tot 140 minute afgeneem. Omdat toediening van insulien deur die orale roete lei tot die teiken van die entero-hepatiese pad, het die skrywers van hierdie studie gevoel dat hierdie of 'n soortgelyke formulering kan dien as 'n bykomende behandeling vir pasiënte met tipe II diabetes mellitus [34]. Hy et al. [49] het bioversoenbare nano-emulsies gestabiliseer deur voedselproteïene wat fenofibriensuur in vivo kan lewer. In hierdie studie is Voedselproteïene (sojaboonproteïenisolaat, weiproteïenisolaat, &beta-laktoglobulien) as stabiliseerders vir nano-emulsies gebruik om hidrofobiese middels soos fenofibriensuur te lewer. Voedselproteïengestabiliseerde nano-emulsies, met klein deeltjiegrootte en goeie grootteverspreiding, het goeie stabiliteit en biobeskikbaarheid getoon. Die nano-emulsies stel die lipofiele geneesmiddel in staat om vinniger en beter geabsorbeer te word in vergelyking met die olie-oplossing ook 'n baie beter stabiliteit is waargeneem in proteïen-gestabiliseerde nano-emulsies in vergelyking met nano-emulsies gestabiliseer met oppervlakaktiewe so voedselproteïene is lewensvatbare plaasvervangers vir tradisionele oppervlakaktiewe middels. . Daar moet kennis geneem word dat die biobeskikbaarheid van SPI-gestabiliseerde nano-emulsies dramaties groter was as dié van nano-emulsies gestabiliseer deur &beta-lg en WPI [49].

7. Gevolgtrekking

Proteïene en baie peptiede word in die spysverteringstelsel verteer. Daarom kan aktiewe proteïene en peptiede soos hormone nie mondelings toegedien word nie as gevolg van onvoldoende orale beskikbaarheid. Suksesvolle peptiedlewering deur die gastroïntestinale roete benodig 'n opeenvolging van gebeurtenisse om die verskillende penetrasie- of ensiematiese hindernisse in elke stadium te omseil. 'n Plek-spesifieke afleweringstelsel en benaderings om proteolitiese degradasie te minimaliseer word vereis. Die gebruik van penetrasieversterkers, draerstelsels, veral nuwe ontwerpte protease-inhibeerders, of chemiese modifikasie van die peptiede bied belowende benaderings om hul orale aflewering te verbeter. Die ontwerp van absorbeerbare klein peptiede wat die dermslymvlies binnedring deur die parasellulêre pad en na bloed geabsorbeer word, blyk 'n moontlike benadering te wees. Die peptied transporter1 (PEPT1) is hoofsaaklik verantwoordelik vir die absorpsie van dieet di- en tripeptiede uit die dunderm lumen. Substraat tipe interaksies deur PEPT1 is suksesvol uitgebuit met pro-geneesmiddels wat ontwerp is om peptied- en peptiedbinding-agtige dele op die ouermolekule in te voer. Dit blyk dat 'n belangrike getuie in die toekoms gerapporteer sal word oor die waardevolle effekte van klein peptiede wat saam met protease-inhibeerders, en/of chemiese modifikasie maklik op hoë vlakke uit die spysverteringskanaal geabsorbeer kan word.


Farnesoïde X-reseptor onderdruk lewermens APOA geen uitdrukking

1 Instituut vir Molekulêre Biologie en Biochemie, Sentrum vir Molekulêre Geneeskunde, en 2 Laboratorium vir Eksperimentele en Molekulêre Hepatologie, Afdeling Gastroënterologie en Hepatologie, Departement Interne Geneeskunde, Mediese Universiteit van Graz, Graz, Oostenryk. 3 Departement Kardiologie, Universiteit van Queensland, Mater Volwasse Hospitaal, Brisbane, Australië. 4 Laboratorium vir Metabolisme, Nasionale Kankerinstituut, NIH, Bethesda, VSA. 5 Afdeling Gastroënterologie en Hepatologie, Departement Interne Geneeskunde III, Mediese Universiteit van Wene, Wene, Oostenryk.

Rig korrespondensie aan: Gert M. Kostner, Instituut vir Molekulêre Biologie en Biochemie, Sentrum vir Molekulêre Geneeskunde, Mediese Universiteit van Graz, 8010 Graz, Harrachgasse 21, Oostenryk. Foon: 43.316.380.4202 Faks: 43.316.380.9615 E-pos: [email protected]

Vind artikels deur Chennamsetty, I. in: JCI | PubMed | Google Scholar

1 Instituut vir Molekulêre Biologie en Biochemie, Sentrum vir Molekulêre Geneeskunde, en 2 Laboratorium vir Eksperimentele en Molekulêre Hepatologie, Afdeling Gastroënterologie en Hepatologie, Departement Interne Geneeskunde, Mediese Universiteit van Graz, Graz, Oostenryk. 3 Departement Kardiologie, Universiteit van Queensland, Mater Volwasse Hospitaal, Brisbane, Australië. 4 Laboratorium vir Metabolisme, Nasionale Kankerinstituut, NIH, Bethesda, VSA. 5 Afdeling Gastroënterologie en Hepatologie, Departement Interne Geneeskunde III, Mediese Universiteit van Wene, Wene, Oostenryk.

Rig korrespondensie aan: Gert M. Kostner, Instituut vir Molekulêre Biologie en Biochemie, Sentrum vir Molekulêre Geneeskunde, Mediese Universiteit van Graz, 8010 Graz, Harrachgasse 21, Oostenryk. Foon: 43.316.380.4202 Faks: 43.316.380.9615 E-pos: [email protected]

Vind artikels deur Claudel, T. in: JCI | PubMed | Google Scholar

1 Instituut vir Molekulêre Biologie en Biochemie, Sentrum vir Molekulêre Geneeskunde, en 2 Laboratorium vir Eksperimentele en Molekulêre Hepatologie, Afdeling Gastroënterologie en Hepatologie, Departement Interne Geneeskunde, Mediese Universiteit van Graz, Graz, Oostenryk. 3 Departement Kardiologie, Universiteit van Queensland, Mater Volwasse Hospitaal, Brisbane, Australië. 4 Laboratorium vir Metabolisme, Nasionale Kankerinstituut, NIH, Bethesda, VSA. 5 Afdeling Gastroënterologie en Hepatologie, Departement Interne Geneeskunde III, Mediese Universiteit van Wene, Wene, Oostenryk.

Rig korrespondensie aan: Gert M. Kostner, Instituut vir Molekulêre Biologie en Biochemie, Sentrum vir Molekulêre Geneeskunde, Mediese Universiteit van Graz, 8010 Graz, Harrachgasse 21, Oostenryk. Foon: 43.316.380.4202 Faks: 43.316.380.9615 E-pos: [email protected]

Vind artikels deur Kostner, K. in: JCI | PubMed | Google Scholar

1 Instituut vir Molekulêre Biologie en Biochemie, Sentrum vir Molekulêre Geneeskunde, en 2 Laboratorium vir Eksperimentele en Molekulêre Hepatologie, Afdeling Gastroënterologie en Hepatologie, Departement Interne Geneeskunde, Mediese Universiteit van Graz, Graz, Oostenryk. 3 Departement Kardiologie, Universiteit van Queensland, Mater Volwasse Hospitaal, Brisbane, Australië. 4 Laboratorium vir Metabolisme, Nasionale Kankerinstituut, NIH, Bethesda, VSA. 5 Afdeling Gastroënterologie en Hepatologie, Departement Interne Geneeskunde III, Mediese Universiteit van Wene, Wene, Oostenryk.

Rig korrespondensie aan: Gert M. Kostner, Instituut vir Molekulêre Biologie en Biochemie, Sentrum vir Molekulêre Geneeskunde, Mediese Universiteit van Graz, 8010 Graz, Harrachgasse 21, Oostenryk. Foon: 43.316.380.4202 Faks: 43.316.380.9615 E-pos: [email protected]

Vind artikels deur Baghdasaryan, A. in: JCI | PubMed | Google Scholar

1 Instituut vir Molekulêre Biologie en Biochemie, Sentrum vir Molekulêre Geneeskunde, en 2 Laboratorium vir Eksperimentele en Molekulêre Hepatologie, Afdeling Gastroënterologie en Hepatologie, Departement Interne Geneeskunde, Mediese Universiteit van Graz, Graz, Oostenryk. 3 Departement Kardiologie, Universiteit van Queensland, Mater Volwasse Hospitaal, Brisbane, Australië. 4 Laboratorium vir Metabolisme, Nasionale Kankerinstituut, NIH, Bethesda, VSA. 5 Afdeling Gastroënterologie en Hepatologie, Departement Interne Geneeskunde III, Mediese Universiteit van Wene, Wene, Oostenryk.

Rig korrespondensie aan: Gert M. Kostner, Instituut vir Molekulêre Biologie en Biochemie, Sentrum vir Molekulêre Geneeskunde, Mediese Universiteit van Graz, 8010 Graz, Harrachgasse 21, Oostenryk. Foon: 43.316.380.4202 Faks: 43.316.380.9615 E-pos: [email protected]

1 Instituut vir Molekulêre Biologie en Biochemie, Sentrum vir Molekulêre Geneeskunde, en 2 Laboratorium vir Eksperimentele en Molekulêre Hepatologie, Afdeling Gastroënterologie en Hepatologie, Departement Interne Geneeskunde, Mediese Universiteit van Graz, Graz, Oostenryk. 3 Departement Kardiologie, Universiteit van Queensland, Mater Volwasse Hospitaal, Brisbane, Australië. 4 Laboratorium vir Metabolisme, Nasionale Kankerinstituut, NIH, Bethesda, VSA. 5 Afdeling Gastroënterologie en Hepatologie, Departement Interne Geneeskunde III, Mediese Universiteit van Wene, Wene, Oostenryk.

Rig korrespondensie aan: Gert M. Kostner, Instituut vir Molekulêre Biologie en Biochemie, Sentrum vir Molekulêre Geneeskunde, Mediese Universiteit van Graz, 8010 Graz, Harrachgasse 21, Oostenryk. Foon: 43.316.380.4202 Faks: 43.316.380.9615 E-pos: [email protected]

Vind artikels deur Levak-Frank, S. in: JCI | PubMed | Google Scholar

1 Instituut vir Molekulêre Biologie en Biochemie, Sentrum van Molekulêre Geneeskunde, en 2 Laboratorium vir Eksperimentele en Molekulêre Hepatologie, Afdeling Gastroënterologie en Hepatologie, Departement Interne Geneeskunde, Mediese Universiteit van Graz, Graz, Oostenryk. 3 Departement Kardiologie, Universiteit van Queensland, Mater Volwasse Hospitaal, Brisbane, Australië. 4 Laboratorium vir Metabolisme, Nasionale Kankerinstituut, NIH, Bethesda, VSA. 5 Afdeling Gastroënterologie en Hepatologie, Departement Interne Geneeskunde III, Mediese Universiteit van Wene, Wene, Oostenryk.

Rig korrespondensie aan: Gert M. Kostner, Instituut vir Molekulêre Biologie en Biochemie, Sentrum vir Molekulêre Geneeskunde, Mediese Universiteit van Graz, 8010 Graz, Harrachgasse 21, Oostenryk. Foon: 43.316.380.4202 Faks: 43.316.380.9615 E-pos: [email protected]

1 Instituut vir Molekulêre Biologie en Biochemie, Sentrum vir Molekulêre Geneeskunde, en 2 Laboratorium vir Eksperimentele en Molekulêre Hepatologie, Afdeling Gastroënterologie en Hepatologie, Departement Interne Geneeskunde, Mediese Universiteit van Graz, Graz, Oostenryk. 3 Departement Kardiologie, Universiteit van Queensland, Mater Volwasse Hospitaal, Brisbane, Australië. 4 Laboratorium vir Metabolisme, Nasionale Kankerinstituut, NIH, Bethesda, VSA. 5 Afdeling Gastroënterologie en Hepatologie, Departement Interne Geneeskunde III, Mediese Universiteit van Wene, Wene, Oostenryk.

Rig korrespondensie aan: Gert M. Kostner, Instituut vir Molekulêre Biologie en Biochemie, Sentrum vir Molekulêre Geneeskunde, Mediese Universiteit van Graz, 8010 Graz, Harrachgasse 21, Oostenryk. Foon: 43.316.380.4202 Faks: 43.316.380.9615 E-pos: [email protected]

Vind artikels deur Gonzalez, F. in: JCI | PubMed | Google Scholar

1 Instituut vir Molekulêre Biologie en Biochemie, Sentrum van Molekulêre Geneeskunde, en 2 Laboratorium vir Eksperimentele en Molekulêre Hepatologie, Afdeling Gastroënterologie en Hepatologie, Departement Interne Geneeskunde, Mediese Universiteit van Graz, Graz, Oostenryk. 3 Departement Kardiologie, Universiteit van Queensland, Mater Volwasse Hospitaal, Brisbane, Australië.4 Laboratorium vir Metabolisme, Nasionale Kankerinstituut, NIH, Bethesda, VSA. 5 Afdeling Gastroënterologie en Hepatologie, Departement Interne Geneeskunde III, Mediese Universiteit van Wene, Wene, Oostenryk.

Rig korrespondensie aan: Gert M. Kostner, Instituut vir Molekulêre Biologie en Biochemie, Sentrum vir Molekulêre Geneeskunde, Mediese Universiteit van Graz, 8010 Graz, Harrachgasse 21, Oostenryk. Foon: 43.316.380.4202 Faks: 43.316.380.9615 E-pos: [email protected]

Vind artikels deur Trauner, M. in: JCI | PubMed | Google Scholar

1 Instituut vir Molekulêre Biologie en Biochemie, Sentrum van Molekulêre Geneeskunde, en 2 Laboratorium vir Eksperimentele en Molekulêre Hepatologie, Afdeling Gastroënterologie en Hepatologie, Departement Interne Geneeskunde, Mediese Universiteit van Graz, Graz, Oostenryk. 3 Departement Kardiologie, Universiteit van Queensland, Mater Volwasse Hospitaal, Brisbane, Australië. 4 Laboratorium vir Metabolisme, Nasionale Kankerinstituut, NIH, Bethesda, VSA. 5 Afdeling Gastroënterologie en Hepatologie, Departement Interne Geneeskunde III, Mediese Universiteit van Wene, Wene, Oostenryk.

Rig korrespondensie aan: Gert M. Kostner, Instituut vir Molekulêre Biologie en Biochemie, Sentrum vir Molekulêre Geneeskunde, Mediese Universiteit van Graz, 8010 Graz, Harrachgasse 21, Oostenryk. Foon: 43.316.380.4202 Faks: 43.316.380.9615 E-pos: [email protected]

Vind artikels deur Kostner, G. in: JCI | PubMed | Google Scholar

Hoë plasmakonsentrasies van lipoproteïen(a) [Lp(a), wat deur die APOA gene] verhoog 'n individu se risiko om siektes te ontwikkel, soos koronêre arteriesiektes, restenose en beroerte. Ongelukkig word verhoogde Lp(a)-vlakke minimaal beïnvloed deur dieetveranderings of geneesmiddelbehandeling. Verder is die ontwikkeling van Lp(a)-spesifieke medikasie belemmer deur beperkte kennis van Lp(a)-metabolisme. In hierdie studie het ons pasiënte geïdentifiseer wat aan galobstruksies ly met baie lae plasma Lp(a) konsentrasies wat aansienlik styg na chirurgiese ingryping. In ooreenstemming met hierdie, algemene galbuis afbinding in muise transgeen vir die mens APOA (tg-APOA muise) verlaagde plasmakonsentrasies en hepatiese uitdrukking van APOA. Om te toets of farnesoïed X-reseptor (FXR), wat deur galsure geaktiveer word, verantwoordelik was vir die lae plasma Lp(a)-vlakke in cholestatiese pasiënte en muise, het ons tg-APOA en tg-APOA/Fxr –/– muise met choliensuur. FXR-aktivering het plasmakonsentrasies en hepatiese uitdrukking van menslike APOA aansienlik verminder in tg-APOA muise maar nie in tg-APOA/Fxr –/– muise. Inkubasie van primêre hepatosiete vanaf tg-APOA muise met galsure dosisafhanklik afgereguleer APOA uitdrukking. Verdere ontleding het bepaal dat die direkte herhaling 1 element tussen nukleotiede –826 en –814 van die APOA promotor het as 'n negatiewe FXR-reaksie-element gefunksioneer. Hierdie motief word ook gebind deur hepatosiet kernfaktor 4α (HNF4α), wat bevorder APOA transkripsie, en FXR is getoon om te kompeteer met HNF4α vir binding aan hierdie motief. Hierdie bevindings kan belangrike implikasies hê in die ontwikkeling van Lp(a)-verlagende medikasie.

Lipoproteïen(a) [Lp(a)] is 'n plasmalipoproteïen wat in mense en Ouwêreldse ape voorkom, maar is afwesig in konvensionele laboratoriumdiere. Plasma Lp(a)-konsentrasies is onder streng genetiese beheer en wissel van minder as 1 mg/dl tot meer as 200 mg/dl, met mediane van 8 tot 9 mg/dl (hersien in refs. 1, 2). Lp(a) is 'n komplekse plasma lipoproteïen wat gevorm word deur kovalente binding van vry APOA, wat hoofsaaklik in die lewer gesintetiseer word, met apoB-100 van lae-digtheid lipoproteïen (3). Alhoewel dit vir baie jare bekend is dat verhoogde plasma Lp(a) konsentrasies geassosieer word met trombo-aterogeniese siektes (4-6), het onlangse bewyse van groot kohorte uiteindelik 'n oorsaaklike verband bevestig (7-11). Daarom, in 'n konsensusverslag, het die Europese Aterosklerose Vereniging sifting vir Lp(a) aanbeveel by mense met 'n matige tot hoë risiko van kardiovaskulêre siekte, waarin die gewenste afsnypunt vir Lp(a) op minder as 50 mg/dl gestel is. ( 12 ).

Die trombo-atherogeniese eienskappe van Lp(a) is ook goed gedokumenteer in transgeniese muise (13, 14). Verskeie hemostatiese weë is toegeskryf aan die patomeganismes van Lp(a) (15, 16). As gevolg van sy hoë aterogenisiteit, is verskeie pogings aangewend om individue met verhoogde Lp(a)-vlakke met óf medikasie óf dieet (16), sonder sukses te behandel. Selfs al verlaag nikotiensuur en sy derivate Lp(a)-vlakke met tot 30%, word dit nie algemeen gebruik nie as gevolg van gereelde newe-effekte. Daarom is daar tot op hede geen veilige middel beskikbaar vir die behandeling van individue met verhoogde plasma Lp(a) vlakke nie, en die ontwikkeling van nuwe middels word belemmer deur 'n gebrek aan gedetailleerde kennis van beide Lp(a) biosintese en katabolisme.

Vorige omsetstudies by mense het getoon dat plasma Lp(a)-vlakke sterk korreleer met sy tempo van biosintese, maar nie met die fraksionele kataboliese tempo nie (17, 18). Dus, enige poging om plasma Lp(a) vlakke te beheer moet fokus op 'n inmenging met APOA biosintese. Dit is ondersteun deur in vivo studies met behulp van antisense strategieë waarin plasma vlakke van 'n N-terminale APOA fragment uitgedruk in muise onder die beheer van die CMV promotor is verminder tot byna nul (19). Kleinmolekulemedikasie is egter nog nie beskikbaar nie.

Die farnesoïde X-reseptor (FXR, ook bekend as NR1H4) is 'n galsuur-geaktiveerde reseptor en behoort aan die kernreseptor-superfamilie van ligand-geaktiveerde transkripsiefaktore (20-23). FXR word hoofsaaklik uitgedruk in die lewer, derm, niere en byniere. FXR heterodimeriseer met die retinoïed X reseptor (RXRa ook bekend as NR2B1), bind aan FXR respons elemente (FXREs) wat gewoonlik maar nie uitsluitlik omgekeerde herhaling-1 (IR-1) is nie, en reguleer transkripsie van teikengene (24). 'n Direkte herhaling (DR) met 'n soortgelyke kernvolgorde is ook versoenbaar vir binding van FXR, hetsy as 'n monomeer of heterodimeer (24-27). FXR speel belangrike rolle in galsuur-, cholesterol-, lipoproteïen- en trigliseriedmetabolisme. Aktivering van hepatiese FXR moduleer die uitdrukking van baie hepatiese gene wat by lipiedmetabolisme betrokke is. Studies met behulp van Fxr –/- muise het die belangrikheid van hierdie kernreseptor in die handhawing van cholesterol en galsuur homeostase geïllustreer (28, 29).

In die huidige studie rapporteer ons dat transkripsie van die APOA geen is onder sterk beheer van FXR, wat bind aan 'n negatiewe kontrole-element geleë op die -826-bp-gebied van die mens APOA promotor. Daar is gevind dat FXR inmeng met die hepatosiet kernfaktor 4α-gemedieerde (HNF4α-bemiddelde) (HNF4α is ook bekend as NR2A1) aktivering van APOA transkripsie.

Verhoogde galsuurvlakke verminder die plasma Lp(a)-vlakke by mense drasties. Ons het konsekwent in verskeie kliniese omgewings opgemerk dat pasiënte wat aan obstruktiewe geelsug ly, baie lae of selfs onopspoorbare vlakke van plasma Lp(a) toon. Om dit op 'n meer sistematiese wyse te bestudeer, is pasiënte met obstruktiewe geelsug ontleed vir merkers van cholestase, soos bilirubien, lipoproteïen X (LP-X), en plasma galsuur konsentrasies, en die resultate is gekorreleer met Lp(a) vlakke. Aanvullende Tabel 1 (aanvullende materiaal aanlyn beskikbaar met hierdie artikel doi: 10.1172/JCI45277DS1) lys die resultate van 20 pasiënte wat aan galobstruksie ly as gevolg van pankreas-, galblaas- of galbuiskanker. Daarbenewens is 1 pasiënt met aangebore galatresie en 5 pasiënte met choledocholithiasis ingesluit. Alle pasiënte het verhoogde plasma bilirubienkonsentrasies (316 ± 48 μmol/l) gehad en was positief vir plasma LP-X (370 ± 47.7 mg/dl). Die pasiënte het veral plasma totale galsuurvlakke van 98.9 ± 9.2 μmol/l gehad wat meer as 10 keer hoër was in vergelyking met dié van gesonde individue (Figuur 1A). In 13 uit 20 van hierdie pasiënte was die plasma Lp(a) konsentrasies voor terapie minder as 1 mg/dl, wat die opsporingslimiet van die spesifieke toets is. Die oorblywende 7 pasiënte het baie lae Lp(a) vlakke in verhouding tot hul APOA isovorm (K-IV herhaal). Na suksesvolle chirurgiese of endoskopiese behandeling van galobstruksie, is bilirubien, LP-X en totale galsuurvlakke genormaliseer, en Lp(a) konsentrasies het aansienlik gestyg tot vlakke wat ooreenstem met dié van gesonde kontroles met die ooreenstemmende APOA isovorme. Gemiddelde plasma Lp(a)-vlakke was 2,7 ± 1,1 mg/dl voor terapie en 20,3 ± 4,4 mg/dl na terapie (Figuur 1B).

Lae plasma Lp(a)-vlakke by pasiënte met obstruktiewe geelsug. Plasmamonsters van 20 pasiënte wat aan obstruktiewe geelsug van verskillende etiologie ly, is getoets vir (A) totale galsure en (B) Lp(a), voor en na chirurgiese of endoskopiese behandeling. Waardes word uitgedruk as gemiddelde ± SEM. Sien Aanvullende Tabel 1 vir besonderhede.

'n Cholestatiese muismodel met verhoogde galsuurvlakke toon baie lae plasma- en hepatiese uitdrukking van APOA. Om die uitwerking van obstruktiewe cholestase op plasmavlakke en hepatiese APOA-uitdrukking te bepaal, is muise transgenies vir mense APOA (tg-APOA muise) en tg-APOA muise wat Fxr-tekort was (tg-APOA/Fxr –/– muise) is vir 3 dae aan biliêre obstruksie onderwerp deur gewone galbuisligasie (CBDL). CBDL in tg-APOA muise het gelei tot aansienlik verhoogde serum lewerensieme (Aanvullende Tabel 2), totale galsure en bilirubien (Figuur 2, A en B). Die ophoping van endogene galsure in tg-APOA muise het gelei tot dramatiese vermindering van plasma APOA-vlakke met 87% (Figuur 2C) en van lewer APOA mRNA uitdrukking met 98% (Figuur 2D). CBDL in tg-APOA/Fxr –/- muise het 'n klein maar meetbare vermindering van plasma APOA met 15% en hepatiese mRNA met 19% getoon (Aanvullende Figuur 1), wat moontlik te wyte is aan inflammasie en lewerbesering. Ten slotte, lae APOA-vlakke wat in muis- en menslike cholestase gevind word, het dit voorgestel APOA uitdrukking word gereguleer deur galsure in vivo.

Drastiese vermindering in plasmavlakke en hepatiese mRNA uitdrukking van APOA in 'n muismodel van cholestase. tg-APOA muise is deur CBDL aan galobstruksie onderwerp (n = 3 per groep) of skynoperasie (n = 4 per groep) vir 3 dae. (A en B) Totale galsure en bilirubien is in serum gemeet. Data word as gemiddelde ± SD aangebied. ***P ≤ 0,001, in vergelyking met skyn-opereerde muise. (C) Plasmavlakke van APOA is deur DELFIA gemeet en word uitgedruk as gemiddelde ± SD (***P ≤ 0.001). (D) Lewer APOA mRNA-vlakke is geanaliseer deur intydse kwantitatiewe PCR genormaliseer na siklofilien en word uitgedruk relatief tot dié van skyn-opereerde muise. Resultate verteenwoordig gemiddelde ± SEM (***P ≤ 0.001).

Choliensuurvoeding verminder plasma APOA konsentrasies en hepatiese APOA uitdrukking in transgeniese APOA muise. Om regulering van die mens te bestudeer APOA geenuitdrukking deur galsure in 'n nie-cholestatiese model, tg-APOA en tg-APOA/Fxr –/- muise wat die mens uitdruk APOA gene is vir 5 dae gevoer met óf 'n normale chow-dieet (kontrole) óf 'n chow-dieet aangevul met 0.2% choliensuur (CA) (w/w). Geen veranderinge in liggaamsgewig of voedselinname is tussen kontrole en behandelde groepe waargeneem nie (data nie getoon nie). Plasma totale cholesterol en trigliseriedvlakke is verlaag in tg-APOA muise na CA-voeding maar onveranderd gebly in tg-APOA/Fxr –/- muise (Aanvullende Figuur 2). 'n 0.2%-CA-aanvulling het gelei tot 'n beduidende 72% afname in plasma APOA-vlakke in tg-APOA muise (Figuur 3A). Om te evalueer of die verlaging van plasma APOA-vlakke te wyte was aan afname APOA mRNA-vlakke in lewer, intydse kwantitatiewe PKR-analise is uitgevoer. APOA mRNA-vlakke is aansienlik verlaag in die lewers van die CA-gevoede tg-APOA muise (Figuur 3B). Western klad-analise van lewerhomogenate het bevestig dat hierdie onderdrukking ook op die proteïenvlak plaasvind by CA-voeding in tg-APOA muise (Figuur 3C). In tg-APOA/Fxr –/- muise, egter, plasma APOA konsentrasies (Figuur 3D), hepatiese APOA mRNA-vlakke (Figuur 3E), en proteïenvlakke (Figuur 3F) was vergelykbaar in kontrole en CA-behandelde muise. Saamgevat dui hierdie data daarop dat beide plasmavlakke en leweruitdrukking van menslike APOA afgereguleer word deur CA-voeding in tg-APOA muise op 'n FXR-afhanklike wyse.

CA verlaag plasmavlakke en hepatiese uitdrukking van APOA in tg-APOA muise maar nie in tg-APOA/Fxr –/– muise. tg-APOA muise (n = 8 per groep) en tg-APOA/Fxr –/– muise (n = 8 per groep) wat menslike APOA uitdruk, is gevoer met 0.2% CA (w/w) gemeng in normale voer vir 5 dae. Kontrolemuise het normale knaagdier-chow ontvang. (A en D) Plasmavlakke van APOA is deur DELFIA gemeet en word uitgedruk as gemiddelde ± SD (**P ≤ 0.01). (B en E) Muislewer APOA mRNA-vlakke is ontleed deur intydse kwantitatiewe PKR en genormaliseer na siklofilien en word uitgedruk relatief tot dié van kontrolemuise. Resultate verteenwoordig gemiddelde ± SEM (***P ≤ 0.001). (C en F) Western klad-analise en densitometriese kwantifisering van APOA-vlakke in die proteïenekstrakte van lewerweefsel (uitgedruk as gemiddelde ± SD relatief tot kontroles **P ≤ 0,01). Die geenuitdrukkingprofiel is ontleed in (G) tg-APOA muise en (H) tg-APOA/Fxr –/- muise deur intydse kwantitatiewe PCR. mRNA uitdrukking in kontrole muise is arbitrêr op 1 gestel en genormaliseer na dié van siklofilien. Resultate verteenwoordig gemiddelde ± SEM (***P ≤ 0.001, **P ≤ 0.01, *P < 0,05).

Vervolgens het ons leweruitdrukking van bekende FXR-teikengene wat betrokke is by galsuur- en cholesterolmetabolisme geprofileer na 'n 5-dae voeding van tg-APOA en tg-APOA/Fxr –/- muise met CA (Figuur 3, G en H). Soos verwag, CA-behandeling van tg-APOA muise het gelei tot 'n sterk inhibisie van beide Cyp7a1 en Cyp8b1 (30 – 32), 2.3-voudige opregulering van klein heterodimeer maat (Shp, ook bekend as NR0B2) (33), en induksie van Bsep. Geen veranderinge is waargeneem in die hepatiese mRNA uitdrukking van Lrh1 en Hnf4a. Fgf15 mRNA in die ileum is met 2,8 vou opgereguleer (34). CA voeding het nie hepatiese uitdrukking van Cyp3a11, 'n teikengeen van pregnane X-reseptor (PXR ook bekend as NR1I2) in tg-APOA muise, wat aandui dat PXR nie deur 0,2% CA in die dieet geaktiveer is nie. Daarenteen het CA-behandeling geen impak gehad op mRNA-vlakke van FXR-teikengene in tg-APOA/Fxr –/– muise, tog Cyp3a11 uitdrukking is geïnduseer (35, 36).

Galsure kan inflammasie in die lewer veroorsaak en lewerskade veroorsaak (37). Boonop word cholestase in mense en muise gekenmerk deur hoë inflammasie (38). Daarom het ons die hepatiese uitdrukking van verskeie pro-inflammatoriese gene bestudeer. 'n 0.2%-CA voeding het nie die uitdrukkingsvlakke van pro-inflammatoriese sitokiene verander nie Il6, Il1b, en Tnfa in tg-APOA muise (Aanvullende Figuur 3A), terwyl Il6 uitdrukking was 2,6-voudig verhoog in tg-APOA/Fxr –/- muise (Aanvullende Figuur 3B). Saamgevat het hierdie resultate getoon dat galsure onderdruk APOA uitdrukking deur 'n FXR-bemiddelde meganisme.

CA en GW4064 verminder menslike APOA-geenuitdrukking in primêre hepatosiete. Om die direkte meganisme van die inhiberende effek van FXR op lewer verder te bestudeer APOA uitdrukking, het ons toe die invloed van FXR-agoniste op APOA uitdrukking in primêre hepatosiete van muise. Vir hierdie doel is primêre hepatosiete geïsoleer uit tg-APOA muise en geïnkubeer met verskillende konsentrasies van die natuurlike FXR-ligand CA. Ontleding van mRNA-vlakke deur intydse kwantitatiewe PKR het 'n beduidende dosis- en tydafhanklike afname in APOA transkripsievlakke, wat 'n transkripsie-effek voorstel (Figuur 4, A en B). Western klad-analise het bevestig dat hierdie CA-gemedieerde onderdrukking ook op die proteïenvlak plaasvind (Figuur 4C). Sellewensvatbaarheid is geassesseer met die tripaanblou uitsluitingstoets, wat aan die lig gebring het dat alle konsentrasies van CA goed deur die selle verdra is (data nie getoon nie).

FXR agoniste afreguleer APOA geenuitdrukking op 'n dosis- en tydafhanklike wyse in primêre muishepatosiete. (A) Primêre muishepatosiete van tg-APOA muise is geïnkubeer met toenemende konsentrasies van CA (50, 100 en 200 μM) of voertuig (kontrole) vir 24 uur. APOA mRNA-vlakke is deur intydse kwantitatiewe PCR ontleed. Hierdie data word aangebied as gemiddelde ± SEM (**P ≤ 0.01, *P < 0,05). (B) Primêre muishepatosiete is vir 12, 24 en 48 uur met CA (200 μM) of voertuig geïnkubeer. APOA mRNA-vlakke is gemeet deur intydse kwantitatiewe PCR. Resultate verteenwoordig gemiddelde ± SEM van 3 onafhanklike eksperimente (**P ≤ 0.01). (C) Western blotting en densitometriese ontledings van APOA-uitdrukking in heelsel-lisate vanaf hepatosiete wat vir 24 uur behandel is met toenemende konsentrasies van CA (uitgedruk as gemiddelde ± SD relatief tot kontroles *P < 0,05). (D) Primêre hepatosiete is vir 24 uur met GW4064 (5 μM) behandel en ontleed vir APOA mRNA-vlakke deur intydse kwantitatiewe PKR. Hierdie data word aangebied as gemiddelde ± SEM van 3 onafhanklike eksperimente (**P ≤ 0.01). (E) Western blotting en densitometriese ontledings van APOA-uitdrukking in heelsel-lisate vanaf hepatosiete wat vir 24 uur behandel is met GW4064 (5 μM) (uitgedruk as gemiddelde ± SD relatief tot kontroles **P ≤ 0.01).

Aangesien galsure FXR-onafhanklike effekte kan uitoefen deur ander seintransduksiebane te aktiveer (39, 40), het ons ook die invloed van die sintetiese niesteroïdale FXR-agonis GW4064 op APOA geen uitdrukking. Behandeling van primêre hepatosiete met 5 μM GW4064 vir 24 uur het gelei tot 'n beduidende afname van APOA mRNA (Figuur 4D) en proteïenvlakke (Figuur 4E) in vergelyking met dié van voertuigbehandelde kontroleselle. Daarbenewens het ons die uitdrukkingsvlakke van kontrole-FXR-teikengene gemeet na behandeling met CA en GW4064 en gevind dat beide ligande toegeneem het Shp en merkbaar afgeneem Cyp7a1 en Apoa1 mRNA-vlakke (Aanvullende Figuur 4, A en B).

Oor die algemeen toon hierdie resultate aan dat beide natuurlike en sintetiese FXR-agoniste die mens afreguleer APOA uitdrukking in gekweekte muis primêre hepatosiete via 'n transkripsiemeganisme.

Kartering van 'n FXRE in die menslike APOA-promotor.Om direkte bewyse te verskaf vir die FXR-gemedieerde inhiberende effek op die APOA promotor en om relevante promotorelement(e), 'n 2-kb-fragment van die mens verder te identifiseer APOA promotor (van –1,952 bp tot +52 bp, hierin na verwys as hAPOA -1,952/+52 promotor) is in pGL3-luciferase verslaggewerplasmied gekloneer (Figuur 5A). Daarbenewens is 'n reeks 5′-skrapkonstrukte gegenereer, soos getoon in Figuur 5D. Verbygaande transfeksies is uitgevoer in HepG2-selle met die hAPOA –1,952/+52 promotorkonstruksie in die afwesigheid of teenwoordigheid van FXR- en FXR-agoniste. FXR alleen het 'n 29% afname in promotoraktiwiteit tot gevolg gehad, en hierdie effek is verder versterk deur die byvoeging van chenodeoksicholsuur (CDCA) (63%) (Figuur 5B). Net so het inkubasie met FXR en GW4064 ook die aktiwiteit van die h sterk onderdruk.APOA –1952/+52 promotor met 57% (Figuur 5C). In die afwesigheid van FXR-ooruitdrukking, het die hAPOA –1952/+52 promotor is met 25% of minder deur CDCA of GW4064 alleen geïnhibeer. Hierdie afname was waarskynlik die gevolg van die aktivering van die endogene FXR wat in HepG2-selle uitgedruk word (27).

Galsure en die niesteroïdale FXR-agonis GW4064 afreguleer die mens APOA promotoraktiwiteit via FXR. (A) Skema van die vollengte hAPOA –1,952/+52 promotorgedrewe luciferase-verslaggewerstelsel. (B en C) HepG2-selle is getransfekteer met die hAPOA –1,952/+52 promotorverslaggewerplasmied (150 ng) in die teenwoordigheid van óf die pcDNA3 (kontrole) óf FXR-uitdrukkingsvektor (150 ng). Selle is daarna behandel met CDCA (100 μM), GW4064 (500 nM), of voertuig vir 36 uur. Waardes word genormaliseer na interne beheer β-galaktosidase en uitgedruk as persentasies. Transfeksies is in drievoude uitgevoer, en elke eksperiment is ten minste 3 keer herhaal. (D) Skema van die delesiekonstrukte van die mens APOA promotor wat in die lusiferase-verslaggewertoets gebruik word. HepG2-selle is met die aangeduide mens getransfekteer APOA promotorverslaggewerplasmiede (150 ng) in die teenwoordigheid van pcDNA3-leë of FXR-uitdrukkingsvektor (150 ng). Selle is dan behandel met CDCA (100 μM) of voertuig vir 36 uur. Waardes word genormaliseer na interne beheer β-galaktosidase aktiwiteit. (E) Skema wat wilde-tipe en mutante volgordes wys. Mutasies word in vetgedrukte kleinletters aangedui. Onderstreepte letters definieer die DR-1-element. (F) Mutasie-analise van die mens APOA promotor. HepG2-selle is getransfekteer met die wilde-tipe en mutante (M1, M2) mens APOA promotorverslaggewerplasmiede in die teenwoordigheid van pcDNA3 leë of FXR-bevattende uitdrukkingsvektor (150 ng). Selle is dan behandel met CDCA (100 μM) of voertuig vir 36 uur. Waardes word genormaliseer na β-galaktosidase aktiwiteit en uitgedruk as persentasies. Data word aangebied as gemiddelde ± SD (**P ≤ 0.01, *P < 0,05).

Om endogene te vermy FXR-gemedieerde terugvoer inhibisie, verbygaande transfeksie eksperimente is uitgevoer in COS-7 selle, 'n niehepatiese sellyn. Transfeksie van COS-7-selle in die afwesigheid of teenwoordigheid van FXR het die h onderdrukAPOA –1,952/+52 promotoraktiwiteit met 24%, 'n effek wat aansienlik versterk is deur CDCA (43%) (Aanvullende Figuur 5). Hierdie eksperimente het getoon dat ektopiese uitdrukking van FXR en 'n fisiologiese konsentrasie van CDCA nodig is om die APOA promotoraktiwiteit in niehepatiese selle.

Sedert Shp is geïnduseer deur CA-behandeling in vivo en in vitro, het ons daarna die APOA promotor aktiwiteit op kotransfeksie van selle met toenemende konsentrasies van 'n SHP uitdrukking plasmied. Verbasend genoeg het SHP nie verlaag nie APOA promotoraktiwiteit, maar het dit verder verbeter (Aanvullende Figuur 6). Saamgevat het hierdie resultate getoon dat FXR kan reguleer APOA promotoraktiwiteit op 'n direkte en SHP-onafhanklike wyse.

Vervolgens, om promotorelemente wat verantwoordelik is vir die waargenome effekte van FXR te identifiseer, is HepG2-selle getransfekteer met 5′-delesiekonstrukte van die mens APOA promotor in die afwesigheid of teenwoordigheid van FXR en/of CDCA. Verminderde promotoraktiwiteite is opgemerk vir beide die –1,446-bp en –857-bp konstrukte (Figuur 5D). Die onderdrukking is egter verlig vir -757-, -657-, -477- en -148-bp-promotorkonstrukte, wat aandui dat die gebied tussen -857 bp tot -757 bp van die mens APOA promotor bevat 'n potensiële negatiewe FXRE, wat verantwoordelik kan wees vir die waargenome galsuurreaksie.

Veral, in silico Matinspector promotor analise (41) en NUBIScan algoritme (42) voorgestel die teenwoordigheid van 'n DR-1 element geleë tussen nukleotiede -826 en -814. Vorige studies het reeds getoon dat die DR-1-element as 'n FXRE kan funksioneer (24, 43, 44).

Om te toets of hierdie DR-1-werf FXR-afhanklike onderdrukking van die APOA promotor, het ons mutasies in die konteks van die vollengte hAPOA –1,952/+52 promotor (WT) en gegenereer 2 mutant konstrukte (M1 en M2), soos getoon in Figuur 5E. Mutasie (M2) van hierdie webwerf het die FXR-bemiddelde onderdrukking van heeltemal afgeskaf APOA promotoraktiwiteit (Figuur 5F), wat die binding van FXR aan die tweede helfte van die DR-1-element aandui.

Gesamentlik dui hierdie resultate daarop dat die DR-1-plek, geleë tussen nukleotiede -826 en -814, 'n negatiewe reaksie-element is waardeur FXR die mens onderdruk. APOA promotoraktiwiteit.

FXR bind aan die DR-1-plek van die APOA-promotor in EMSA. Om addisionele bewyse te verskaf dat die DR-1-element by die –826-bp-gebied van die mens APOA promotor kan funksioneer as 'n FXRE, gel shift toetse is uitgevoer. Konsensus IR-1 sonde is gebruik as 'n positiewe kontrole. FXR het die gemerkte IR-1-sonde gebind, beide in die afwesigheid (Figuur 6A, baan 3) en teenwoordigheid (Figuur 6A, baan 4) van RXR. Daarteenoor het FXR as 'n monomeer gebind aan die radio-gemerkte sonde wat 'n wildtipe DR-1 element (DR-1 WT) bevat (Figuur 6A, bane 7 en 8), maar nie aan die sonde wat die gemuteerde DR-1 element dra nie (DR -1 M2) (Figuur 6A, bane 11 en 12). Vorming van die FXR-DNA-kompleks is spesifiek gekompeteer deur koue DR-1 WT-sonde (Figuur 6B, bane 3-5), terwyl die DR-1 M2-sonde nie meegeding het nie (Figuur 6B, baan 6). Binding van FXR aan die DR-1 WT-sonde is ook bekamp deur 'n koue IR-1-sonde (Figuur 6B, baan 7), veral die koue IR-1- en koue DR-1 WT-sondes het met 'n soortgelyke doeltreffendheid gekompeteer vir die gemerkte DR -1 WT oligo. Hierdie resultate het aangedui dat FXR spesifiek aan die DR-1-plek van die mens bind APOA promotor.

FXR bind aan die DR-1 element van die mens APOA promotor as 'n monomeer. (A) EMSA's is uitgevoer met radio-gemerkte IR-1 konsensus FXRE (bane 1–4), DR-1 WT (bane 5–8), en DR-1 M2 (bane 9–12) probes met behulp van in vitro getranskribeerde/vertaalde RXR (bane) 2, 6 en 10), FXR (bane 3, 7 en 11), beide RXR en FXR (bane 4, 8 en 12), of ongeprogrammeerde retikulosiet-lisaat (bane 1, 5 en 9) soos aangedui. (B) Kompetisie-EMSA's op radio-gemerkte DR-1 WT-sonde is uitgevoer deur 50-voudige, 100-voudige, 200-voudige molêre oormaat van die aangeduide koue DR-1 WT (bane 3–5) en 50-voudige molêre oormaat koue DR by te voeg -1 M2 (baan 6) en IR-1 (baan 7) sondes. Nommering dui die relatiewe intensiteit van die bande aan.

FXR kompeteer vir HNF4α-binding aan die DR-1-element. DR-1 elemente is getoon om te funksioneer as HNF4α reaksie elemente (45). Ten einde die regulering van te ondersoek APOA geenuitdrukking deur HNF4α, het ons ooruitgedruk HNF4α in gekweekte primêre hepatosiete en het die uitdrukking van die mens bestudeer APOA geen. Soos getoon in Figuur 7A, adenovirus-gemedieerde ooruitdrukking van HNF4α in muis primêre hepatosiete van tg-APOA muise het dosisafhanklik die uitdrukking van APOA mRNA-vlakke vergelyk met LacZ-getransfekteerde selle.

Effekte van hepatosiet-kernfaktor HNF4α-ooruitdrukking op die mens APOA. (A) Primêre muishepatosiete is besmet met óf adenovirus wat vir β-galaktosidase (Ad-LacZ) óf menslike kodeer HNF4A (Ad-HNF4α). Totale RNA is onttrek, en geenuitdrukking is gemeet deur intydse kwantitatiewe PKR. Data verteenwoordig gemiddelde ± SEM. (**P ≤ 0.01). (B) HepG2-selle is getransfekteer met die hAPOA –1,952/+52 verslaggewerplasmied (150 ng) in die teenwoordigheid van toenemende hoeveelhede HNF4α-uitdrukkingsvektor. Waardes verteenwoordig gemiddelde ± SD (**P ≤ 0.01). (C) HepG2-selle is getransfekteer met die hAPOA –1,952/+52 verslaggewerplasmied in die teenwoordigheid of afwesigheid van FXR en HNF4α. Selle is dan behandel met CDCA (100 μM) of voertuig vir 36 uur. Waardes word genormaliseer na interne beheer β-galaktosidase en uitgedruk as persentasies. Waardes verteenwoordig gemiddelde ± SD (**P ≤ 0.01, *P < 0,05). (D) HNF4α bind aan die DR-1-motief in die mens APOA promotor. EMSA's met eindgemerkte DR-1 WT-sonde wat in vitro getranskribeerde/vertaalde HNF4α (bane gebruik) 2). Kompetisie-analise is uitgevoer deur 50-voudige (baan 3) en 100-voudige (baan 4) molêre oormaat van die aangeduide koue DR-1 WT-sonde by te voeg. Onderstreepte letters dui die DR-1-element aan. (E) tg-APOA muise is vir 24 uur normale chow of 0.2% CA chow gevoer, en lewers is versamel vir ChIP-ontledings. Vir ChIP-toets, is afgeskuurde chromatien immuunpresipiteer met die aangeduide teenliggaampies. Die finale DNA-ekstraksies is geamplifiseer deur PCR deur gebruik te maak van primerpare wat die distale gebied en die DR-1-motief van die APOA geen promotor. As 'n positiewe beheer vir FXR / RXR binding, die Shp geen-promotor is geamplifiseer deur PCR.

Vervolgens het ons die effek van HNF4α-ooruitdrukking op die aktiwiteit van die h bestudeerAPOA –1 952/+52 promotor. Soos in Figuur 7B getoon, het ooruitdrukking van HNF4α in HepG2-selle dosisafhanklik die mens getransaktiveer APOA promotor. Bykomende kotransfeksie met FXR- en/of CDCA-behandeling het egter die HNF4α-gemedieerde transaktivering afgeskaf (Figuur 7C). Hierdie effek kan wees as gevolg van die besetting van die HNF4α reaksie element (DR-1) deur FXR. HNF4α-gemedieerde transaktivering van die hAPOA –1,952/+52 promotor is ook waargeneem in die nie-hepatiese sellyn, COS-7, wat nóg FXR nóg HNF4α uitgedruk het. Kotransfeksie met FXR alleen of met FXR en CDCA het HNF4α transaktivering aansienlik geïnhibeer (Aanvullende Figuur 5), wat daarop dui dat FXR kompeteer met HNF4α vir die DR-1 bindingsmotief. Ons het toe 'n mobiliteitsverskuiwing-toets uitgevoer om te kyk of HNF4α aan die DR-1-element by die -826-bp-gebied van die mens bind. APOA promotor. HNF4α het gebind aan die radio-gemerkte sonde wat DR-1 WT bevat, en die proteïen-DNA-kompleks is spesifiek gekompeteer deur koue ongemerkte WT-sonde (Figuur 7D).

Saamgevat dui hierdie resultate daarop dat hierdie responselement by -826 bp deur HNF4α op die basale vlak beset kan word, terwyl galsuuraktivering lei tot 'n omskakeling van besetting van hierdie terrein deur FXR.

Om die interaksie van FXR met die DR-1-element in die verder te bevestig APOA promotor, in vivo ChIP-eksperimente is uitgevoer met lewerweefsel geïsoleer van tg-APOA muise gevoer vir 24 uur met normale chow of met chow wat 0,2% CA bevat (Figuur 7E). In die kontrolegroep het teenliggaampies teen HNF4α DNA gepresipiteer wat die DR-1-element (-826- tot -814-bp-streek) in die APOA promotor. Daarenteen het 0.2%-CA voeding gelei tot besetting van hierdie responselement deur FXR alleen sonder RXR. As 'n negatiewe kontrole het 'n ekwivalente hoeveelheid chromatien wat met 'n nie-relevante anti-IgG-teenliggaam neergesit is, geen sein tot gevolg gehad nie. Dieselfde DNA-monsters is PCR geamplifiseer deur gebruik te maak van primers wat die distale gebied van die APOA promotor, maar geen sein is waargeneem nie, terwyl 0.2%-CA-voeding die besetting van beide FXR en RXR tot die Shp promotor.

Saamgevat bewys hierdie resultate dat die DR-1-element by die –826- tot –814-bp-gebied van die mens APOA promotor kan die FXR-onderdrukking van bemiddel APOA transkripsie deur 'n kompetisie tussen FXR en HNF4α (Aanvullende Figuur 7).

Meta-ontledings van voornemende en epidemiologiese studies het 'n assosiasie van verhoogde plasma Lp(a)-vlakke met 'n verhoogde risiko vir isgemiese hartsiektes en beroerte getoon (7-11). Lp(a) word oorsaaklik geassosieer met 'n verhoogde risiko vir miokardiale infarksie en het gerapporteer dat dit die waarskynlikheid vir groot nadelige kardiovaskulêre gebeure verhoog wanneer plasma Lp(a)-vlakke 30 mg/dl met 2,3 vou oorskry (9, 46). Daarom is die ontrafeling van molekulêre en farmakologiese faktore wat Lp(a) verminder 'n nuwe doelwit, met belangrike terapeutiese en farmakologiese gevolge in die menslike bevolking. In hierdie studie het ons die galsuur-geaktiveerde reseptor FXR geïdentifiseer as 'n belangrike onderdrukker van Lp(a)-vlakke in pasiënte en muise met hoë galsuurvlakke. Terapeutiese normalisering van galsuurkonsentrasies lei veral tot verhoogde plasma Lp(a)-vlakke. Net so, galbuis afbinding in transgeniese APOA muise feitlik opgehef APOA uitdrukking. Daarom het ons veronderstel dat hoë intrahepatiese galsuur kan onderdruk APOA uitdrukking. Om stewig te demonstreer dat galsuur-geaktiveerde FXR onderdruk APOA uitdrukking in 'n meer fisiologiese toestand, het ons transgenies gevoer APOA en Fxr –/- transgenies APOA muise met galsure. Galsuurvoeding het APOA-plasmakonsentrasie sowel as geenuitdrukking en proteïenvlakke in transgenies verlaag APOA muise, 'n effek afgeskaf in Fxr –/- transgenies APOA muise. Verder, in vitro aktivering van FXR deur galsure of 'n niesteroïdale FXR-agonis verlaag APOA geenuitdrukking op 'n tyd- en dosisafhanklike wyse, as gevolg van 'n transkripsiemeganisme.

In normale individue is getoon dat plasma Lp(a)-vlakke beduidend korreleer met die sintesetempo van APOA (17, 18) en blyk minimaal deur die katabolisme daarvan beïnvloed te word. Farmakologiese FXR-aktivering kan dus 'n nuwe en belowende benadering uitmaak om hiper-Lp(a) individue te behandel en nadelige koronêre gebeure in 'n hoërisiko-populasie aansienlik te verminder. Interessant genoeg is getoon dat nuwe FXR-agoniste reeds anti-aterosklerotiese effekte in muise (47) vertoon en dislipidemie (48) normaliseer in knaagdiermodelle wat ontbreek APOA uitdrukking. Dit sal dus van belang wees om Lp(a) te meet in deurlopende menslike kliniese proewe met behulp van FXR-agoniste soos INT-747. Galsuurbindende harse, waarskynlik deur FXR-ligand uit te put en dus FXR-aktivering te verlaag, is getoon om die voorkoms van koronêre siekte te verminder (49), as gevolg van die verlaging van cholesterol en glukosurie (50). Nuwe harse met hoër galsuur-affiniteit, spesifisiteit en bindingskapasiteit is tans beskikbaar en vorm 'n veilige terapeutiese opsie, hetsy in kombinasie met HMGCoA-reduktase-inhibeerders (statiene) of in statien-weerstandige pasiënte. Ons resultate sinspeel egter op die feit dat harse en dermgalsuuropname-inhibeerders noukeurig gemonitor moet word in 'n pasiëntpopulasie met dislipidemie en potensieel verhoogde Lp(a). Omgekeerd kan die bekendstelling van Lp(a) as 'n siftingsparameter lei tot verbeterde harse sonder newe-effekte, met selfs meer kardiovaskulêre beskerming.

Daar is gevind dat FXR direk onderdruk APOA promotoraktiwiteit deur te bind aan 'n DR-1-plek wat met HNF4α gedeel word, wat lei tot onderdrukking van transkripsie. Daar is gevind dat verskeie molekulêre reguleerders aan die promotorgebied van bind en moduleer APOA. Dit sluit onder andere bindingsplekke vir HNF1, HNF4α, RXR en LINE in (51, 52). FXR word hoogs uitgedruk in die lewer en is gevind om te bind aan IR-1-reaksie-elemente in promotors as 'n heterodimeer met RXR sowel as aan verskeie DR-elemente (24), waardeur verwante teikengene getransaktiveer word. Daarbenewens kan FXR monomeriese reaksie-elemente bind en dus geentranskripsie direk onderdruk (24-27). Onlangs is die ligging en volgorde van FXRE sistematies bestudeer via ChIP en volgordebepaling (53). In hierdie werk het Chong et al. 1 656 bindingsplekke geïdentifiseer, insluitend 10% geleë in die proksimale 2 kb van die promotor. Boonop was tot 25% van hierdie FXRE's nie klassieke IR-1 nie. In ons studie, deur verslaggewertoetse, terreingerigte mutagenese, EMSA en ChIP te kombineer, het ons ondubbelsinnig 'n DR-1 geïdentifiseer wat by -826-bp stroomop van die transkripsie-beginterrein geleë is as wat ons glo 'n nuwe negatiewe FXRE is in die promotor van APOA. Hierdie webwerf is dus versoenbaar met die argitektuur van 'n bona fide FXRE. Aangesien Chong et al. 'n muislewer gebruik wat nie uitdruk nie APOA chromatien-verrykte materiaal, kon ons responselement nie in hul databasis gevind word nie. Daar is egter gevind dat die DR-1 geleë by die –826- tot –814-bp streek gebind en geaktiveer is deur HNF4α soos getoon deur transfeksie, EMSA en ChIP. Daarbenewens is HNF4α mededingend verplaas deur FXR, soos gedemonstreer in Figuur 7E. HNF4α is welbekend om betrokke te wees by lipied-, glukose- en galsuurhomeostase (54). 'n Kompetisie tussen FXR en HNF4α is voorheen gevind in die promotor van APOCIII ( 24 , 43 , 44 ). Dit is dus aanloklik om te spekuleer dat die balans tussen FXR- en HNF4α-binding op geenpromotors 'n netwerk van gene betrokke by lipiedhomeostase kan koördineer (Aanvullende Figuur 7). Die presiese meganisme vir hierdie onderdrukking, insluitend die gebeure wat betrokke is by 'n nieproduktiewe FXR-binding aan 'n responselement, vereis bykomende studies.

FXR transaktiveer ook muis Fgf15, 'n geen wat feitlik uitsluitlik in die terminale ileum uitgedruk word, en sy menslike ortoloog, FGF19, 'n geen wat in die dunderm sowel as in die lewer uitgedruk word. FGF15/19 seine van derm na die lewer om die transkripsie van sleutelensieme van galsuurbiosintese te onderdruk (34, 55). Veral, FXR-aktivering doeltreffend onderdruk APOA in vitro in primêre muishepatosiete wat nie uitdruk nie Fgf15, wat aandui dat FXR die kan reguleer APOA geen op 'n FGF15/19-onafhanklike wyse. Verdere studies sal vereis word om 'n moontlike bykomende rol van FGF15/19 in APOA geen onderdrukking.

Daarbenewens kan FXR indirek geenuitdrukking moduleer deur die induksie van Shp in die lewer (31). Alhoewel SHP 'n transkripsionele onderdrukker is, het dit geen DNA-bindingsmotief nie (56) maar interaksie met verskeie kernreseptore, soos LRH-1 of HNF4α, en daardeur inmeng met geentranskripsie. Onlangs is die SHP/LRH-1/CYP7A1 seinweg weerlê, en LRH-1 is geïdentifiseer as 'n meesterreguleerder van Cyp8b1 (57, 58).Aangesien SHP in staat is om in vitro met verskeie vennote te kommunikeer, is die identifisering van die werklike SHP-teikens steeds 'n oop soeke. Ons transgeniese APOA muise wat gevoer is met CA of primêre hepatosiete wat met FXR-aktiveerders geïnkubeer is, het meer gevind Shp en minder APOA geen uitdrukking. Ons het dus gewonder of Shp induksie kan onderdruk APOA. Dosisrespons transfeksie-eksperimente met SHP-uitdrukkingsplasmied het egter getoon dat SHP nie onderdruk nie en eerder die APOA promotoraktiwiteit in HepG2 sowel as in COS-7-selle (Aanvullende Figuur 6). Omgekeerd, FXR direk onderdruk APOA promotoraktiwiteit deur te bind aan 'n DR-1 wat ook deur HNF4α erken word. Dit is geverifieer deur ChIP-toets, wat indrukwekkend bevestig het dat die DR-1-element by die -826- tot -814-bp-gebied van die APOA promotor word deur HNF4α beset, terwyl CA-aktivering lei tot 'n omskakeling van besetting van die terrein deur FXR (Figuur 7E). Saamgevat dui ons data daarop dat SHP nie die reguleer nie APOA promotor in teenstelling met FXR.

In die lig van die huidige resultate, kan FXR-agonis 'n nuwe terapeutiese manier vorm om hiper-Lp(a)-toestande te behandel en kan dit nuttig wees in die behandeling van aterosklerotiese siekte en miokardiale infarksie. Daarbenewens dui hierdie resultate daarop dat huidige en toekomstige FXR gedeeltelike agoniste, ook genoem galsuurreseptor modulator (BARM), gemonitor moet word vir moontlike nadelige effekte op plasma Lp(a) vlakke in menslike kliniese proewe.

Chemikalieë. CA en CDCA is van Sigma-Aldrich gekoop. GW4064 is by Tocris Bioscience gekoop. Kollagenase is van Worthington Biochemical Corporation gekoop.

Pasiënte. Pasiënte wat aan obstruktiewe geelsug ly as gevolg van galstene of kwaadaardigheid is bestudeer vir merkers van galobstruksie en plasma Lp(a) konsentrasies. Bloed van pasiënte wat na chirurgie of endoskopie verwys is, is onmiddellik ontleed vir plasmavlakke van Lp(a), bilirubien, totale galsure en LP-X. Na toepaslike behandeling, omkering van geelsug en normalisering van plasma bilirubien, is plasma Lp(a) vlakke weer gemeet. Alle menslike studies is deur die etiese komitee van die Mediese Universiteit van Graz goedgekeur en is uitgevoer in ooreenstemming met die Helsinki-verklaring. Ingeligte toestemming is van alle pasiënte of hul ouers ontvang om ekstra bloed te trek om lipied- en lipoproteïenontledings uit te voer.

Analise van plasmaparameters en Lp(a) by pasiënte. Lipiede van menslike plasma is ensiematies gemeet met behulp van die toetsstelle van Roche Diagnostics. Lp(a) is deur 'n interne DELFIA-metode gekwantifiseer. Die voorbereiding van Lp(a) en APOA en die standaardisering van die Lp(a)-toets is voorheen in detail beskryf (59). Die bepaling van APOA isovorme is uitgevoer deur Western blotting soos voorheen beskryf (60). LP-X is gemeet deur standaardmetodes (61). Totale plasma galsure is ensimaties gemeet (62).

Diere-eksperimente. Alle diere-eksperimente is uitgevoer na goedkeuring van die protokol deur die Oostenrykse Federale Ministerie van Wetenskap en Navorsing, Afdeling Genetiese Ingenieurswese en Diere-eksperimente (Wene, Oostenryk). Fxr –/- muise (28) is teruggekruis vir 5 generasies met tg-APOA muise, wat 'n mens van 110 kb dra APOA geen omring deur meer as 60-kb 5'- en 3'-flankerende DNA in die YAC (63). Muise is onder 'n standaard 12-uur-lig/12-uur-donker siklus gehuisves en standaard knaagdiervoedet dieet en water ad libitum gevoer. Vroulike muise, tussen 10 en 12 weke oud, is in al die eksperimente gebruik. Vir voedingstudies, tg-APOA (n = 8) en tg-APOA/Fxr –/– muise (n = 8) wat die menslike APOA uitdruk, is in 2 groepe verdeel. Diere is gerandomiseer op grond van plasma APOA-vlakke. Een groep het 'n normale knaagdier-chow-dieet (kontrole) ontvang, terwyl die ander groep dieselfde dieet ontvang het, aangevul met 0.2% (w/w) CA vir 5 dae. By die opoffering is muise vir 4 uur gevas voordat bloedmonsters geneem is. Lewer- en ileummonsters is geoes en by –80°C gestoor tot verdere ontleding. Vir die ChIP-toets, vroulike tg-APOA muise (n = 3) is gevoer met óf normale chow (kontrolegroep) óf chow met 0.2% CA vir 24 uur. Vars geïsoleerde lewerweefsel is saamgevoeg en gebruik om chromatien te isoleer vir immunopresipitasie.

Plasmalipiedparameters in muise. Bloed is versamel deur retro-orbitale bloeding en EDTA plasma is binne 20 minute voorberei. Plasmakonsentrasies van APOA is ensiematies gemeet deur 'n interne DELFIA metode. Plasma trigliseried (DiaSys) en totale cholesterol konsentrasies (Greiner Diagnostics AG) is ensimaties bepaal volgens die vervaardiger se protokolle.

CBDL. Twaalf weke oue vroulike tg-APOA muise (n = 3–4 per groep) en tg-APOA/Fxr –/– muise (n = 3 per groep) is aan CBDL onderwerp soos voorheen beskryf (64). Kortliks, die gemeenskaplike galbuis is naby die lewer hilus, onmiddellik onder die bifurkasie, afgebind en tussen die ligature gedissekteer. Sham-opereerde diere is aan dieselfde chirurgiese prosedure onderwerp, maar sonder afbinding van die gemeenskaplike galbuis. Sera en lewers is 3 dae na die operasie vir ontleding versamel. Lewerweefsel is in vloeibare stikstof gevries vir verdere RNA voorbereidings. Serum is gestoor by –80°C tot ontleding. Serum alanien aminotransferase, aspartaat aminotransferase, alkaliese fosfatase vlakke en bilirubien is bepaal deur roetine toetsing op 'n Hitachi 917 ontleder (Boehringer Mannheim), as maatstawwe van die graad van cholestase. Totale serum galsuurvlakke is ensimaties bepaal deur gebruik te maak van die Bile Acid Kit (Ecoline S+, DiaSys Diagnostic Systems).

Selkulture. Muis primêre hepatosiete van tg-APOA muise is voorberei en gekweek soos voorheen beskryf (65), met geringe wysigings. Die muislewer is geperfuseer met kollageenase-oplossing, en lewerselle is versamel. Na filtrasie en sentrifugering is die geïsoleerde hepatosiete hersuspendeer in DMEM (Invitrogen) aangevul met 20% (v/v) FCS (Sigma-Aldrich), 100 eenhede/ml penisillien en 100 eenhede/ml streptomisien en in 6-put kollageen geplaas. -bedekte plate (BD Biosciences) teen 'n digtheid van 1 × 10 5 selle/put by 37°C in 'n atmosfeer van 5% CO2 vir 4 uur. Daarna is selle gekweek in DMEM aangevul met 10% FCS en 100 eenhede/ml penisillien/streptomisien vir 16 uur. Eksperimente is uitgevoer in serumvrye DMEM aangevul met verskeie konsentrasies van die FXR ligande CA en GW4064.

Die HepG2 en COS7 selle is verkry vanaf ATCC. Die selle is onderhou in DMEM wat 10% FCS en 100 eenhede/ml penisillien/streptomisien bevat.

RNA-ekstraksie, omgekeerde transkripsie en intydse PCR. Totale RNA van selle en muisweefsels is geïsoleer met behulp van TRI zol (Invitrogen) volgens die vervaardiger se protokol. Twee mikrogram van totale RNA is omgekeerd getranskribeer deur gebruik te maak van die Hoë-Kapasiteit cDNA Omgekeerde Transkripsie Kit (Applied Biosystems). Kwantitatiewe intydse PCR is uitgevoer op 'n Light Cycler 480 instrument (Roche Diagnostics), met behulp van die QuantiFast SYBR Green PCR Kit (Qiagen). Primer-volgordes word in Aanvullende Tabel 3 gelys. Die geenuitdrukkingwaardes is genormaliseer na siklofilien A (Ppie) as 'n huishouding geen. Die data is ontleed deur die publieke domein-program Relative Expression Software Tool (REST http://www.gene-quantification.de/download.html#rest) (66). Waardes word as gemiddelde ± SEM aangebied.

Proteïen-ekstraksie en immunoblotting. Lewers is gehomogeniseer of selle is gelys in 'n yskoue RIPA buffer. Die lysate is gesentrifugeer (12 000 g) by 4°C vir 10 minute, en die supernatant is versamel. Proteïen is gekwantifiseer deur gebruik te maak van die Bradford-proteïentoets (Bio-Rad). Ekwivalente hoeveelhede proteïenhomogenate is opgelos deur SDS-PAGE, oorgedra na 'n nitrosellulose membraan, en ondersoek met konyn poliklonale teenliggaampies teen menslike APOA (1:1,250) en 'n monoklonale anti-muis β-aktien (1:2,000) (Santa Cruz Biotegnologie) Inc.). Die immunoblots is gevisualiseer deur die Pierce ECL Chemiluminescence Detection System (Thermo Scientific). Densitometriese analise van die gels is uitgevoer met behulp van ImageJ sagteware (http://rsbweb.nih.gov/ij/). Data word as gemiddelde ± SD aangebied.

Adenovirale infeksie van primêre muishepatosiete. Primêre hepatosiete van tg-APOA muise is geïsoleer en vir 24 uur in stand gehou voor infeksie met 50 en 100 MOI van adenovirus wat vir LacZ of menslike kodeer HNF4A in serumvrye DMEM. Na 'n 4-uur infeksie, is die selle geïnkubeer in DMEM aangevul met 10% FCS vir 24 uur, gevolg deur sel-oes vir RNA-analise.

Plasmiede. Uitdrukkingsplasmiede wat hFXR (pcDNA3-FXR), hRXRa (pSG5-RXR), SHP (pCDM8-SHP) en HNF4α (pSG5-HNF4α) kodeer, is verskaf deur Peter Young (Dupont, Oakley, Kalifornië, VSA), Philippe Lefebvre (Instituut Pasteur de Lille, Lille, Frankryk), David D. Moore (Baylor College of Medicine, Houston, Texas, VSA), en Mary C. Weiss (Institut Pasteur, Parys, Frankryk), onderskeidelik. Die mens APOA promotorkonstruksie (hAPOA –1,952/+52) is verkry deur PCR-amplifikasie deur menslike genomiese DNA as 'n templaat te gebruik. Die PCR-produk is in die pGL3 basiese vektor (Promega) gekloneer as 'n MluI/BglII fragment om mens te genereer APOA- Luc. (Primers wat gebruik word is soos volg: vir voorwaartse reaksie, 5'-ACGCGTTCTGAGAGGGAGGTCAAAGTTTTC-3', en omgekeerde reaksie, 5'-AGATCTCTTGAGAAAGCCAGCCCCAAAGGT-3'.) Alle konstrukte is geverifieer deur DNA-volgordebepaling (LGC Genomics).

Verbygaande transfeksie en verslaggewergeentoetse. HepG2-selle is oornag in 24-put plate uitgeplaat voor transfeksie. Selle by 60%-70% samevloeiing is kortstondig getransfekteer met die aangeduide verslaggewerplasmied (150 ng), met of sonder reseptoruitdrukkingsplasmiede (150 ng), deur gebruik te maak van FuGENE 6-reagens (Roche Diagnostics) volgens die vervaardiger se instruksies. β-Galaktosidase uitdrukkingsplasmied is gekotransfekteer om die transfeksie doeltreffendheid te bepaal. Na 12 uur van transfeksie is medium verander, en selle is blootgestel aan die ligande (CDCA [100 μmol/l], GW4064 [500 nmol/l]) of voertuig. Na 36 uur is selekstrakte met behulp van passiewe lisisbuffer (Promega) voorberei en vir lusiferase- en β-galaktosidase-aktiwiteite getoets deur die Luciferase-toetsstelsel en die β-Galaktosidase-ensiemtoetsstelsel onderskeidelik (Promega) te gebruik. Luciferase-aktiwiteite is gemeet met Lumat LB9501 (Berthold) en genormaliseer na β-galaktosidase-aktiwiteite vir elke getransfekteerde put. Vir elke eksperimentele proef is putte in drievoud getransfekteer, en elke put is in duplikaat getoets. Data word as gemiddelde ± SD aangebied.

Terreingerigte mutagenese. Mutagenese is uitgevoer met behulp van die QuikChange Site-Directed Mutagenese System (Stratagene), volgens die vervaardiger se handleiding. Die mutante is geverifieer deur volgordebepaling. Die oligonukleotiede M1 (5'-GAGGGTTGGAAGCAAGAGGGGbyCCAACGCGCACGGGGAGGAAGC-3′) en M2 (5′-GAAGCAAGAGGGGGGCCAACbyGCACGGGGAGGAAGCATTTGGGCAG-3′) is gebruik om mutasies in die vollengte h in te voerAPOA –1 952/+52. Gemuteerde basisse word met vetdruk, kleinletters aangedui, en onderstreepte letters definieer die DR-1-element.

EMSA's. Menslike FXR, RXR en HNF4α proteïene is in vitro gesintetiseer deur gebruik te maak van die TNT T7 Quick Coupled Transcription/Translation System (Promega). Die sin- en antisense-oligonukleotiedprobes van DR-1 WT (5'-AGGGGGGCCAACGCGCACGGG-3'), DR-1 M2 (5'-AGGGGGCCAACatGCACGGG-3'), en 'n FXR IR-1-konsensusrespons-element-bevattende oligonukleotied (IRgon-u 1, 5'-GATCTCAAGAGGTCATTGACCTTTTTG-3') is uitgegloei en radioaktief aan die 5'-punt gemerk deur gebruik te maak van T4 polinukleotiedkinase en γ- 32 P-ATP (Hartmann Analytic GmbH) (gemuteerde basisse word met vetgedrukte, onderstreepletters en kleinletters aangedui, definieer die IR-1-element). Ongeïnkorporeerde nukleotiede is verwyder deur gebruik te maak van Micro Bio-Spin 6 Columns (Bio-Rad). In vitro getransleerde proteïene (2.0 μl) is vir 20 minute by kamertemperatuur in 'n totale volume van 10 μl met bindingsbuffer (Gel Shift Assay System, Promega) geïnkubeer voordat die gemerkte sonde bygevoeg is. Bindingsreaksies is verder vir 30 minute geïnkubeer en opgelos deur 6% nie-denaturerende poliakrielamiedgelelektroforese in 0.25X Tris-Borate-EDTA buffer by kamertemperatuur en 120 V vir 3.5 uur. Die jel is gedroog en aan 'n X-straalfilm blootgestel. Vir kompetisie-eksperimente is ongemerkte probes ingesluit in die bindingsreaksie by die aangeduide oormaat konsentrasies.

Chip-toets. Die in vivo ChIP-toets is uitgevoer met vars geïsoleerde muislewerweefsel met behulp van die EpiQuik Tissue ChIP Kit (Epigentek) volgens die vervaardiger se instruksies, met geringe wysigings. Lewerweefsel is vir 12 minute in formaldehied gefixeer en dan vir 5 minute met glisien geblus. Die kerne is onttrek en gesoniceer om 500- tot 1 000-bp DNA-fragmente te lewer. Porties van geskeerde chromatien is dan geïmmunopresipiteer met behulp van 4 μg anti-FXR (sc-13063 Santa Cruz Biotechnology Inc.), anti-RXR (sc-553 Santa Cruz Biotechnology Inc.), 2 μg anti-HNF4α teenliggaampie (sc-6556 Santa Cruz) Biotechnology Inc.), of 1 μg anti-IgG teenliggaampie. Nie-gepresipiteerde chromatien (insette) is as 'n positiewe kontrole gebruik. DNA ekstraksies is PCR geamplifiseer met behulp van die volgende flankerende primers, en die PCR produkte is geanaliseer deur agarose gel elektroforese: DR-1 element in die APOA promotor (DR-1 ChIP vorentoe, 5' TTGGCAGTGTTATTATTGGGAGAC 3' DR-1 ChIP agteruit, 5' ACAGGCAGTTCCATCACTCC 3'), distale gebied van die APOA promotor (distale ChIP vorentoe, 5′ TCTCCCCTTCATGTTTCCAG 3′ distale ChIP agteruit, 5′ CCAGTGGCCGACATAGAGAT 3′), en Shp promotor (Shp ChIP vorentoe, 5′GCCTGAGACCTTGGTGCCCTG 3′ Shp ChIP agteruit, 5′ CTGCCCACTGCCTGGATGC 3′).

Statistiek. Statistiese ontledings van die eksperimente is uitgevoer met GraphPad Prism 5.0. Tweestert, ongepaarde Student's t toets is toegepas om statistiese betekenisvolheid te bepaal.

Hierdie werk is ondersteun deur die Mediese Universiteit van Graz (I. Chennamsetty en A. Baghdasaryan word befonds deur die PhD-program "Molekulêre Geneeskunde"), die Oostenrykse Wetenskapfonds FWF (SFB-LIPOTOX F3004, F3008 en P19186), en die Oostenrykse Federale Ministerie van Wetenskap en Navorsing (GEN-AU-projek Genomics of Lipid-associated Disorders — GOUD). Die skrywers bedank A. Ibovnik vir uitstekende tegniese bystand.

Konflik van belange: Die skrywers het verklaar dat geen botsing van belange bestaan ​​nie.

Verwysingsinligting: J Clin Belê. 2011121(9):3724–3734. doi:10.1172/JCI45277.


Toegang opsies

Kry volledige joernaaltoegang vir 1 jaar

Alle pryse is NETTO pryse.
BTW sal later by die betaalpunt bygevoeg word.
Belastingberekening sal tydens afhandeling gefinaliseer word.

Kry tydsbeperkte of volledige artikeltoegang op ReadCube.

Alle pryse is NETTO pryse.


Erkennings

Ons bedank K Kourouniotis en G Fragiadakis vir hulp met transgenese en biochemiese toetse en C Pritchard, H Hilton en D Williams vir tegniese ondersteuning met mikroskikkings en databasisvoorlegging en R Nilsson en L Swensson vir bioanalitiese chemie van die sera. Ons gee ook erkenning aan die MRC Rosalind Franklin-sentrum (voorheen VK HGMP-hulpbronsentrum) vir die verskaffing van mikroskikkings. Hierdie werk is ondersteun deur GSRT en toelaes van die EU (QLRT-2000-01513 en LSHG-CT-2004-502950).


Kyk die video: Microbiology: Bile Esculin interpretation (Oktober 2022).